Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2020 Jun 3.
Published in final edited form as: Stem Cell Res. 2019 Sep 11;40:101575. doi: 10.1016/j.scr.2019.101575

Generation and characterization of six human induced pluripotent stem cell lines (iPSC) from three families with AP4B1-associated hereditary spastic paraplegia (SPG47)

Julian Teinert a,1, Robert Behne a,1, Angelica D’Amore a, Miriam Wimmer a, Sean Dwyer b, Teresa Chen b, Elizabeth D Buttermore b, Ivy Pin-Fang Chen b, Mustafa Sahin a,b, Darius Ebrahimi-Fakhari a,*
PMCID: PMC7269118  NIHMSID: NIHMS1589475  PMID: 31525725

Abstract

Bi-allelic variants in the subunits of the adaptor protein complex 4 lead to childhood-onset, complex hereditary spastic paraplegia (AP-4-HSP): SPG47 (AP4B1), SPG50 (AP4M1), SPG51 (AP4E1), and SPG52 (AP4S1). Here, we describe the generation of induced pluripotent stem cells (iPSCs) from three AP-4-HSP patients with compound-heterozygous, loss-of-function variants in AP4B1 and sex-matched parents. Fibroblasts were reprogrammed using non-integrating Sendai virus. iPSCs were characterized according to standard protocols including karyotyping, embryoid body formation, pluripotency marker expression and STR profiling. These first iPSC lines for SPG47 provide a valuable resource for studying this rare disease and related forms of hereditary spastic paraplegia.

Resource utility

These iPSC lines are the first human disease model of AP-4-HSP and provide a valuable resource to study adaptor protein complex 4 biology, disease mechanisms and therapeutic interventions.

Resource details

The hereditary spastic paraplegias are a group of > 80 neurodegenerative diseases and the most common cause of inherited spasticity and associated disability (Blackstone, 2018). Here, we focus on prototypical yet poorly understood forms of complex hereditary spastic paraplegia in children caused by bi-allelic variants in genes that encode subunits of the adaptor protein complex 4 (AP-4-HSP): SPG47 (AP4B1); SPG50 (AP4M1), SPG51 (AP4E1), and SPG52 (AP4S1) (Ebrahimi-Fakhari et al., 2018b). AP-4 is a heterotetrameric protein complex that selectively incorporates transmembrane cargo proteins into vesicles and mediates their intracellular transport. Recently, several groups identified the core autophagy protein ATG9A as the major cargo of AP-4 (Davies et al., 2018; De Pace et al., 2018), linking loss of AP-4 function to defective autophagy. To understand AP-4 deficiency in patient derived cells, we created iPSC lines from three well-characterized patients with AP4B1-associated AP-4-HSP (or SPG47) (Ebrahimi-Fakhari et al., 2018a) and sex-matched parents as controls. The AP4B1 variants present are nonsense, missense, frameshift or canonical splice site mutations leading to no functional protein. Fibroblasts were obtained by standard punch biopsy and reprogrammed using non-integrating Sendai virus to overexpress OCT4, SOX2, KLF4 and hc-MYC. All iPSC lines recovered well after thawing (Fig. 1A, scale bar 400 μm). For each line, one clone was selected based on expression of pluripotency markers and differentiation potential. Pluripotency was assessed by immunofluorescence staining for OCT4, Nanog, SSEA4 and Tra-1–60 (Fig. 1B, scale bar 300 μm) as well as qRT-PCR of NANOG, OCT4, REX1, and SOX2 (Fig. 1D). All iPSC lines showed robust expression of pluripotency markers. To examine the potential to differentiate into all three germ layers, embryoid bodies from iPSC lines were tested for expression of ectodermal (EN1, MAP2 and NR2F2), mesodermal (SNAI2, RGS4 and HAND2) and endodermal (SST, KLF5 and AFP) markers using qRT-PCR (Fig. 1E). Karyotype analysis showed normal karyotypes and no clonal abnormalities (Fig. 1C). STR analysis for 16 short tandem repeat markers (Table 2) showed identical profiles for iPSC lines with their respective fibroblast line. To verify AP4B1 variants in iPSC lines, Sanger sequencing was performed (Fig. 1F). Mycoplasma testing using a standard assay (MycoAlert™) was negative.

Fig. 1. Figure 1.

Fig. 1.

Table 2.

Characterization and validation.

