Metronidazole-Treated Porphyromonas gingivalis Persisters Invade Human Gingival Epithelial Cells and Perturb Innate Responses

Periodontitis as a biofilm-associated inflammatory disease is highly prevalent worldwide. It severely affects oral health and yet closely links to systemic diseases like diabetes and cardiovascular disease. Porphyromonas gingivalis as a “keystone” periodontopathogen drives the shift of microbe-host symbiosis to dysbiosis and critically contributes to the pathogenesis of periodontitis. Persisters represent a tiny subset of biofilm-associated microbes highly tolerant to lethal treatment of antimicrobials, and, notably, metronidazole-tolerant P. gingivalis persisters have recently been identified by our group.

ABSTRACT

Periodontitis as a biofilm-associated inflammatory disease is highly prevalent worldwide. It severely affects oral health and yet closely links to systemic diseases like diabetes and cardiovascular disease. Porphyromonas gingivalis as a “keystone” periodontopathogen drives the shift of microbe-host symbiosis to dysbiosis and critically contributes to the pathogenesis of periodontitis. Persisters represent a tiny subset of biofilm-associated microbes highly tolerant to lethal treatment of antimicrobials, and, notably, metronidazole-tolerant P. gingivalis persisters have recently been identified by our group. This study further explored the interactive profiles of metronidazole-treated P. gingivalis persisters (M-PgPs) with human gingival epithelial cells (HGECs). P. gingivalis cells (ATCC 33277) at stationary phase were treated with a lethal dosage of metronidazole (100 μg/ml, 6 h) for generating M-PgPs. The interaction of M-PgPs with HGECs was assessed by microscopy, flow cytometry, cytokine profiling, and quantitative PCR (qPCR). We demonstrated that the overall morphology and ultracellular structure of M-PgPs remained unchanged. Importantly, M-PgPs maintained the capabilities to adhere to and invade HGECs. Moreover, M-PgPs significantly suppressed proinflammatory cytokine expression in HGECs at a level comparable to that seen with the untreated P. gingivalis cells, through the thermosensitive components. The present report reveals that P. gingivalis persisters induced by lethal treatment of antibiotics were able to maintain their capabilities to adhere to and invade human gingival epithelial cells and to perturb the innate host responses. Novel strategies and approaches need to be developed for tackling P. gingivalis and favorably modulating the dysregulated immunoinflammatory responses for oral/periodontal health and general well-being.

INTRODUCTION

Periodontitis is a highly common and yet serious biofilm-associated inflammatory disease, and it is among the major global oral health burdens (1–3). It results in irreversible destruction of tooth-supporting soft and hard tissues and eventually leads to tooth exfoliation. Among the documented periodontopathogens (4), Porphyromonas gingivalis as the “keystone” pathogen of periodontitis drives the shift of microbe-host symbiosis to dysbiosis, thereby critically contributing to the pathogenesis of periodontitis (5). At present, it remains very challenging to tackle P. gingivalis in its biofilm and intracellular status, and, indeed, this noxious bacterium develops specific strategies to evade host defense and survive in various harsh environments (6, 7). Our group recently showed for the first time the existence of metronidazole (MTZ)-tolerant P. gingivalis persisters and identified the underlying survival mechanisms (8). These exciting findings enhance current understanding of the pathogenicity of P. gingivalis and the recalcitrant nature of tackling periodontitis and may contribute to developing new therapeutic approaches.

The term “microbial persisters” refers to a tiny survival subpopulation of biofilm-associated microbes tolerant of lethal dosage of antimicrobials (9, 10). These survivors, the so-called “persisters,” usually exist in a dormant, nondividing phase like bacteria in their stationary phase. Essentially, descendants of persisters are sensitive to antimicrobials, and they are therefore claimed to be phenotypic variants and to represent noninherited phenotypes (9). Various microbial persisters such as Escherichia coli, Mycobacterium tuberculosis, and Candida albicans have been reported in the past 2 decades (11). As persisters enable resumption of growth following the termination of antimicrobial treatment, they are crucially recognized as the major culprit responsible for recurrent infections and inflammatory diseases in humans (10, 12). Currently, most of the work deals with investigating the characteristics of persisters and intrinsic regulatory mechanisms (13, 14). The profiles of interactions of persisters with host cells as well as the resultant mutual reactions remain unknown.

