Human Papillomavirus Quasivirus Production and Infection of Primary Human Keratinocytes

Abstract

This protocol describes the production of human papillomavirus (HPV) derived quasiviruses. Quasiviruses are infectious particles that are produced in 293TT packaging cells and contain a complete viral genome. We describe methods of infection of primary human keratinocytes with HPV quasiviruses, and assays to measure early viral DNA replication and transcription.

Introduction:

Production of virus stocks and assays of infection are relatively straightforward for most well-studied viruses. In contrast, assays of papillomavirus infection are complicated by difficulties in generating sufficient quantities of infectious particles, and because the virus will only replicate in keratinocytes. In this protocol, we describe methods to produce quasiviruses, which are complete HPV genomes assembled into HPV capsids in 293TT packaging cells, as well as methods to assay the early stages of HPV infection in primary human keratinocytes. We present alternative protocols that use minicircle technology to efficiently generate supercoiled viral DNA for packaging, and that increase packaging efficiency by inducing viral genome replication in 293TT cells by co-expression of the viral E1 and E2 replication proteins.

Biosafety cautions

CAUTION: HPV quasiviruses are a potential biohazard. The appropriate Institution Biosafety Review Board should be consulted before beginning these protocols. In our Institution, the production of HPV quasiviruses is conducted under Biosafety level 2 with level 3 practices (BSL2/3). This includes rear opening lab coats, double gloves, face protection (lab goggles and a P100 respirator), and steps to minimize the generation of virus-containing aerosols. It is recommended that personnel be vaccinated against HPV when producing or using oncogenic HPV types. Importantly, HPV quasiviruses are infectious agents and all quasivirus products and materials used in their production and downstream applications should be considered infectious material. All physical manipulation should occur in a biosafety hood. After use, all disposables used to produce HPV quasiviruses should be placed in a biohazard bag and autoclaved or incinerated. Liquids should be decontaminated with 10% bleach. Surfaces and equipment should be decontaminated with 70% ethanol (Ozbun & Patterson, 2014; Roden et al., 1997). Risk can be reduced by packaging non-oncogenic HPV genomes or oncogenic viral genomes with mutations in the E6 and E7 oncogenes. Follow all appropriate guidelines and regulations for the use and handling of pathogenic microorganisms. See (Burnett, Lunn, & Coico, 2009) for more information.

Human-derived materials

CAUTION: Human tissue must be obtained with the approval of the appropriate Institutional Review Board. All human tissue should be treated as potentially infectious. Follow all appropriate guidelines and regulations for the use and handling of human-derived materials. See (Burnett et al., 2009) for more information.

Strategic Planning

Figure 1 shows an overview of the different Basic Protocols and Support Protocols, as well as some alternatives.

Figure 1. Flowchart of the protocol.

A visual overview of the entire protocol. Green boxes represent the Basic Protocols. Peach color boxes represent Support Protocols. Blue and yellow boxes represent Alternate Protocols.

Basic Protocol 1: Transfection, Harvest, and Isolation of HPV Quasiviruses

This protocol was adapted from methods used to produce pseudovirus, which are HPV capsids containing gene transfer or reporter plasmids (Buck & Thompson, 2007; Cardone et al., 2014), and describes the production of infectious papillomavirus virions containing complete viral genomes. In the HPV field, these have been named quasiviruses (Pyeon, Lambert, & Ahlquist, 2005). Briefly, 293TT cells are transfected with circular dsDNA viral genomes and plasmids expressing the viral capsid proteins L1 and L2 (and optionally the viral replication proteins E1 and E2: Alternative Protocol 1). When the L1 and L2 capsid proteins are expressed in 239TT cells, they spontaneously assemble around the viral genomes. The viral particles are extracted from the cells, allowed to mature, and purified by ultracentrifugation through a density gradient. If conducted properly, this protocol will result in the production of high titer infectious HPV quasiviruses for use in infection assays (10⁸ VGE, or viral genome equivalents). We routinely package HPV18 genomes inside HPV16 capsids because the HPV16 capsids are more infectious while the HPV18 genomes replicate more efficiently in keratinocytes (McKinney, Kim, Chen, & McBride, 2016).

Materials:

• 293TT cells (available from NCI’s Developmental Therapeutics Program)

• 293TT medium (see Solutions)

• Opti-MEM (Thermo Fisher #31985070)

• Lipofectamine 2000 (Invitrogen #11668019)

• p16SheLL (Addgene #37320) or p18SheLL (Addgene #37321)

• HPV genomes prepared using Support Protocol 1: Production of HPV Minicircles or Alternate Support Protocol 1: Production of Recircularized HPV Genomes using these plasmids:

  • Plasmid pMC.BESPX-HPV18 minicircle HPV18 (Support Protocol 1) (Henno et al., 2017)
    OR
  • Recircularized HPV18 genomes (Alternate Support Protocol 1) (Boshart et al., 1984; Cole & Danos, 1987) derived from cloned HPV genomes. HPV genomes can be requested from the HPV Reference Center

• Trypsin (Thermo Fisher #25200056)

• DPBS (Invitrogen #14040–141)

• MgCl₂ (Quality Biological #351-033-721)

• Triton X-100 (Sigma #T8787)

• Ammonium sulfate pH 9 (Sigma #204501)

• Benzonase (Millipore #70664-3)

• Plasmid Safe (Lucigen #E3110K)

• 5M NaCl (Sigma #59222C)

• DPBS + NaCl (See Solutions)

• 46% OptiPrep Solution (see Solutions)

• T75 tissue culture flask (Cellstar #658175)

• 5% and 10% CO₂ incubators, such as Heracell VIOS 160i (Thermo Fisher # 51030400)

• Serological pipettes

• 5 ml polypropylene round-bottom tubes (Corning #352063)

• 50 ml conical tubes (Corning #352070)

• Centrifuge such as Sorvall Legend XTR Centrifuge (Thermo Fisher #75004521)

• Refrigerated tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• Siliconized conical tube with screw cap (Bio Plas #4202SLS)

• Heat block such as ThermoMixer C (Eppendorf #5382000023)

• 5 ml Open-Top Thinwall Polypropylene Tubes (Beckman #326819)

• 3 ml syringe (VWR #53548–017)

• 150 mm long stainless steel needle (Kemtech #S389150)

• Sw55Ti rotor (Beckman # 342194)

• Ultracentrifuge, such as OPTIMA XPN – 90 (Beckman # A94468)

• 22 Ga needles (Monoject #15141–136)

Part 1: Transfection of 293TT cells

1. Seed six T75 flasks with 7×10⁶ 239TT cells each in 15 ml 293TT medium without antibiotics.

2. Incubate overnight in 37°C 10% CO₂ incubator.

3. For each flask prepare transfection mix as follows in 5 ml polypropylene round-bottom tubes:

   1. In one tube combine 2 ml Opti-MEM with 85 μl Lipofectamine 2000
   2. In the second tube add DNA to 2 ml Opti-MEM

      1. 19 μg minicircle HPV18 genome or recircularized HPV18 genome
      2. 19 μg p16SheLL

4. Incubate tubes separately at room temperature for 10 minutes.

5. Combine the contents of the tube of Lipofectamine and the tube of DNA, mix gently, and incubate at room temperature for 20 minutes.

6. Add the ~4 ml combined transfection reagent directly to the T75 flask of 293TT cells.

   Take care not to dislodge the cells from the plastic. From this point on, the flask of transfected 293TTs and all subsequent derivatives should be treated as infectious material. This step is best performed late in the day.

7. Incubate overnight at 37°C 10% CO₂

8. Change medium on the T75 flasks.

   It is normal to see significant toxicity from transfection. This step is best performed first thing in the morning.

9. Incubate until the following day at 37°C 10% CO₂ incubator.

Part 2: Harvest and Maturation of Quasiviruses

1. Collect medium from flasks of transfected 239TT cells in 50 ml conical tubes.

   This step ensures that any 293TT cells that detached from the flask are still collected.

2. Harvest cells by trypsinization and combine them in the 50 ml conical tube with the collected medium.

3. Wash the flasks with 5 ml DPBS and combine in the 50 ml conical tube with the collected cells.

4. Centrifuge at 200 x g for 5 minutes at room temperature.

5. Discard the supernatant.

6. Resuspend the cells in 1 ml DPBS and transfer to a siliconized, screwcap microfuge tube.

7. Wash the 50 ml conical tube with 0.5 ml DPBS and transfer to the same microfuge tube to capture any remaining cells.

8. Centrifuge samples at 5,000 x g at room temperature for 5 minutes.

9. Remove supernatant with a pipette tip and discard it.

10. Estimate the size of the pellet by pipetting DPBS into an adjacent tube.

    This volume is referred to as “pellet volume”.