Classification Test Result Data
Morphology Photography Normal Fig. 1 panel A
Phenotype Qualitative analysis by immunocytochemistry Immunocytochemistry for pluripotency markers OCT4, Nanog, SSEA4 and Tra-1–60 Fig. 1 panel B
Quantitative analysis by RT-qPCR qRT-PCR for expression of Nanog OCT4, REX1, SOX, HTERT and DNMT3B Fig. 1 panel B
Genotype Karyotype (G-banding) and resolution BCHNEUi001-A: 46,XY Fig. 1 panel E
Band Resolution: 425–500
BCHNEUi002-A: 46,XY
Band Resolution: 400–425
BCHNEUi004-A: 46,XX
Band Resolution: 375–475
BCHNEUi005-A: 46,XX
Band Resolution: 425–475
BCHNEUi005-A: 46,XX
Band Resolution: 425–500
BCHNEUi006-A 46,XX
Band Resolution: 450–500
Identity STR analysis Performed Archived with the journal
16 loci tested, all matched (D3S1358, TH01, D21S11, D18S51, Penta E, D5S818, D13S317, D7S820, D16S539, CSF1PO, PentaD, vWA, D8S1179, TPOX, FGA, Amelogenin) Archived with the journal
Mutation analysis Sanger sequencing Confirmed variants listed in Table 1. Fig. 1 panel F
Southern Blot OR WGS N/A N/A
Microbiology and virology Mycoplasma Mycoplasma testing by luminescence (MycoAlert™): Negative Archived with the journal
Differentiation potential Embryoid body formation Expression of ectodermal (EN1, MAP2 and NR2F2), mesodermal (SNA1L2, RGS4 and HAND2) and endodermal markers (SST, KLF5 and AFP) Fig. 1 panel D
Donor screening (Optional) HIV 1 + 2 Hepatitis B, Hepatitis C N/A N/A
Genotype additional info (Optional) Blood group genotyping N/A N/A
HLA tissue typing N/A N/A

Materials and methods

Generation of iPSC

Skin punch biopsies (2–3 mm) were incubated in 0.5% Dispase Solution (STEMCELL Technologies) to remove epidermis. Samples were placed in gelatin-coated wells under growth conditions (37 °C, 5% CO2), and a coverslip was added to prevent lifting. Fibroblast media consisted of DMEM with 10% FBS and 1% Penicillin/Streptomycin (Thermo Fisher Scientific). The CytoTune-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) was used to transduce cells (Tables 1 & 2). Eight days after transduction, iPSCs were re-plated on Geltrex™-coated dishes and maintained in StemFlex medium (Thermo Fisher Scientific). Emerging stem cell colonies were picked and re-plated on Geltrex™-coated dishes for expansion. Cells were passaged weekly using Gentle Cell Dissociation Reagent (STEMCELL Technologies).

Table 1.

Summary of lines.

iPSC line names Abbreviation in figures Gender Age Ethnicity Genotype of locus Disease
BCHNEUi001-A AP4B1 [LoF/LoF] Male 2 years Mixed c.1345A > T/c.1160_1161delCA SPG47
BCHNEUi002-A AP4B1 [WT/LoF] Male 38 years Mixed c.1160_1161delCA Unaffected control
BCHNEU003-A AP4B1 [LoF/LoF] Female 3 years Caucasian c.530_531insA & c.533_535delACT/c.114-2A > C SPG47
BCHNEUi004-A AP4B1 [WT/LoF] Female 33 years Caucasian c.114-2A > C Unaffected control
BCHNEUi005-A AP4B1 [LoF/LoF] Female 3 years 9 months Caucasian c.1216C > T/c.1328 T > C SPG47
BCHNEUi006-A AP4B1 [WT/LoF] Female 39 years Caucasian c.1328 T > C Unaffected control

Immunocytochemistry for markers of pluripotency

For immunocytochemistry, iPSC were grown on coverslips. After washing with PBS, cells were fixed in 4% PFA at room temperature for 20 min. After three washes with PBS containing 0.05% Tween 20 (PBST), cells were permeabilized with PBS containing 0.1% Triton X-100 for 15 min and subsequently washed with PBST. Blocking was performed overnight at 4 °C with 4% donkey serum in PBS. After washing with PBS, cells were incubated with primary antibodies (Table 3) for 1 h at room temperature, washed with PBST and incubated with secondary antibodies for 1 h at room temperature and stained with DAPI. Imaging was performed using the Olympus IX71 Inverted Microscope.

Table 3.

Reagents details.