Human gingival epithelial cells (HGECs) represent the first defensive line of periodontium, through forming a physical barrier to protect underlying tissues and crucially acting as a biological barrier to augment innate host defense (15, 16). The modulatory effects of P. gingivalis and/or its lipopolysaccharide (LPS) on immunoinflammatory responses in HGECs have been well documented by other groups and ours (17–19). Such effects represent results of highly complex interactions of P. gingivalis with HGECs in vivo, owing to differing microenvironmental conditions and host backgrounds (e.g., temperature, pH, nutrients at its resident niches, genetic traits, immune defense, and systemic health) (20). Understanding how and to what extent P. gingivalis could survive in vivo under various status conditions and regrow after the cessation of antimicrobial treatments is of great importance. It is conceivable that there are highly complex and dynamic cross-talks between microbial species and host cells and that those interactions critically account for the survival and persistence of P. gingivalis. Our recent discovery of metronidazole-tolerant P. gingivalis persisters (8) inspires further research work on this path.

The present study was extended to investigate the interactive profiles of P. gingivalis persisters with HGECs and explored how these persisters could affect the innate host defense. We show that metronidazole-treated P. gingivalis persisters remain able to adhere to and invade HGECs and yet significantly suppress immunoinflammatory responses at a level comparable with that seen with untreated P. gingivalis cells, through their thermosensitive components.

RESULTS

Microscopic characteristics of metronidazole-treated P. gingivalis persisters (M-PgPs).

Our previous work proved the existence of MTZ-tolerant P. gingivalis persisters and identified their proteomic profiles (8). Here, transmission electron microscopy (TEM) was used to evaluate the microscopic characters of M-PgPs. Overall, the morphology and cellular structure of M-PgPs remained unchanged, and there was no obvious difference from the P. gingivalis cells untreated by MTZ. The cytoplasts were destroyed by heat in both heat-killed M-PgPs and P. gingivalis, and cell membranes continued to exist (Fig. 1).

FIG 1.

Microscopic characteristics of M-PgPs. TEM profiles of M-PgPs at 6 h (a1) and 24 h (a2) are shown, with the zoomed-in images in b1 and b2 representing randomly selected fields. Scale bars: a1 and a2, 1 μm; b1 and b2, 100 nm.

Adhesion to and invasion of HGECs by M-PgPs.

As adhesion to and invasion of host cells are two important virulence factors of P. gingivalis (21), we attempted to determine whether M-PgPs could maintain such critical capabilities. M-PgP- and P. gingivalis-treated HGECs were assessed with immunofluorescence (IF), TEM, and flow cytometry. Importantly, the M-PgPs were still able to adhere to the cell surfaces and yet invade the cytoplasts as P. gingivalis did (Fig. 2a to c; see also Fig. S1 in the supplemental material), while heat-killed M-PgPs lost such pathogenic abilities (Fig. 2d and e; see also Fig. S1). TEM findings demonstrated that M-PgPs altered the cell membrane and led to the generation of membrane ruffles, thereby facilitating the invasion of HGECs, whereas the membranes of HGECs remained unchanged, even when heat-killed M-PgPs were present quite near them (Fig. 2f to j). In addition, similar proportions of HGECs were adhered to or invaded by M-PgPs and P. gingivalis as quantitated by flow cytometry (Fig. 3).

FIG 2.

Adhesion to and invasion of HGECs by M-PgPs. HGECs were treated with M-PgPs and P. gingivalis at an MOI of 100 for 2 h and were examined by IF (a to e) and TEM (f to j). (a1 to e1) P. gingivalis cells and M-PgPs (green). (a2 to e2) The nuclei of HGECs (blue). (a3 to e3) F-actin (red). (a4 to e4) Merged images. (f1 to j1) TEM images. (g2 to j2) Zoomed-in views of panels g1 to j1, respectively. Red circles, intracellular P. gingivalis (g1 and g2) and M-PgPs (h1 and h2); green arrows, extracellular P. gingivalis (g1 and g2), heat-killed P. gingivalis (i1 and i2), M-PgPs (h1), and heat-killed M-PgPs (j1 and j2). Scale bars: 30 μm (a to e), 3 μm (f1 to j1), 800 nm (g2 to i2), and 2 μm (j2).

FIG 3.