11. Resuspend pellet in 1.4 pellet volumes of DPBS supplemented with 10 mM MgCl₂.

12. Add Triton X-100 to 0.5% final concentration

13. Add ammonium sulfate pH 9 to 25 mM final concentration

14. Add 10 U Plasmid Safe.

15. Add 25 U Benzonase.

16. Incubate for 16–20 hours (overnight) in a 37°C heat block, inverting after 4 hours to mix.

Part 3: Salt Extraction

1. Add NaCl to the lysate a final concentration of 850 mM.

2. Incubate on ice for 10 minutes.

3. Centrifuge at 5,000 x g for 5 minutes at 4°C.

4. Transfer the supernatant to a new siliconized tube.

5. Resuspend the pellet in two pellet volumes DPBS + NaCl. Vortex thoroughly to mix.

6. Centrifuge at 5,000 x g at 4°C for 5 minutes.

7. Transfer supernatant to the new siliconized tube from Step 4.

8. Centrifuge the combined supernatants at 5,000 x g for 5 minutes at 4°C.

9. Transfer the clarified supernatant to a new tube.

Part 4: Ultracentrifugation

1. Prepare 27%, 33%, and 39% OptiPrep solutions.

   %	Volume 46% OptiPrep (ml)	Volume DPBS + NaCl (ml)
   27	5.28	3.72
   33	6.44	2.56
   39	7.64	1.36

2. Add 1.4 ml 27% solution to each 5 ml ultracentrifuge tube using a 2 ml serological pipette.

3. Underlay with 1.4 ml 33% solution using a 3 ml syringe and a 15 cm long needle.

4. Underlay with 1.4 ml 39% solution using a 3 ml syringe and a 15 cm long needle.

5. Allow the gradients to diffuse for 1 hour at room temperature.

6. Layer the supernatant (from step 9 in Part 3: Salt Extraction) on top of the gradient using a P1000 pipetman.

7. Place each tube in a Sw55Ti centrifuge bucket and carefully screw on lid.

   Take care not to disrupt the gradients.

8. Weigh each bucket to ensure its opposite is of equal weight. Add an appropriate volume of DPBS + NaCl to the top of the gradient to balance, if necessary.

9. Centrifuge at 237,000 x g for 3.5 hours at 16°C.

   Use acceleration setting 1 and deceleration setting 2 to avoid disrupting the gradients.

10. Remove buckets from the rotor and tubes from the buckets.

    Take care not to disrupt the gradients.

11. Place a centrifuge tube in a clamp stand.

    An example of a gradient after ultracentrifugation is shown in Figure 2.

12. Place a tube rack with 10 microfuge siliconized tubes with caps removed beneath the gradient to collect the fractions.

13. Using a 22-gauge needle, pierce a small hole in the bottom of the tube.

    Do not pierce the hole on the seam; piercing just to the side of the seam will produce more consistent drops. Figure 2 shows what the gradient should look like prior to fraction collection.

14. Collect ten 200 μl dropwise fractions in each tube.

    Use an extra tube to pipette 200 μl water into a spare collection tube and mark the 200 μl level on the gradient collection tubes.

15. Dispose of the remainder of the gradient and gradient tube as infectious material

16. Take a 10 μl aliquot from each collection tube and transfer to ten new tubes to be used for screening (see Support Protocols #2 and #3).

17. Select fractions that are positive for viral proteins (see Support Protocol 2) and viral DNA (see Support Protocol 3). Combine and mix fractions (if necessary), pipette 20 μl aliquots into siliconized screw cap tubes and store at −80°C.

    In the example shown in Figure 6, fractions 7 and 8 are positive for both viral genomes and capsid proteins and are selected for the quasivirus stock.

Figure 2: Diagram of the OptiPrep gradient after ultracentrifugation.

The horizontal arrow indicates the location of a white band that contains the quasivirions in the gradient. The vertical arrow shows the direction of fraction collection from the bottom of the tube. The needle shows where the tube should be pierced (just to the side of the seam).

Figure 6. Screening of Quasivirus Fractions.

A. qPCR was performed to measure HPV18 DNA in fractions prepared by standard (Basic Protocol 1) and Ripcord (Alternative Protocol 2).

B. Total proteins in each quasivirus fractions prepared by normal (Basic Protocol 1) and Ripcord (Alternative Protocol 2) were analyzed by SDS-PAGE and SYPRO Ruby detection.

Alternate Protocol 1: Packaging HPV DNA that has Replicated in 293TT Cells

In this protocol, the viral genome is replicated inside the 293TT cells by the additional expression of the viral replication proteins E1 and E2 from co-transfected plasmids (McKinney et al., 2016). This has the advantage of increasing the total yield of viral particles in quasivirus preparations and improving the particle to infectivity ratio. Studies with other small DNA tumor viruses (SV40) have also shown that nucleosomes are assembled more authentically on replicated compared to unreplicated DNA (Cereghini & Yaniv, 1984). However, replication of the viral genomes in 239TT cells eliminates the ability to use the Replication Assay (described in Basic Protocol 4) to distinguish between replicated and unreplicated viral genomes in the host keratinocyte. The replication protocol compares the difference in input bacterial DNA (DpnI sensitive) and DNA replicated in keratinocytes (DpnI resistant). Replication of the viral DNA in the 293TT packaging cells eliminates the ability to distinguish between input and replicated DNA with this method. Therefore, quasivirions produced using Alternative Protocol 1 should only be used for Basic Protocol 3: HPV Quasivirus Transcription Assay.

This alternate protocol substitutes Part 1 from Basic Protocol 1, but all other steps are identical to Basic Protocol 1.

Materials

The only additional materials required for this Alternative Protocol are the E1 and E2 expression plasmids

• Plasmid pMEP9-HPV18 E1 (McKinney et al., 2016), available from authors.

• Plasmid pMEP4-HPV18 E2 (McKinney et al., 2016), available from authors.

Part 1: Transfection of 293TT cells

1. Seed six T75 flasks with 7×10⁶ cells each in 15 ml 293TT media without antibiotics.

2. Incubate overnight in a 37°C 10% CO₂ incubator.

3. For each flask prepare a transfection mix as follows in 5ml polypropylene round-bottom tubes:

   1. In one tube combine 2 ml Opti-MEM with 100 μl Lipofectamine 2000.
   2. In the second tube add the following amounts of DNA to 2 ml Opti-MEM

      1. 19 μg minicircle HPV18 genome or recircularized HPV18 genome
      2. 19 μg p16SheLL
      3. 6 μg pMEP9-E1
      4. 6 μg pMEP4-E2

4. Incubate the Lipofectamine and DNA tubes separately at room temperature for 10 minutes.

5. Combine the contents of the Lipofectamine and DNA tubes and incubate at room temperature for 20 minutes.

6. Add the ~4 ml of the combined transfection mix directly to the T75 flask of 293TT cells.

   Take care not to dislodge the cells from the plastic. From this point on, the flask of transfected 293TTs and all subsequent derivatives should be treated as infectious material. This step is best performed late in the day.

7. Incubate overnight at 37°C 10% CO₂.

8. Change media on the T75 flasks.

   It is normal to see significant toxicity from transfection. This step is best performed first thing in the morning.

9. Incubate in 37°C 10% CO₂ incubator until the following day.

10. Proceed with Basic Protocol 1, Parts 2–4.

    Figure 3 shows example data showing the increase in viral yield from E1/E2 transfection.

Figure 3. Titer of Quasivirus Preparations.

Quasivirus stocks were digested with nuclease to remove DNA outside of the capsid and the viral DNA was extracted and quantified by qPCR for HPV18 DNA. Shown are examples of viral genome equivalents (VGE) per μl obtained from quasivirus stocks prepared with Basic Protocol 1: Transfection, Harvest, and Isolation of HPV Quasiviruses; Alternate Protocol 1: Packaging HPV DNA Replicated in 293TT Cells; Support Protocol 1: Production of HPV Minicircles and Alternate Support Protocol 1: Production of Recircularized HPV Genomes.