Antibodies used for immunocytochemistry
Antibody Dilution Company Cat # and RRID
Pluripotency markers Rabbit anti-OCT4 1:100 Abcam Cat# ab19857, RRID:AB_445175
Rabbit anti-NANOG 1:50 Abcam Cat# ab21624, RRID:AB_446437
Rat anti-SSEA3 1:200 MiUipore Cat# MAB 4303, RRID:AB_177628
Mouse anti-SSEA4 1:200 MiUipore Cat# MAB 4304, RRID:AB_177629
Mouse anti-TRA-1–60 1:200 MiUipore Cat# MAB 4360, RRID:AB_10917470
Secondary antibodies AlexaFluor 488 Donkey Anti-Rabbit IgG 1:500 Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792
AlexaFluor 488 Donkey Anti-Mouse IgG 1:500 Thermo Fisher Scientific Cat# A-21202, RRID:AB_141607
AlexaFluor 555 Goat Anti-Mouse IgM 1:500 Thermo Fisher Scientific Cat# A-21426, RRID:AB_2535847
Primers
Target Forward/Reverse primer (5’−3’)
Pluripotency markers (qPCR) NANOG CAGTCTGGACACTGGCTGAA/CTCGCTGATTAGGCTCCAAC
OCT4 TGTACTCCTCGGTCCCTTTC/TCCAGGTTTTCTTTCCCTAGC
SOX2 GCTAGTCTCCAAGCGACGAA/GCAAGAAGCCTCTCCTTGAA
DNMT3B ATAAGTCGAAGGTGCGTCGT/GGCAACATCTGAAGCCATTT
HTERT TGTGCACCAACATCTACAAG/GCGTTCTTGGCTTTCAGGAT
REX1 TGGACACGTCTGTGCTCTTC/GTCTTGGCGTCTTCTCGAAC
House-keeping genes (qPCR) ACTB GGACTTCGAGCAAGAGATGG/AGCACTGTGTTGGCGTACAG
Targeted sequencing of AP4B1 AP4B1 BCHNEUi001-A & BCHNEUi002-A:
1) GTCAAGTGTCCCCCACAAAA/AAAGGCAGGCATTACCTGTG
2) 2) ACACCTTTTCTGCTGGCACT/GCAGTGAGCAGCTCCATCTT BCHNEUi003-A & BCHNEUi004-A:
1) AATCCTGGCTGCTACCCTCT/GTATTGATGGCCAGGAGAGC
2) CTTTAGTGTGGCCTTTGTCATT/TGAACCCAGGAGGCGGAGGT BCHNEUi005-A & BCHNEUi006-A:
1) TTGACCACACCTCCAAAACC/CAGGGCCTGACATACAGCTT
2) ACACCTTTTCTGCTGGCACT/GCAGTGAGCAGCTCCATCTT

RNA isolation and qRT-PCR

Total RNA isolation was done using RNeasy Mini Kit (Qiagen), and RNA quantification was done using the qScript® cDNA Synthesis Kit (Quanta Bio). qRT-PCR cycles were performed using the QuantStudio 12 K Flex System (Thermo Fisher Scientific).

Embryoid body formation

To assess their ability to form three germ layers, iPSCs were lifted in clumps to allow for spontanious EB formation in suspension. iPSC cultures were washed with DPBS and incubated with Accutase (STEMCELL Technologies) for 3 min at 37 °C. Cell clumps were lifted with a cell scraper in EB formation medium, consisting of DMEM, 5% KnockOut™ Serum Replacement and 0.5% Penicillin/Streptomycin (Thermo Fisher Scientific). Clumps were added to a 15 ml tube and settled for 10 min before removing the supernatant. EB formation medium with ROCK inhibitor (STEMCELL Technologies) was added, and cell clumps were plated on ultra-low attachment plates (Corning Costar) for 24 h. EB formation medium was replaced every other day until replating to Gelatin-coated-plates on day 8. Cells were then cultured until day 15 in DMEM with 10% FBS. RNA isolation and qRT-PCR was performed, as described above.

Karyotyping

Karyotyping was performed at WiCell.

Mycoplasma detection

Testing for mycoplasma contamination was done using the MycoAlert™ Detection Kit (Lonza).

STR profiling

Genomic DNA was isolated from fibroblasts and iPSCs using the DNeasy Blood & Tissue Kit (Qiagen). STR analysis was performed at Genetica DNA Laboratories. Sixteen loci and an additional mouse marker for the detection of mouse DNA contamination were analyzed using the PowerPlex® 16 HS System (Promega).

Mutation verification

To verify variants in AP4B1, PCR was performed on gDNA samples using Platinum PCR SuperMix High Fidelity and the SimpliAmp Thermal Cycler (Thermo Fisher Scientific). PCR products were verified on 1% agarose gel before purification using DNA Clean & Concentrator (Zymo Research) and submitted to Eton Bioscience and Genewiz for Sanger Sequencing.