Quantitation of HGECs adhered to and invaded by M-PgPs. HGECs were treated with M-PgPs and P. gingivalis at an MOI of 100 for 2 h, followed by flow cytometry analysis. (a to d) Selective profiles from three independent repeats. Red lines, untreated HGECs; blue lines, HGECs treated with P. gingivalis (a), M-PgPs (b), heat-killed P. gingivalis (c), and heat-killed M-PgPs (d). (e) Quantitation of three independent repeats. The data are presented as means ± SD. *, P < 0.0001. FITC, fluorescein isothiocyanate.

Inhibition of cytokine expression in HGECs by M-PgPs.

The preliminary results on the expression of interleukin-6 (IL-6) and IL-8 in HGECs showed that the most appropriate conditions for the subsequent experiments included the use of a multiplicity of infection (MOI) of 100 and 24 h of treatment with P. gingivalis (Fig. 4). A higher MOI of 500 or 1,000 led to detachment and death of HGECs after 24 h (Fig. S2). In order to investigate the effects of M-PgPs on cytokine expression levels in HGECs, a cytokine assay was conducted using a human XL cytokine array kit with 105 targets. It was found that the expression levels of 10 cytokines were remarkably downregulated by both M-PgPs and P. gingivalis (Fig. 5a and b). Among them, the expression levels of IL-6, IL-8, and CXCL5 were further analyzed by quantitative real-time PCR (qPCR) and enzyme-linked immunosorbent assay (ELISA). Notably, M-PgPs suppressed their expression in a fashion similar to that seen with P. gingivalis (Fig. 5c and d).

FIG 4.

P. gingivalis-induced inhibition of IL-6 and IL-8 expression (mRNAs and proteins) in HGECs. (a to d) HGECs were pretreated with or without IL-1β for 24 h, followed by challenge with P. gingivalis at different MOI (0.01 to 100) for 24 h. IL-6 (a and b) and IL-8 (c and d) expression levels were analyzed by qPCR (a and c) and ELISA (b and d). (e to h) HGECs were pretreated with IL-1β for 24 h, followed by challenge with P. gingivalis at an MOI of 100 for 1, 6, and 24 h. IL-6 (e and f) and IL-8 (g and h) expression levels were analyzed by qPCR (e and g) and ELISA (f and h). BL, blank group without IL-1β treatment; NC, negative-control group without P. gingivalis treatment. The data (means ± SD) were obtained from three independent replicates. *, P < 0.001; **, P < 0.0001.

FIG 5.

M-PgP-induced inhibition of expression of cytokines (mRNAs and proteins) in HGECs. (a) Relative expression levels of 105 cytokines after challenge with P. gingivalis or M-PgPs at an MOI of 100 for 24 h. Ten cytokines with remarkable changes in intensity are highlighted. (b) Fold changes in expression of selected cytokines with reference to the IL-1β group. Black arrows, not detected. (c and d) Expression levels of IL-6, IL-8, and CXCL5 determined by qPCR (c) and ELISA (d). BL, blank group without any treatment. The data (means ± SD) were obtained from three independent replicates. *, P < 0.05; **, P < 0.001; ***, P < 0.0001. TGF-α, transforming growth factor alpha; VEGF, vascular endothelial growth factor.

Involvement of thermosensitive components in M-PgP-induced inhibition of cytokine expression.

To further investigate which components of M-PgPs could lead to the inhibition of cytokine expression, M-PgPs were denatured by high temperature (85°C, 10 min) prior to treating the HGECs. In contrast to the untreated M-PgPs, these heat-killed M-PgPs were unable to suppress the expression of IL-6, IL-8, and CXCL5 (Fig. 6a and b), suggesting that their thermosensitive components contributed to the inhibitory effects observed. Hemin as an environmental factor may affect P. gingivalis with respect to expression of different LPS isoforms with featured lipid A structures (22) and opposite host responses (23). As such, M-PgPs and P. gingivalis were cultured with low (1 μg/ml) and high (10 μg/ml) concentrations of hemin. Here, the two showed similar inhibitory effects on cytokine expression in HGECs (Fig. 6c and d).

FIG 6.

Involvement of thermosensitive components in M-PgP-induced inhibition of expression of cytokines (mRNAs and proteins). (a and b) HGECs were challenged with P. gingivalis and M-PgPs and with heat-killed P. gingivalis and heat-killed M-PgPs at an MOI of 100 for 24 h. The expression levels of IL-6, IL-8, and CXCL5 were analyzed by qPCR (a) and ELISA (b). BL, blank group without any treatment; HK, heat killed. (c and d) HGECs were challenged with P. gingivalis and M-PgPs at an MOI of 100 for 24 h, and both groups were cultured with 1 or 10 μg/ml of hemin. The expression levels of IL-6, IL-8, and CXCL5 were analyzed by qPCR (c) and ELISA (d). P. gingivalis 1 or M-PgPs 1, P. gingivalis or M-PgPs cultured with 1 μg/ml of hemin, respectively; P. gingivalis 10 or M-PgPs 10, P. gingivalis or M-PgPs cultured with 10 μg/ml of hemin, respectively. The data (means ± SD) were obtained from three independent replicates. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

DISCUSSION

It is known that gingival epithelia not only provide the first physical barrier to harmful pathogens and substances but also function as crucial components of innate immune defense (15, 16). P. gingivalis as a well-recognized major periodontopathogen is critically involved in periodontal pathogenesis (4, 5). Of note, low-abundance P. gingivalis drives the shift of microbe-host symbiosis to dysbiosis, and inappropriate interactions of P. gingivalis with gingival epithelial cells greatly contribute to the onset of periodontal diseases (5, 7, 16, 24). Microbial persisters are dormant cells highly tolerant to multiple antimicrobials, and numerous species of microbes enable formation of persisters (9–11). We recently investigated the phenotypic characteristics and proteomic profiles of Candida albicans biofilm persisters (25). Furthermore, we have found that P. gingivalis persisters that are present at extremely low abundance (0.1% to 1.0%) at the stationary phase can survive lethal treatment with metronidazole, through functional mechanisms such as reduced utilization of iron, altered stress responses, and adaptive status of dormancy (8), whereas what the microscopic characteristics of P. gingivalis persisters are and how these persister cells interact with host cells such as gingival epithelial cells remain unknown. Therefore, the present study further investigated the interactive profiles of M-PgPs with HGECs and the possible mechanisms involved.

We first performed TEM analysis of M-PgPs, and no obvious difference was found between M-PgPs and the untreated P. gingivalis as the control. Since persister cells as a small proportion of the microbial community act at the transitory physiological phase, it is known to be rather challenging to precisely isolate them from unlysed cells after antimicrobial treatments (8, 12, 25, 26). Here, the M-PgPs consisted of P. gingivalis persisters and metronidazole-killed P. gingivalis cells, and they were used in the subsequent experiments.

During the long coevolution of microbes and mammalian cells, epithelial cells have developed various innate immune functions such as phagocytosis and expression of cytokines/chemokines (15). Meanwhile, bacterial pathogens adapted comprehensive strategies to adhere to and invade host tissues for survival and pathogenicity (27–29). Adhesion and invasion of host cells are two important elements by which P. gingivalis evades host defense, and both elements contribute to microbe-host dysbiosis and resultant tissue destruction (5, 21, 30–32). Interestingly, our findings from the analyses of immunofluorescence, flow cytometry, and TEM indicate that M-PgPs enabled retention of adhesion and invasion abilities, whereas the heat-killed M-PgPs did not. It is apparent that multiple virulence factors (e.g., gingipains, fimbriae, and hemagglutinin) facilitate adhesion and invasion of P. gingivalis (33, 34). It could be speculated that these components may remain to be active after metronidazole treatment and that M-PgPs essentially retain pathogenic virulence, thereby contributing to their invasive propensity and evasion of host defense (35).

Next, we tried to find out how M-PgPs could affect the innate host response in HGECs. Notably, M-PgPs suppress the expression of multiple proinflammatory cytokines and chemokines (e.g., IL-6, IL-8, and CXCL5) in a manner comparable to that shown by P. gingivalis. Considering the crucial roles of these innate molecules in regulating immunoinflammatory responses and periodontal pathogenesis, P. gingivalis may intrinsically have developed core strategies to escape host defense mechanisms for survival and recurrence even under harsh conditions such as lethal dosages of antimicrobials. Note that such M-PgP-induced suppression of cytokine expression no longer exists following denaturation of bacterial components such as proteins under conditions of high temperature. This finding shows that the thermosensitive components extensively account for the inhibitory effects on innate host responses. It is known that the hemin level is an important microenvironmental variable that could induce P. gingivalis to release different isoforms of LPS with opposing immunoinflammatory activities (22, 23, 36, 37), whereas the M-PgPs cultured under conditions of low and high hemin concentrations showed comparable effects on the expression profile of proinflammatory cytokines. Further study is required to clarify these results and the underlying mechanisms.

The last 2 decades have seen extensive advances in the research of microbial persisters discovered nearly 80 years ago (9–11). Most of those studies focused on identification and characterization of various categories of persisters per se. From the clinical point of view, common inflammatory diseases, including periodontitis, develop and lead to further deterioration, owing to the shift of microbe-host symbiosis to dysbiosis and the resultant dysregulated immunoinflammatory responses (38, 39). We are wondering whether and to what extent these noxious persisters may interact with host cells. Obviously, addressing the research gap would enhance our understanding of the critical elements of the innate defense disrupted by microbe-host dysbiosis and of the resultant immunoinflammatory destruction for better patient management. The present study explored the interactions of HGECs with the keystone periodontopathogen P. gingivalis and its persisters following lethal treatment with metronidazole. The current findings on P. gingivalis persister-induced suppression of innate host responses inspire us to reconsider the rationale of antibiotic usage in clinical practice. Further studies are required to develop novel and precise approaches to tackling microbe-associated inflammatory diseases and systemic complications. Indeed, we recently demonstrated that bismuth drugs can remarkably suppress P. gingivalis in its planktonic, biofilm, and intracellular states and can improve P. gingivalis-perturbed innate host responses (40). In addition, nanoparticle-encapsulated herbal extracts can favorably modulate immunoinflammatory responses in HGECs, through effective release and cellular internalization modes (41).

Within the limitations of the experiments, the present report provides the first evidence that P. gingivalis persisters induced by lethal treatment with antibiotics maintain their abilities to adhere to and invade HGECs and yet perturb immunoinflammatory responses via the action of thermosensitive components. Further investigation is required to reveal the underlying mechanisms and plausible pathways accounting for the inhibitory effects observed in this study. Our current findings may shed light on developing novel strategies and approaches to tackling P. gingivalis and favorably modulating dysregulated immunoinflammatory responses for controlling periodontitis and P. gingivalis-related systemic comorbidities.

MATERIALS AND METHODS

Formation of M-PgPs.

P. gingivalis (ATCC 33277) was used, and M-PgP formation was conducted as previously described by our group (8). Briefly, P. gingivalis was cultured anaerobically at 37°C in broth with hemin (1, 5, or 10 μg/ml) for 48 h and recultured in fresh broth to an optical density at 600 nm (OD₆₀₀) of 0.1. The cultures were then incubated to the stationary phase (88 h) followed by treatment with a lethal dosage (100 μg/ml) of metronidazole for 6 h.

Culture of HGECs.

HGECs (CELLnTEC, Bern, Switzerland) were cultured as previously described by our group (41) in CnT-PR medium supplemented with 100 μg/ml of the antimicrobial agent Primocin (InvivoGen, USA) at 37°C with 5% CO₂. The culture medium was changed every 48 h, and passages 3 to 5 were used in all experiments.

The interactions of M-PgPs with HGECs.

HGECs were seeded onto suitable vessels with appropriate density. After adherence, the medium was changed to a nonantibiotic one. The cells were pretreated with 1 ng/ml of IL-1β, and those without IL-1β stimulation were regarded as the blank control (BL). After 24 h, HGECs were treated with untreated P. gingivalis, heat-killed (85°C and 10 min) P. gingivalis, untreated M-PgPs, or heat-killed (85°C and 10 min) M-PgPs for 1, 6, or 24 h. The culture media and total RNAs of HGECs were collected for further assays.

Immunofluorescence staining.

HGECs seeded into ibidi μ-Slide 8-well chamber slides (2 × 10⁴ cells/well) were treated with untreated P. gingivalis, heat-killed P. gingivalis, untreated M-PgPs, or heat-killed M-PgPs for 2 h at an MOI of 100. After being fixed with 4% paraformaldehyde (PFA), the cells were taken for immunofluorescence analysis as previously described (42). P. gingivalis cells or M-PgPs were labeled with mouse anti-P. gingivalis primary antibody (Developmental Studies Hybridoma Bank [DSHB] hybridoma product 60BG1.3), followed by Alexa Fluor 488-conjugated anti-mouse IgG secondary antibody (Cell Signaling Technology, USA). HGECs were stained with Alexa Fluor 555 phalloidin (Thermo Fisher Scientific Inc., USA). The nuclei were stained with DRAQ5 fluorescent probe solution (Thermo Fisher Scientific Inc., USA) and redefined as blue by the use of ImageJ. Samples were analyzed with an Olympus FluoView (FV) 1000 confocal microscope (Olympus, Hachioji, Japan).

TEM.

HGECs seeded into 60-mm-diameter tissue culture (TC)-treated culture dishes (Corning, USA) with 5 × 10⁵ cells/dish were treated with untreated P. gingivalis, heat-killed P. gingivalis, untreated M-PgPs, or heat-killed M-PgPs for 2 h (MOI of 100). After they were fixed with Karnovsky fixative, these samples were prepared for TEM (41). In brief, the fixed cells were washed 3 times with 0.1 M sodium cacodylate buffer, followed by postfixation in 1% OsO₄ for 1 h at room temperature. The cells were then embedded in agar, followed by dehydration in a series of ethanols and infiltration with epoxy resin/propylene oxide (1:1) mixtures. After polymerization at 60°C overnight, ultrathin sections were cut with a Leica Ultracut UCT ultramicrotome (Leica, Wetzlar, Germany) in 100-nm thicknesses and were stained with 2% aqueous uranyl acetate and Reynold’s lead citrate. The samples were examined using a Philips CM100 TEM (Philips, Amsterdam, Netherlands). The bacterial samples (untreated P. gingivalis, heat-killed P. gingivalis, untreated M-PgPs, and heat-killed M-PgPs) were prepared for TEM following the procedure described above.

Flow cytometry.

HGECs seeded into 100-mm-diameter TC-treated culture dishes (1.5 × 10⁶ cells/dish) were treated with untreated P. gingivalis, heat-killed P. gingivalis, untreated M-PgPs, or heat-killed M-PgPs for 2 h at an MOI of 100. Following dissociation with TrypLE Express enzyme (Thermo Fisher Scientific Inc., USA), the samples collected after centrifugation were fixed with 4% PFA and permeabilized using 0.1% Triton X-100, and they were then incubated with mouse anti-P. gingivalis primary antibody (1.5 h at room temperature), followed by Alexa Fluor 488-conjugated anti-mouse IgG (0.5 h at room temperature). Flow cytometry was employed to analyze the samples.

Cytokine array.

The culture media were centrifuged at 4°C for 15 min at 15,000 × g, and the supernatants were obtained. Cytokine assays were conducted with a human XL cytokine array kit (R&D, USA) according to the standard procedures. Supernatants from three independent repeats were pooled for the assay. The data were analyzed by the use of HLImage++ software.

qPCR.

Total RNAs were extracted by the use of an RNeasy Plus minikit (Qiagen, Germany), and cDNA was synthesized with a QuantiTect reverse transcription kit (Qiagen, Germany). qPCR was performed using an ABI 7500 real-time PCR system with a QuantiNova SYBR green PCR kit (Qiagen, Germany). The gene expression levels were normalized to β-actin with the comparative threshold cycle (2^−ΔΔCT) approach. The primer sequences are shown in Table 1.

TABLE 1.

Primer sequences used for qPCR

Gene	Primer direction	Primer sequence (5′ to 3′)
IL-6	Forward	AATCATCACTGGTCTTTTGGAG
	Reverse	GCATTTGTGGTTGGGTCA
IL-8	Forward	GACATACTCCAAACCTTTCCACC
	Reverse	AACTTCTCCACAACCCTCTGC
CXCL5	Forward	AGCTGCGTTGCGTTTGTTTAC
	Reverse	TGGCGAACACTTGCAGATTAC
β-Actin	Forward	TTGGCAATGAGCGGTT
	Reverse	AGTTGAAGGTAGTTTCGTGGAT

ELISA.

The supernatants were collected after centrifugation of the culture media at 4°C for 15 min at 15,000 × g. The levels of IL-6, IL-8, and CXCL5 were measured with a DuoSet ELISA kit (R&D, USA) according to the standard procedures.

Statistical analysis.

All experiments were repeated at least three times. The data were analyzed with GraphPad Prism 6 and are presented as means ± standard deviations (SD). Intergroup differences were examined using one-way analysis of variance with multicomparisons by Tukey’s test. A P value of <0.05 was determined to be statistically significant.