Alternate Protocol 2: Production of Higher Purity Quasivirus Using the “Ripcord” Method

In this alternate protocol, the maturation and salt extraction (Parts 2 and 3 of Basic Protocol 1) are modified to increase the purity of quasivirus preparations. In standard quasivirus preparations, much of the DNA encapsidated by L1 and L2 proteins is linear DNA (<8 kb) fragments from the 293TT host genome (Buck, Pastrana, Lowy, & Schiller, 2005). In this alternate protocol, the DNases used in Basic Protocol 1 are omitted during the maturation step, thus preventing the purification of virions containing linearized pieces of host DNA. In addition, the concentration of salt is lower during the extraction, and this reduces the number of immature particles that remain in the supernatant in Part 3 (Salt Extraction). Combined, these modifications result in a higher ratio of viral genomes to viral particles, which appreciably improves infectivity. However, quasivirus stocks prepared via this method have a 10–100-fold drop in titer. This method was coined the “Ripcord” method by its inventor, Chris Buck. https://ccrod.cancer.gov/confluence/display/LCOTF/Ripcord

Materials:

• Trypsin (Thermo Fisher #25200056)

• 293TT medium (see Solutions)

• DPBS (Invitrogen #14040–141)

• MgCl₂ (Quality Biological #351-033-721)

• Triton X-100 (Sigma #T8787)

• RNase-It (Agilent #400720)

• Ammonium sulfate pH 9 (Sigma #204501)

• Dry Ice

• Ethanol

• DPBS + NaCl (see Solutions)

• 50 ml conical tubes (Corning #352070)

• Centrifuge such as Sorvall Legend XTR Centrifuge (Thermo Fisher #75004521)

• Refrigerated tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• Siliconized conical tube with screw cap (Bio Plas #4202SLS)

• Heat block such as ThermoMixer C (Eppendorf #5382000023)

Part 1 (same as Basic Protocol 1)

Part 2: Harvest and Maturation of Quasiviruses

1. Collect medium from flasks in a 50 ml conical tube.

   This step ensures that any 293TT cells that detached from the flask are still collected.

2. Harvest cells by trypsinization and combine them in the 50 ml conical tube with the collected medium.

3. Wash the flasks with 5 ml DPBS and combine with the collected cells.

4. Centrifuge at 200 x g for 5 minutes at room temperature.

5. Discard the supernatant.

6. Resuspend the cells in 1 ml DPBS and transfer to a siliconized, screwcap microfuge tube.

7. Wash the 50 ml conical tube with 0.5 ml DPBS and transfer it to the same microfuge tube.

8. Centrifuge the samples at 5,000 x g at room temperature for 5 minutes.

9. Remove supernatant with a pipette and discard.

10. Estimate the size of the pellet by pipetting DPBS into an adjacent tube.

    This volume is referred to as the “pellet volume”.

11. Resuspend the pellet in 1.5 pellet volumes DPBS supplemented with 10 mM MgCl₂.

12. Add Triton X-100 to 0.5% final concentration.

13. Add ammonium sulfate pH 9 to 25 mM final concentration.

14. Add 2 ng RNase A and 5 U RNase T1 (in the form of 1 μl RNase-IT).

15. Incubate for 16–20 hours in a 37°C heat block, inverting after 4 hours to mix.

Part 3: Salt Extraction

1. Centrifuge for 5 minutes at 5,000 x g at 4°C.

2. Transfer the supernatant to a new siliconized tube.

   The supernatant will only be a few microliters and may be difficult to pipette due to viscosity. This is normal.

3. Resuspend pellet in two pellet volumes DPBS.

4. Centrifuge at 5,000 x g for 5 minutes at 4°C.

5. Transfer the supernatant to the new siliconized tube from Step 2.

6. Resuspend the pellet in one pellet volume DPBS. Vortex thoroughly to mix.

7. Flash freeze by placing the tubes in a dry ice-ethanol bath for 5 minutes.

8. Thaw the pellet completely at room temperature.

9. Centrifuge for 5 minutes at 5,000 x g at 4°C.

10. Transfer the supernatant to the new siliconized tube from Step 2.

11. Resuspend the pellet in one pellet volume DPBS + NaCl.

12. Centrifuge for 5 minutes at 5,000 x g at 4°C.

13. Transfer the supernatant to the new siliconized tube from Step 2.

14. Centrifuge the combined supernatants at 5,000 x g for 5 minutes at 4°C.

15. Transfer the clarified supernatant to a new tube.

16. Proceed with Basic Protocol 1, Part 4.

    Tip: “Ripcord” quasiviruses can be used at five to ten-fold lower Multiplicity of Infection (MOI) compared to traditional quasivirus preparations.

Support Protocol 1: Production of HPV Minicircles

The use of HPV minicircles vastly simplifies and streamlines the production of HPV genomes for use in quasivirus production by removing the digestion and religation steps. Additionally, it has the benefit of removing the bacterial vector and generating supercoiled circular viral genomes. If performed correctly, the user should expect large amounts of covalently closed circular 8 kb HPV genomes.

Materials:

• Plasmid pMC.BESPX-HPV18 minicircle HPV18 (Henno et al., 2017)

• Competent E. coli ZYCY10P3S2T (Systems Biosciences # MN900A-1)

• SOC medium (Thermo Fisher #15544034)

• LB-Kanamycin Plates (Sigma #L0543–10EA)

• Lysogeny broth (Gibco #10855–021)

• Kanamycin (Sigma #K0254)

• Terrific broth (Thermo Fisher #A1374301)

• Arabinose induction solution (20%) (System Biosciences #MN850A-1)

• Sodium hydroxide (Sigma # S2770)

• NucleoBond Xtra Maxi Plus EF Maxi kit (Machery Nagel #740426.50)

• BglII restriction enzyme (NEB #R0144S)

• NEB CutSmart Buffer (NEB #B7204S)

• Gel Loading Dye, Purple (6X) (NEB #B7024S)

• SeaKem GTG Agarose (Lonza #50074)

• Ethidium Bromide, 10 mg/ml (Invitrogen #15585011)

• TAE Buffer (Tris-acetate-EDTA) (50X) (Thermo Fisher #B49)

• Water bath set to 42°C

• 14 ml Round Bottom High Test Tube (Corning #352059)

• Bacterial shaker

• Bacterial incubator

• Baffled glass 2L culture flasks (Corning #431256)

• Biophotometer (Eppendorf #6133000010), or another spectrophotometer

• Cuvettes for Biophotometer (Eppendorf #0030079353)

• Agarose gel running apparatus

• UV light box

• Imager, such as SynGene G:BOX

• Wizard Plus SV Minipreparations DNA Purification System (Promega # A1465)

• Tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

Part 1: Transformation of E. coli ZYCY10P3S2T

1. Add 50 ng pMC.BESPX-HPV18 to a vial of competent E. coli ZYCY10P3S2T and mix gently.

2. Incubate on ice for 30 minutes.

3. Heat shock by placing a tube in a 42°C water bath for 30 seconds.

4. Incubate on ice for 2 minutes.

5. Transfer the transformed cells into a 14 ml tube with 950 μl SOC medium.

6. Shake at 225 rpm for 1 hour at 37°C.

7. Spread 20 μl culture on an LB plate containing 50 μg/ml kanamycin.

8. Incubate overnight at 37°C.

Part 2: Bacterial Culture

1. Pick a single, well isolated colony and inoculate a 5 ml culture of LB containing 50 μg/ml kanamycin.

2. Shake at 225 rpm for 5 to 8 hours at 37°C.

3. Inoculate 200 ml terrific broth with 50 μl starter culture in a two-liter beveled flask.

   This volume can be changed to any amount to scale the preparation. Expect roughly 1 μg minicircle DNA per 1 ml of culture.

4. Shake at 225 rpm for 8 hours to overnight at 37°C.

Part 3: Induction

1. Add 100 μl overnight culture to 900 μl LB.

   Diluting the culture ten-fold is necessary to get an accurate OD₆₀₀ reading.

2. Measure the OD₆₀₀ of the 1:10 diluted culture using a Biophotometer.

   The OD₆₀₀ of the overnight culture should be between 4–8. If it is too high, the protocol should be restarted for optimal results.

3. Transfer 1.5 ml of the culture to a microfuge tube and purify plasmid DNA using the Wizard Plus SV Miniprep Kit according to the manufacturer’s instructions.

   Save the DNA at 4°C. This will be referred to as the “pre-induction” sample.

4. Add a volume of the induction mix (1X LB containing final concentrations of 0.04N NaOH and 0.02% L-Arabinose) according to the OD₆₀₀ of the culture.

   If the OD₆₀₀ is between 4–6, use the same volume (200 ml) of the induction mix.

   If the OD₆₀₀ is between 6–8, use double the volume (400 ml) of the induction mix.

5. Shake the culture for 6–8 hours at 225 rpm at 32°C.

6. Transfer 1.5 ml of the culture to a microfuge tube and purify plasmid DNA using the Wizard Plus SV Miniprep Kit according to the manufacturer’s instructions.

   This will be referred to as the “post-induction” sample.

7. Centrifuge the remainder of the culture at 5,000 x g for 10 minutes at 4°C.

8. Pour off the supernatant and discard it. Store the pellet on ice until successful induction and minicircle recombination is confirmed (see Part 4).

Part 4: Confirming Recombination of the Minicircle

1. Assemble two 20 μl restriction digest reactions to confirm full induction:

   1. 500 ng of pre-induction sample, 1X CutSmart Buffer, 10 U BglII
   2. 500 ng of post-induction sample, 1X CutSmart Buffer, 10 U BglII

2. Digest for 60 minutes at 37°C.

3. Prepare undigested samples in 20 μl total volume.

   1. 500 ng of pre-induction sample, 1X CutSmart Buffer
   2. 500 ng of post-induction sample, 1X CutSmart Buffer

4. Add 4 μl of Gel Loading Dye to each sample.

5. Separate all samples by electrophoresis on a 0.8% agarose gel in TAE buffer containing 0.5 μg/ml EtBr.

6. Image on UV lightbox.

   If induction and recombination are complete proceed with Part 5. Figure 4 shows an example of a successful induction and recombination. If successful, post-induction samples should run as ~8 kb covalently closed circles (~with 5–6 kb marker) in the uncut (lane 3) and have no remaining bacterial vector in the digested sample (lane 4). The upper bands in lane 3 are multimers of the HPV genome. It is possible to enrich for the monomers by gel purification (Henno et al., 2017).

Figure 4. Production of HPV18 Minicircles.

A. Map of pMC.BESPX-HPV18

B. Agarose gel showing pMC.BESPX-HPV18 DNA before and after induction. E. coli ZYCY10P3S2T transformed with pMC.BESPX-HPV18 were induced to generate minicircles. Plasmid DNA isolated before and after induction were digested with BglII. DNAs were separated on a 0.8% TAE agarose gel and imaged on a UV lightbox. Lane 1: Pre-induction pMC.BESPX-HPV18 undigested; lane 2: pre-induction pMC.BESPX-HPV18 digested; lane 3: post-induction pMC.BESPX-HPV18 undigested; lane 4: post-induction pMC.BESPX-HPV18 digested. CCC-covalently closed circular DNA.

Part 5: Extraction of Minicircle HPV Genomes

1. Isolate minicircle DNA with NucleoBond Xtra Maxi Plus EF Maxi kit using the manufacturer’s instructions.

Alternate Support Protocol 1: Production of Recircularized HPV Genomes

This protocol, adapted from (Wilson & Laimins, 2005), describes the generation of ~8 kb recircularized HPV genomes for use in the production of HPV quasiviruses. This protocol can be used in place of Support Protocol 1, if HPV minicircle plasmids are not available. The principle behind this protocol is to restriction digest the HPV genome from the bacterial plasmid and perform a dilute ligation to promote intra-molecular ligation to generate covalently closed circular genomes that can be packaged into quasivirus particles.

Materials

• HPV genome such as pUC-HPV18 (Cole & Danos, 1987) or pBR-HPV18 (Boshart et al., 1984) (HPV genomes can be acquired from The HPV Reference Center)

• NcoI (50,000 U/ml) (NEB #R0193T), EcoRI (20,000 U/ml) (NEB# R0101L) or other enzyme to release viral genome from the bacterial vector

• NEB CutSmart Buffer (NEB #B7204S)

• QIAquick PCR Purification Kit (Qiagen #28104)

• Gel Loading Dye, Purple (6X) (NEB #B7024S)

• SeaKem GTG Agarose (Lonza #50074)

• Ethidium Bromide (Invitrogen #15585011)

• TAE Buffer (Tris-acetate-EDTA) (50X) (Thermo Fisher #B49)

• T4 DNA ligase (400,000 U/ml) (NEB #M0202S)

• 10X T4 DNA Ligase Reaction Buffer (NEB #B0202S)

• Isopropanol (Sigma #190764)

• 5M NaCl (KD Medical #RGF-3270)

• 70% Ethanol

• TE pH 8.0 (Quality Biological #351-011-131)

• Heat block capable of cooling such as ThermoMixer C (Eppendorf #5382000023) or 16°C water bath in a cold room

• Refrigerated tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• Agarose gel running apparatus

1. Prepare a 50 μl restriction digestion reaction to free HPV18 from the bacterial plasmid backbone containing 10 μg pUC-HPV18, 1X CutSmart Buffer, and 50 U NcoI. Alternatively, pBR-HPV18 is digested with EcoRI.

   Perform multiple 10 μg reactions to scale up. Expect 25–50% yield. Each 293TT transfection requires 19 μg of DNA.

2. Incubate at 37°C for 60 minutes.

3. Heat inactivate enzyme by incubating at 80°C for 20 minutes.

   If the enzyme cannot be heat-inactivated, use a DNA cleanup kit to remove the enzyme.

4. Take 1 μl aliquot of the digest (0.2 μg) and transfer it to a separate tube. Combine with 7.3 μl H₂O and 1.7 μl Purple Gel Loading Dye and separate by electrophoresis on a 0.8% agarose TAE gel containing 0.5 μg/ml of EtBr. Image on UV lightbox and confirm digestion is 100% complete before proceeding to Step 5.

5. Prepare a 900 μl ligation reaction with 49 μl of digested DNA, 90 μl of 10X Ligation Reaction Buffer, 400 U of T4 Ligase, and 580 μl H₂O.

6. Incubate overnight at 16°C.

7. Precipitate DNA by adding 180 μl of 5M NaCl and 600 μl isopropanol. Mix well.

8. Incubate overnight at −20°C.

9. Allow sample to warm to room temperature.

   This will make the solution less viscous and facilitate pelleting the DNA by centrifugation.

10. Centrifuge at 16,000 x g for 30 minutes at 4°C.

11. Remove supernatant.

12. Wash pellet gently with 100 μl 70% ethanol.

13. Centrifuge at 16,000 x g at 4°C for 30 minutes.

14. Remove supernatant.

15. Allow pellet to air dry briefly.

16. Dissolve pellet in 15 μl TE.

17. Combine 1 μl of a sample with 7.3 μl H₂O and 1.7 μl Purple Gel Loading Dye.

18. Separate ligation products by electrophoresis on a 0.8% agarose TAE gel containing 0.5 μg/ml EtBr.

19. Image on UV lightbox.

    Example data of the recircularized genome is shown in Figure 5.

Figure 5. Traditional HPV genome recircularization.

A. Map of pUC-HPV18 showing the NcoI sites used to remove the vector and recircularize the viral genome.

B. Agarose gel showing a comparison of uncut, digested and religated viral DNA. Lane 1: uncut pBR-HPV18; Lane 2, pBR-HPV18 restriction digested to free the HPV genome from plasmid backbone; Lane 3: pBR-HPV18 fragments ligated under dilute conditions to promote intramolecular recombination. Samples were separated on a 0.8% agarose TAE gel containing 0.5 μg/ml EtBr and imaged on a UV imager.

Support Protocol 2: Screening of Fractions for Viral Proteins

The purpose of this protocol is to identify which gradient fractions from Basic Protocol 1 are positive for the viral capsid proteins L1 and L2. The proteins in each fraction are separated by SDS-PAGE and detected with the total protein stain, SYPRO Ruby.

Materials

• Quasivirus Fractions from Basic Protocol 1, Part 4, Step 16

• 4X LDS Sample Buffer (Thermo Fisher #NP0007)

• 1 M DTT

• 26 well NuPage 4–12% Bis-Tris acrylamide gel (Thermo Fisher #WG1403BOX)

• 20X MOPS running buffer (Thermo Fisher #NP0001)

• SYPRO Fixation Buffer

  • 50% Methanol
  • 7% Acetic acid

• SYPRO Ruby (Thermo Fisher #S12000)

• SYPRO Wash Buffer

  • 10% Methanol
  • 7% Acetic acid

• Heat block

• Gel running apparatus

• Perfect Western container, black, extra-large (GeneHunter #B110)

• Imager with appropriate excitation source and filters to detect SYPRO Ruby

1. Combine 9 μl each fraction with LDS Sample Buffer and DTT to final concentrations of 1X and 50 mM, respectively.

2. Heat for 10 minutes at 72°C in a heat block.

3. Prepare 26 well NuPAGE 4–12% Bis-Tris Midi Protein Gels in a gel running apparatus filled with 1 L 1X MOPS running buffer.

4. Load each fraction sample and electrophorese at 150V until the dye front reaches the bottom of the gel.

5. Remove the gel from running apparatus and cassette and transfer to a Perfect Western container.

6. Completely cover the gel with SYPRO Fixation Buffer (approximately 100 ml) and incubate for 30 minutes on an orbital shaker in a low setting.

7. Pour off the fixation buffer and add SYPRO Ruby until the gel is completely covered (approximately 40 ml).

   Cover in foil to protect from light.

8. Place on an orbital shaker on a low setting overnight at room temperature.

9. Wash the gel twice for 1 minute each with 150 ml SYPRO Wash buffer.

10. Wash briefly with H₂O.

11. Image on a Syngene with UV box at 254 nm wavelength and appropriate filter to detect SYPRO Ruby.

12. Once fractions are selected, they are pooled and stored as described in Basic Protocol 1, Part 4, Step 17.

    Figure 6B shows example data. Fractions 7 and 8 are positive for HPV16 L1 and L2 proteins in both normal and “Ripcord” quasivirus preparations. In the normal fractions (from Basic Protocol 1), fractions 7 and 8 also contain cellular histones. Note that in the “Ripcord” samples (from Alternate Protocol 2), the levels of histones are extremely low.

Support Protocol 3: Screening of Fractions for Viral DNA

The purpose of this protocol is to identify fractions that are positive for HPV DNA by qPCR.

Materials

• Quasivirus Fractions from Basic Protocol 1, Part 4, Step 16

• Molecular Biology Grade Water (Corning #46–000-CM)

• Yeast tRNA (Invitrogen #AM7119)

• Plasmids pUC-HPV18 (Cole & Danos, 1987) or pBR-HPV18 (Boshart et al., 1984)

• HPV18 DNA Primers

  • Forward: CACAATACTATGGCGCGCTTT (nt 96 to 116)
  • Reverse: CCGTGCACAGATCAGGTAGCT (nt 162 to 142)

• FastStart Universal SYBR Green Master (Roche #4913914001)

• PCR Strip tubes (Denville #C18063)

• Optical 384-Well Reaction Plates (Life Technologies #4309849)

• QuantStudio 7 Flex Real-Time PCR System or equivalent (Thermo Fisher #4485701)

1. Dilute 1 μl each fraction in 99 μl H₂O, mix well.

2. Prepare standard curves of HPV18 DNA by performing 10-fold serial dilutions of pUC-HPV18 from 1 × 10⁻¹ ng/ul ng/ul to 1 × 10⁻⁸ ng/ul in 0.1 mg/ml yeast tRNA in a PCR strip tube.

3. Assemble 10 μl reactions in a 384 well plate with 1X FastStart Universal SYBR Green Master Mix, 750 nM HPV18 DNA primers, and 2.5 μl diluted fractions or HPV standard curve. Each reaction should be assembled in triplicate.

4. Perform qPCR with the following temperature cycles

   Stage	Temperature (°C)	Time (min:sec)	Cycles
   1	50	2:00	1
   2	95	10:00	1
   3	95	0:15	40
   4	60	1:00
   5	95	0:15	1
   6	60	1:00	1
   7	95	0:15	1

5. At the end of the run, use the standard curve to calculate the quantity of HPV DNA in each fraction.

6. Select positive fractions, pool, and store as described in Step 17 of Part 4 of Basic Protocol 1.

   Figure 6A shows example data in which fractions 6–10 are positive for HPV18 DNA in both the standard (Basic Protocol 1) and “Ripcord” (Alternate Protocol 2) quasivirus preparations. Note that the quantity of HPV18 DNA detected is ~40-fold lower in the Ripcord samples.

Support Protocol 4: Measuring Viral Titer the pooled fractions of

In this protocol, the quasivirus stocks consisting of the pooled fractions are quantified by measuring the Viral Genome Equivalents by qPCR. To ensure that the quantification measures only fully packaged viral DNA, virions are first treated with nuclease to remove any DNA that is outside the capsid.

Materials

• Quasivirus stock from Part 4, Step #16 of Basic Protocol 1

• TURBO DNA-free Kit (Invitrogen #1907)

• Capsid Digest Buffer (see Solutions)

• QIAquick PCR Purification Kit (Qiagen #28104)

• Yeast tRNA (Invitrogen #AM7119)

• Plasmid pUC-HPV18 (Cole & Danos, 1987)

• Primers against HPV18 DNA

  • Forward: CACAATACTATGGCGCGCTTT (nt 96 to 116)
  • Reverse: CCGTGCACAGATCAGGTAGCT (nt 162 to 142)

• FastStart Universal SYBR Green Master (Roche #4913914001)

• PCR Strip tube (Denville #C18063)

• Optical 384-Well Reaction Plate (Life Technologies #4309849)

• Heat block such as ThermoMixer C (Eppendorf #5382000023)

• Tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• QuantStudio 7 Flex Real-Time PCR System or equivalent (Thermo Fisher #4485701)

1. Digest quasivirus sample with Ambion DNase-free Kit. We recommend assembling triplicate reactions for increased precision.

   1. 5 μl virus prep
   2. 2 μl 10X DNase I buffer
   3. 1 μl (2 U) rDNase I
   4. 12 μl nuclease-free H₂O

2. Incubate at 37°C for 30 minutes.

3. Add 2 μl DNase Inactivation Reagent and mix well.

4. Incubate at room temperature for 2 minutes.

5. Centrifuge at 10,000 x g for 1.5 minutes.

6. Transfer 16 μl to a fresh microfuge tube.

7. Add 100 μl Capsid Digest Buffer.

8. Incubate for 20 minutes at 50°C.

   This will free the packaged viral DNA from the virion.

9. Isolate viral DNA using the QIAquick PCR Purification Kit. Elute into 50 μl.

10. Quantify amount (in ng) HPV DNA in isolated DNA sample by performing qPCR for HPV DNA using the standard curve as described in Steps 2–4 of Support Protocol 3.

11. Calculate amount (in ng) HPV DNA in the original quasivirus virus sample.

    Remember to factor in a dilution factor of 5x to account for dilution of the sample during isolation and qPCR.

12. Calculate the quasivirus preparation titer (in Viral Genome Equivalents) per μl.

    Each ng of the 7857 bp HPV18 genome is equal to 1.18×10⁸ viral genome equivalents (VGE). Figure 3 shows example data.

Support Protocol 5: Quantitation of Quasivirions

This protocol is used to determine the number of viral particles in the quasivirus stock by measuring the mass of protein compared to a standard curve of bovine serum albumin (BSA)

Materials

• Bovine Serum Albumin Standard Ampules, 2 mg/ml (Thermo Fisher #23209)

• 4X LDS Sample Buffer (Thermo Fisher #NP0007)

• 1 M DTT

• 2X SDS Sample Buffer

  • 2% (w/v) SDS (KD Medical #REGE-3230)
  • 20 mM Tris (Quality Biological #351-007-101)
  • 2 mM EDTA (Quality Biological #351-027-101)

• Quasivirus stock from Part 4 Step #16 of Basic Protocol 1

• 20-well NuPAGE 4–12% Bis-Tris Midi Protein Gels (Thermo Fisher #WG1402BOX)

• 20X MOPS running buffer (Thermo Fisher #NP0001)

• Perfect Western container, black, extra-large (GeneHunter #B110)

• Fixation Buffer

  • 50% Methanol
  • 7% Acetic acid
• Wash Buffer

  • 10% Methanol
  • 7% Acetic acid

• SYPRO Ruby (Thermo Fisher #S12000)

• Heat block

• Gel running apparatus

• Power source

• Imager with appropriate excitation source and filters to detect SYPRO Ruby

1. Prepare a standard curve of BSA from 1000 ng/μl to 50 ng/μl.

   Tube #	Final Concentration (ng/μl)	Volume (μl) BSA 2000 μg/ml	Volume 2x SDS Sample Buffer (μl)	Volume H2O (μl)
   1	1000	200	200	0
   2	750	150	200	50
   3	500	100	200	100
   4	250	50	200	150
   5	125	25	200	175
   6	25	5	200	195
   7	0	0	200	200

2. Prepare each BSA standard for denaturing and loading.

   Component	Volume (μl)
   BSA Standard	1
   SDS Sample Buffer	9.5
   4X LDS	3.75
   1M DTT	0.75

3. Prepare quasiviruses stock for denaturing and loading.

   Component	Volume (μl)
   Quasivirus	10
   SDS Sample Buffer	0.5
   4X LDS	3.75
   1M DTT	0.75

4. Heat all standards and samples for 10 minutes at 72°C.

5. Prepare 20 well NuPAGE 4–12% Bis-Tris Midi Protein Gels in a gel running apparatus filled with 1 L 1X MOPS running buffer.

6. Load each sample and electrophorese at 150V until the dye front reaches the bottom of the gel.

7. Remove the gel from running apparatus and cassette and transfer to Perfect Western container.

8. Completely cover the gel with SYPRO Fixation Buffer (approximately 100 ml) and incubate for 30 minutes on an orbital shaker in a low setting.

9. Pour off the fixation buffer and add SYPRO Ruby until the gel is completely covered (approximately 40 ml).

   Cover in foil to protect from light.

10. Place on an orbital shaker on a low setting overnight at room temperature.

11. Wash the gel twice with 150 ml SYPRO Wash buffer for 1 minute each.

12. Wash briefly with H₂O.

13. Image on a Syngene with UV box at 254 nm wavelength and appropriate filter to detect SYPRO Ruby.

14. Calculate the intensity of each BSA standard and the L1 of the quasivirus sample using Gene Tools Software (or similar).

15. Calculate ng of L1 per μl quasivirus stock using the BSA standard curve

16. Calculate the number of virions

    Each ng of HPV16 L1 is equal to 2.97×10⁷ virion particles.

    Figure 7 shows example data of quantitation of HPV quasivirus virions.

Figure 7. Quantitation of Virions in HPV Quasivirus Preparations.

The amount of L1 protein in quasivirus stocks was calculated with reference to a BSA standard curve.

A. Image of an SDS-polyacrylamide gel stained with SYPRO Ruby.

B. Standard curve of BSA protein concentrations as measured by SYPRO Ruby intensity

C. The concentration of virions in quasivirus stocks prepared by Basic Protocol 1: Transfection, Harvest, and Isolation of HPV Quasiviruses; Alternate Protocol 1: Packaging Viral DNA Replicated in 293TT Cells; Support Protocol 1: Production of HPV Minicircles and Alternate Support Protocol 1: Production of Recircularized HPV Genomes.

Basic Protocol 2: Infections of Primary Human Foreskin Keratinocytes with Quasivirus

In this protocol, the HPV quasiviruses produced in Basic Protocol 1 are used to infect primary human foreskin keratinocytes (HFKs). The early viral activity can be quantified by the Transcription Assay (Basic Protocol 3) and Replication Assay (Basic Protocol 4).

Materials:

• J2 media (DMEM-10) (see Solutions)

• 3T3-Swiss albino J2 mouse embryonic fibroblasts (ATTC #CCL-92)

• Versene™ (Thermo Fisher #15040066)

• Phosphate Buffered Saline (1X) without Calcium and Magnesium (Lonza #17–516F)

• Trypsin (Thermo Fisher #25200056)

• Primary, low passage, neonatal human foreskin keratinocytes (ATCC# PCS-200–010) or similar

• Rheinwald-Green F-medium (see Solutions)

• Quasivirus stock (from Basic Protocol 1)

• 12 well tissue culture plate (Corning #3513)

• Gamma irradiator or Mitomycin C (Sigma #M4827)

• 5% and 10% CO₂ Incubator, such as Heracell VIOS 160i (Thermo Fisher # 51030400)

• Biosafety hood

• Light microscope

• Serological pipettes

• Rocker at 4–8°C (cold room)

• Centrifuge such as Sorvall Legend XTR Centrifuge (Thermo Fisher #75004521)

• Cellometer Auto T4 Bright Field Cell Counter (Nexcelom)

Part 1: Culture of J2 fibroblasts and HFKs

1. Culture J2 fibroblasts in J2 medium using standard sub-culturing techniques. Cells should be passed at a ratio of 1:4 to 1:5 about every five days and they should be low passage. They should be cultured in a 37°C incubator in 10% CO_2.

2. Co-culture HFKs with the irradiated J2 feeder cells. Plate 1×10⁶ irradiated feeders on a 10 cm dish and allow them to attach and spread overnight in a 37°C incubator in 10% CO_2.

3. Change the medium to Rheinwald-Green medium and plate 3×10⁵ HFKs onto the feeder monolayer. Change the medium every two days until cells are ~70% confluent. They should be cultured in a 37°C incubator in 5% CO₂.

4. Remove feeders by adding 10 ml Versene to the plate and repeatedly pipetting the Versene across the surface of the monolayer. Aspirate the Versene/feeders and rinse the monolayer with PBS.

5. Harvest HFKs by adding 3 ml trypsin to the keratinocyte monolayer and incubating at 37°C until cells begin to detach (do not over trypsinize). Neutralize trypsin with 3 ml Rheinwald-Green medium and count cells.

6. Centrifuge the keratinocytes at 250 x g for 5 minutes. Resuspend in the Rheinwald-Green medium at 1×10⁶ cells/ml.

Part 2: Infection of HFKs

Each quasivirus stock should be used to infect duplicate wells.

1. Harvest J2 cells by trypsinization and resuspend at 1×10⁶ cells/ml.

2. Irradiate J2 cells in suspension with a dose of 6000 Rads.

   Alternatively, J2 fibroblasts can be rendered mitotically inactive by treatment with 8 μg/ml Mitomycin C for three hours followed by extensive washing with PBS.

3. Plate 8×10⁵ lethally irradiated J2 fibroblasts in J2 media across a 12 well plate (6.67×10⁴ cells/well, 1 ml media/well).

4. Incubate overnight in a 37°C incubator at 10% CO₂ to allow cells to adhere and spread.

5. Remove medium and plate 6×10⁵ HFKs across a 12 well plate (5×10⁴ HFKs/well, 1 ml media/well).

   Plate one extra well (referred to as the “counting well”) of HFKs to be used for counting the number of cells per well at the time of infection.

6. Incubate overnight in a 37°C incubator at 5% CO_2.

7. Observe keratinocytes by light microscopy at 24 hours, and up to 48 hours, after plating to evaluate the optimal time for infection.

   The keratinocytes should be in small colonies of 6–12 cells. The goal is to have many small clusters of cells, as the cells need to divide to facilitate infection. See Figure 8 for an example of optimal colony formation.

8. Count the number of cells in the “counting well” as described in Part 1, Steps 3–4.

   It will be necessary to resuspend the cells in a small volume (100–500 μl) to get an accurate reading.

9. Calculate the amount of virus needed for the desired MOI for each well.

   An MOI of 100 is advisable for traditional quasivirus preparations whereas an MOI of 10 is generally enough for “Ripcord” quasivirus stocks to get detectable levels of viral transcription and replication by 48 hours post-infection (hpi).

10. Mix the calculated amount of quasivirus with the Rheinwald-Green medium.

    For each well to be infected, use 400 μl Rheinwald-Green medium.

11. Remove the 12 well plate of keratinocytes from the incubator and aspirate the medium.

12. Add 400 μl virus/ Rheinwald-Green F media mix to each well.

13. Rock the plate for 60 minutes at 4°C.

14. Return the plate to the biosafety hood and add 0.6 ml Rheinwald-Green F medium.

15. Incubate the plate in a 37°C incubator in 5% CO₂ until the desired collection time (usually 24, 48, 72 and 96 hpi).

    By 96 hpi, the cells will likely be confluent, so it is not advisable to take timepoints beyond this time.

16. 15 Proceed to extract RNA or DNA as described in Basic Protocols 3 and 4.

Figure 8. Human Keratinocytes in Co-culture Prior to Infection.

6×10⁵ primary HFKs were co-cultured with lethally irradiated J2–3T3 fibroblasts in a 12-well plate for 24 hours. White arrows indicate colonies suitable for infection.

Basic Protocol 3: HPV Quasivirus Transcription Assay

In this protocol, RNA is harvested from infected keratinocytes and viral transcripts are quantitated by RT-qPCR.

Materials

• HFKs infected with HPV18 quasivirus from Basic Protocol 2

• Versene™ (Thermo Fisher #15040066)

• Phosphate Buffered Saline (1X) without Calcium and Magnesium (Lonza #17–516F)

• RNeasy Mini Kit (Qiagen #74106)

• β-Mercaptoethanol (Sigma # 63689)

• QIAshredder homogenizer (Qiagen #79656)

• TURBO DNA-free Kit (Invitrogen #1907)

• Qubit™ RNA BR Assay Kit (Life Technologies #Q19219)

• RNA 6000 Nano Kit (Agilent #5067–1511)

• RNase ZAP (Thermo Fisher # AM9780)

• Transcriptor First Strand cDNA Synthesis Kit (Roche #04897030001)

• FastStart Universal SYBR Green Master (Roche #4913850001)

• Yeast tRNA (Invitrogen #AM7119)

• Plasmid pUC57-HPV18E1Ê4 (HPV18 E1Ê4 cDNA for standard curve) (Stepp, Meyers, & McBride, 2013). It can be obtained from the authors.

• HPV18 E1Ê4 primers

  • Forward: CAACAATGGCTGATCCAGAAGTAC (nt 907 to 3436)
  • Reverse: TAGGTCTTTGCGGTGCCC (nt 3535 to 3518)

• Plasmid pUC57-HPV18E6*I (HPV18 E6*I cDNA for standard curve) (Stepp et al., 2013). It can be obtained from the authors.

• HPV18 E6*I primers

  • Forward: CAAGACAGTATTGGAACTTACAGAGGTG (nt 208 to 408)
  • Reverse: CTGGCCTCTATAGTGCCCAGC (nt 515 to 495)

• pCMVsport6-TBP (human TBP cDNA for standard curve) (Open Biosystems #MHS6278–202802567)

• TATA Binding Protein Primers

  • Forward: TAAACTTGACCTAAAGACCATTGCA (nt 605 to 629)
  • Reverse: CAGCAAACCGCTTGGGATTA (nt 672 to 653)

• Tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• Qubit 3.0 Fluorometer (Life Technologies #Q33216)

• PCR strip tubes

• 2100 Bioanalyzer Instrument (Agilent #G2939BA)

• QuantStudio 7 Flex Real-Time PCR System or equivalent (Thermo Fisher #4485701)

Part 1: Extract RNA

1. Aspirate the medium from wells.

2. Add 1 ml Versene per well.

3. Remove the feeders by gently pipetting the Versene across the cell monolayer.

4. Aspirate the Versene.

5. Wash the well with 500 μl PBS to remove any residual feeders.

6. Add 350 μl Qiagen Buffer RLT + 1% β-Mercaptoethanol to each well.

   Qiagen Buffer RLT is from the RNeasy Mini Kit.

7. Allow the cells to lyse for 30 seconds.

8. Collect the lysate by pipetting into a QiaShredder.

   Scraping is not necessary.

9. Centrifuge at 16,000 x g for 2 minutes at room temperature.

   Stopping point: samples can be stored indefinitely at −80°C in the QiaShredder.

10. Extract RNA with the RNeasy Mini Kit according to the manufacturer’s instructions.

    Perform the optional on-column DNase digestions to remove any DNA. Perform the optional centrifugation step at full speed with a new collection tube to remove residual ethanol. Elute into 30 μl RNase-free H₂O.

11. Stopping point: RNA can be stored indefinitely at −80°C.

    If the quantification of unspliced viral transcripts is desired, additional DNase digestions may be needed. Use the TURBO DNase kit to remove any remaining DNA.

12. Use the Qubit 3.0 and Qubit BR RNA kit to quantify RNA according to the manufacturer’s instructions.

13. Normalize RNA to 100 ng/μl using RNase free H₂O.

14. Measure RNA integrity with the RNA 6000 Nano Kit according to the manufacturer’s instructions.

    If RIN values are acceptable (8.0 or above) proceed to Part 2.

Part 2: cDNA Synthesis

1. Prepare a 20 μl cDNA synthesis reaction with 1 μg RNA for each sample using Transcriptor First Strand cDNA Synthesis Kit.

   Follow the manufacturer’s instructions to perform cDNA Synthesis with oligo(dT)18 primer and random hexamer primers.

2. Dilute the cDNA by adding 30 μl H₂O and mixing it well.

3. For each sample, the amounts of the following transcripts should be quantified:

   1. Viral transcript E1Ê4
   2. Viral transcript E6*I
   3. Normalizing cellular transcript, TBP

4. Prepare standard curves for E1Ê4, E6*I, and TBP by assembling 10-fold serial dilutions of pUC57-HPV18E1Ê4, pUC57-HPV18E6*I, and pCMVsport6-TBP from 1 × 10⁻¹ ng/μl ng/μl to 1 × 10⁻⁸ ng/μl in 0.1 mg/ml yeast tRNA in a PCR strip tube

5. Perform qPCR as described in Support Protocol 3.

6. Calculate the amount of each transcript using the standard curves.

7. Normalize the amount of each viral transcript with the corresponding value for TBP in that sample.

   Figure 9A shows example data.

Figure 9. Assays of Viral Transcription and Replication after Quasivirus Infection.

A. Duplicate wells of HFKs were infected with HPV18 Quasivirus (prepared by Basic Protocol 1) at an MOI of 100. RNA was collected at 24, 48, 72, and 96 hpi. RT-qPCR for viral transcripts E1Ê4 (left) and E6*I (right) was performed to quantitate viral transcription. Error bars represent the standard deviation of replicate wells.

B. Duplicate wells of HFKs were infected with HPV18 Quasivirus (prepared by Basic Protocol 1) at an MOI of 100. DNA was collected at 24, 48, 72, and 96 hpi. DNA was digested with DpnI before using qPCR for HPV18 DNA to quantitate viral replication. Error bars represent the standard deviation of replicate wells.

Basic Protocol #4: HPV Quasivirus Replication Assay

In this protocol, DNA is harvested from infected keratinocytes and newly replicated viral genomes are quantified by removing input DNA with DpnI digestion before qPCR. The DpnI restriction enzyme will digest DNA methylated by the dam bacterial methylase (viral genomes grown in E. coli and packaged in HPV quasiviruses). The reverse qPCR primer in this assay spans a DpnI site and only DNA that has replicated in eukaryotic cells will be resistant to cleavage. This enables specific quantitation of viral DNA that has replicated inside the host keratinocyte.

Materials

• HFKs infected with HPV18 quasivirus from Basic Protocol 2

• Versene™ (Thermo Fisher #15040066)

• Trypsin (Thermo Fisher #25200056)

• Rheinwald-Green F-medium (see Solutions)

• DNeasy Blood & Tissue Kit (Qiagen # 69506)

• 3M Sodium acetate, pH 5.2

• 90% Ethanol

• TE pH 8.0 (Quality Biological #351-011-131)

• DpnI (NEB # R0176S)

• NEB CutSmart Buffer (NEB #B7204S)

• FastStart Universal SYBR Green Master (Roche #4913850001)

• Yeast tRNA (Invitrogen #AM7119)

• Plasmid pMA-RPPH1 (contains a 341bp region from the RNase P gene) for standard curve)

• DpnI resistant HPV18 DNA primers

  • Forward: CACAATACTATGGCGCGCTTT (nt 96 to 116)
  • Reverse: CCGTGCACAGATCAGGTAGCT (nt 162 to 142)
• RNase P primers

  • Forward: CGGAGGGAAGCTCATCAGTG
  • Reverse: TGGCCCTAGTCTCAGACCTT

• Optical 384-Well Reaction Plate (Life Technologies #4309849)

• Tabletop centrifuge such as Centrifuge 5415R (Eppendorf #5401000137)

• Heat block such as ThermoMixer C (Eppendorf #5382000023)

• Nanodrop 2000 or equivalent (Thermo Fisher # ND-2000)

• QuantStudio 7 Flex Real-Time PCR System or equivalent (Thermo Fisher #4485701)

1. Aspirate the medium from infected cells in the 12 well plate.

2. Add 1 ml Versene per well.

3. Remove the feeders by gently pipetting the Versene on the bottom of the well.

4. Aspirate Versene.

5. Add 0.5 ml trypsin per well

6. Incubate for several minutes in a 37°C incubator.

7. Neutralize the trypsin with 0.5 ml Rheinwald-Green medium per well.

8. Collect cells in a sterile microfuge tube.

9. Centrifuge at 300 x g for 5 minutes.

10. Remove the supernatant with a pipette tip.

11. Resuspend cells in 1 ml PBS.

12. Centrifuge at 300 x g for 5 minutes.

13. Remove the supernatant with a pipette.

    Stopping point: cell pellets can be flash-frozen in a dry ice ethanol bath and stored at −80°C indefinitely.

14. Use the DNeasy Blood & Tissue Kit to isolate DNA according to the manufacturer’s instructions.

    Elute into 200 μl and repeat the elution step twice, combining elutants (final volume 400 μl).

15. Add 40 μl 3M Sodium acetate, pH 5.2

16. Add 1320 μl 90% ethanol and mix well.

17. Incubate 30 minutes on ice.

18. Centrifuge 5 minutes at 16,000 x g at room temperature. Discard supernatant.

19. Add 100 μl 90% ethanol to the pellet.

20. Centrifuge 5 minutes at 16,000 x g at room temperature. Discard the supernatant and allow the pellet to briefly air dry.

    Pellet should be dry, but still translucent, not white (overdried).

21. Dissolve pellet in 50 μl TE Buffer.

22. Quantitate the DNA sample using a Nanodrop 2000 or equivalent.

23. Normalize 1 μg DNA to 100 ng/μl using H₂O.

24. Prepare two reactions for each sample:

    1. A 20 μl DpnI restriction digestion with 500 ng DNA, 10 U DpnI, and 1X CutSmart Buffer
    2. A 20 μl mock digestion with 500 ng DNA and 1X CutSmart Buffer

25. Incubate the reactions for 90 minutes at 37°C in a heat block.

26. Heat inactivate enzyme by incubating for 20 minutes at 80°C in a heat block.

27. Dilute the digested DNA to a final volume of 50 μl by adding 30 μl H₂O.

28. Prepare standard curves for HPV18 DNA and RNase P by performing 10-fold serial dilutions of HPV18 genome and pMA-RPPH1 to from 1 × 10⁻¹ ng/μl to 1 × 10⁻⁸ ng/μl in 0.1 mg/ml yeast tRNA.

29. Prepare qPCR 10 μl reactions for HPV18 DNA:

    1. 1X FastStart Universal SYBR Green Master
    2. 750 nM HPV18 DNA Primers
    3. 2.5 μl DpnI and mock digested DNA or standard curve
30. Prepare qPCR 10 μl reactions for RNase P:

    1. 1X FastStart Universal SYBR Green Master
    2. 750 nM RNase P Primers
    3. 2.5 μl mock digested DNA or standard curve
       Do not prepare an RNase P qPCR reaction for the DpnI digested samples.

31. Run qPCR as described in Support Protocol 3.

32. Calculate the amount of HPV18 DNA and RNase P in each sample using the standard curves.

    The amount of HPV18 DNA detected from samples digested with DpnI is referred to as “replicated” and the mock digested samples as “total”.

• 8. Normalize the amount of viral DNA with the corresponding value for RNase P in that sample.

  Example data is shown in Figure 9B.

Reagents/Solutions

• 293TT media

  • 10% Fetal bovine serum (Thermo Fisher Hyclone #SH30071.03)
  • 2 mM L-Glutamine (Invitrogen #25030081)
  • 100 U/ml Penicillin, 100 μg/ml Streptomycin (Invitrogen #15140–163)
  • 1X non-essential amino acids (Thermo Fisher #11140050)
  • 1 mM sodium pyruvate (Life Technologies #11360–070)
  • 0.33 mg/ml Hygromycin B (Roche #10843555001)
  • Can be stored for two weeks at 4°C
• 46% OptiPrep Solution

  • 46% OptiPrep (#Sigma D1556)
  • 1X PBS (Thermo Fisher #70011044)
  • 650 mM NaCl
  • 920 μM CaCl₂
  • 520 μM MgCl₂
  • 2 mM KCl
  • Should be made fresh each time
• Capsid Digest Buffer

  • 20 mM Tris-HCl, pH 8 (Quality Biological #351-007-101)
  • 20 mM DTT
  • 20 mM EDTA (Quality Biological #351-027-101)
  • 0.5% (w/v) SDS (KD Medical #REGE-3230)
  • 0.2% Proteinase K (Qiagen #19133)
  • Should be made fresh each time
• DPBS + NaCl

  • 1X PBS (Thermo Fisher #70011044)
  • 650 mM NaCl
  • 920 μM CaCl₂
  • 520 μM MgCl₂
  • 2 mM KCl
  • Can be stored 1–2 months at room temperature
• J2 media (DMEM-10)

  • DMEM (Invitrogen #11960–069
  • 10% Normal Calf Serum (Hyclone #SH30072.03)
  • 2 mM L-Glutamine (Invitrogen #25030081)
  • 100 U/ml Penicillin, 100 μg/ml Streptomycin (Invitrogen #15140–163)
  • Can be stored for two weeks at 4°C
• Rheinwald-Green F-medium

  • 3:1 F12 (Invitrogen #11765–062)/DMEM (#11960–069)
  • 5% Fetal bovine serum, FBS (Thermo Fisher Hyclone SH30071.03)
  • 2 mM L-Glutamine (Invitrogen #25030081)
  • 0.4 μg/ml hydrocortisone (Sigma #H4001)
  • 8.4 ng/ml cholera toxin (Calbiochem #227036)
  • 10 ng/ml EGF (Invitrogen #PHG0311)
  • 24 μg/ml adenine (Sigma #A-2786)
  • 5 μg/ml insulin (Gemini #700–112P)
  • 100 U/ml Penicillin, 100 μg/ml Streptomycin (Invitrogen #15140–163)
  • Can be stored for two weeks at 4°C

Commentary

Background

There are several types of papillomavirus particle preparations, each with its advantages and drawbacks. Virions can be isolated from human or animal wart tissue but, while these particles are physiologically relevant, they are difficult to acquire in large and reproducible quantities. Furthermore, no manipulation of the viral particle or genome is possible. Alternatively, “raft” virions can be isolated from keratinocytes infected with papillomavirus and grown in organotypic raft culture (Ozbun & Patterson, 2014). The advantage of using this method is the ability to produce physiologically relevant viruses. However, the ability to mutate the viral genome is limited; the genome must be fully capable of going through the entire lifecycle by itself to produce virion particles. Lastly, using 293TT producer cells, several types of papillomavirus virions can be made. Virus Like Particles (VLPs) are invaluable for vaccine and antibody binding studies but do not contain viral genomes and cannot be used for infection assays. Pseudoviruses are 293TT-produced L1–L2 particles encapsulating reporter plasmids and are commonly used to study viral entry and neutralization. However, they do not contain viral genomes and thus cannot be used to study viral DNA replication or transcription. Quasiviruses are similar to pseudoviruses, but they contain a viral genome and are thus a broadly applicable tool to study all stages of the viral lifecycle. As the capsid and replication proteins are provided in trans, any part of the virion can be modified including major changes to the genome, chromatin, and capsids.

Critical Parameters

Basic Protocol 1: it is critically important that the cells are resuspended at high concentration during the maturation step.

Basic Protocol 2: it is essential that the cells are in small colonies and not too confluent at the time of infection; the cell must divide for the infection to succeed.

Trouble Shooting

Basic Protocol 1: If the fractions appear disordered on the protein screen, the gradient was likely disturbed after ultracentrifugation. Try reducing the acceleration and deceleration settings on the centrifuge and handling the gradients very carefully.

Support Protocol 1: If recombination is not complete, it is likely that the OD₆₀₀ at the time of induction was too high or that the induction time was insufficient.

Basic Protocols 3 and 4: If there are very low levels of viral transcription and replication, the infection was likely insufficient. This can be remedied by ensuring the keratinocytes are not too confluent, and are at low pass, at the time of infection or by increasing the MOI.

TIME CONSIDERATIONS:

Protocol	Total time	Details
Support Protocol 1: Production of HPV Minicircles	4 days	Day 1: 2 hours
		Day 2: 30 minutes
		Day 3: 8 hours
		Day 4: 2 hours
Alternate Support Protocol 1: Production of Recircularized HPV Genomes	3 days	Day 1: 1.5 hours
		Day 2: 15 minutes
		Day 3: 2 hours
Basic Protocol 1: Transfection, Harvest, and Isolation of HPV Quasiviruses	6 days	Day 1: 30 minutes
		Day 2: 1 hour
		Day 3: 30 minutes
		Day 4: 1.5 hours
		Day 5: 6 hours
		Day 6: 1 hour
Alternate Protocol 1: Packaging HPV DNA Replicated in 293TT Cells	1 day	Day 1: 1 hour
Alternate Protocol 2: Production of Higher Purity Quasivirus Using “Ripcord” Method	2 days	Day 1: 1.5 hours
		Day 2: 1.5 hours
Support Protocol 2: Screening of Fractions for Viral Proteins	2 Days	Day 1: 3 Hours
		Day 2: 30 minutes
Support Protocol 3: Screening of Fractions for Viral DNA	1 day	Day 1: 3 hours
Support Protocol 4: Measuring Viral Titer	1 day	Day 1: 4 hours
Support Protocol 5: Quantitation of HPV Quasivirions	2 Days	Day 1: 3 hours
		Day 2: 30 minutes
Basic Protocol 2: HPV Quasivirus Infections of Primary Human Foreskin Keratinocytes	3 days, not including time points post-infection	Day 1: 1 hour
		Day 2: 30 minutes
		Day 3: 2 hours
Basic Protocol 3: HPV Quasivirus Transcription Assay	1 day	Day 1: 5 hours
Basic Protocol 4: HPV Quasivirus Replication Assay	1 day	Day: 6 hours