Supplementary Material

1

Key resource table

Unique stem cell lines identifier BCHNEUi001-A
BCHNEUi002-A
BCHNEUi003-A
BCHNEUi004-A
BCHNEUi005-A
BCHNEUi006-A
Alternative names of stem cell lines HNDS_0052–01
HNDS_0052–03
HNDS_0054–01
HNDS_0054–02
HNDS_0058–01
HNDS_0058–02
Institution Boston Children’s Hospital, Harvard Stem Cell Institute
Contact information of distributor Darius Ebrahimi-Fakhari darius.ebrahimi-fakhari@childrens.harvard.edu
Type of cell lines iPSC
Origin Human
Cell Source Fibroblasts
Clonality Clonal cell lines
Method of reprogramming Sendai Virus, non-integrating (OCT4, SOX2, KLF4 and hc-MYC)
Multiline rationale Three lines from patients with AP-4-HSP due to compound-heterozygous variants in AP4B1 and control lines from sex-matched parents who are clinically unaffected heterozygous carriers.
Gene modification 3 cell lines with homozygous variants
3 cell lines with heterozygous variants
Type of modification N/A
Associated disease AP4B1 , Hereditary Spastic Paraplegia type 47, SPG47
Gene/locus AP4B1; Reference sequences: NM_001253852.1
BCHNEUi001-A: c.1345A > T/c.1160_1161delCA
BCHNEUi002-A: c.1160_1161delCA
BCHNEUi003-A: c.530_531insA/c.114-2A > C
BCHNEUi004-A: c.114-2A > C
BCHNEUi005-A: c.1216C > T/c.1328T > C
BCHNEUi006-A: c.1328T > C
Method of modification N/A
Name of transgene or resistance N/A
Inducible/constitutive system N/A
Date archived/stock date May 3rd 2018
Cell line repository/bank N/A
Ethical approval This study was approved by the Institutional Review Board at Boston Children’s Hospital (IRB#: P00016119). Written informed consent was obtained.

Acknowledgements

The authors thank the patients and families who participated in this study. The authors are grateful to the iPS Core Facility at the Harvard Stem Cell Institute for help with generating and characterizing induced pluripotent stem cells. This study was supported by funds from CureSPG47 Inc., the Spastic Paraplegia Foundation (SPF) Inc., and the Thrasher Research Fund (all to D.E.F.), the German National Academic Foundation (to J.T.), the University of Würzburg Graduate School of Life Sciences Scholarship (to R.B.), and the University of Siena “Pegaso Scholarship” (to A.D.). The Translational Neuroscience Center at Boston Children’s Hospital is supported by the Massachusetts Life Sciences Center (MLSC) and the Intellectual and Developmental Disabilities Research Center at Boston Children’s Hospital (NIH-NICHD U54HD090255).

Footnotes

Appendix A. Supplementary data

Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2019.101575.

References

  1. Blackstone C, 2018. Hereditary spastic paraplegia. Handb. Clin. Neurol 148, 633–652. [DOI] [PubMed] [Google Scholar]
  2. Davies AK, Itzhak DN, Edgar JR, Archuleta TL, Hirst J, Jackson LP, Robinson MS, Borner GHH, 2018. AP-4 vesicles contribute to spatial control of autophagy via RUSC-dependent peripheral delivery of ATG9A. Nat. Commun 9, 3958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. De Pace R, Skirzewski M, Damme M, Mattera R, Mercurio J, Foster AM, Cuitino L, Jarnik M, Hoffmann V, Morris HD, Han T-U, Mancini GMS, Buonanno A, Bonifacino JS, 2018. Altered distribution of ATG9A and accumulation of axonal aggregates in neurons from a mouse model of AP-4 deficiency syndrome. PLoS Genet. 14, e1007363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ebrahimi-Fakhari D, Cheng C, Dies K, Diplock A, Pier DB, Ryan CS, Lanpher BC, Hirst J, Chung WK, Sahin M, Rosser E, Darras B, Bennett JT, CureSpg, 2018a. Clinical and genetic characterization of AP4B1-associated SPG47. Am. J. Med. Genet. A 176, 311–318. [DOI] [PubMed] [Google Scholar]
  5. Ebrahimi-Fakhari D, Behne R, Davies AK, Hirst J, 2018b. AP-4-Associated hereditary spastic paraplegia. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Stephens K, Amemiya A (Eds.), GeneReviews((R)), Seattle (WA). [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES