Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2020 Jun 4;15(6):e0233990. doi: 10.1371/journal.pone.0233990

Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples

Pieter Willem Smit 1,2, Akke Rosanne Cornelissen 1, Sylvia Maria Bruisten 1,3,*
Editor: Deborah Dean4
PMCID: PMC7271987  PMID: 32497069

Abstract

Objectives

Typing of Chlamydia trachomatis (CT) is traditionally performed by characterising the ompA gene, resulting in more than a dozen different genovars, A to L. Type L is associated with Lymphogranuloma venereum (LGV) and commonly screened for using PCR, targeting the chromosomal pmpH gene. We aimed to develop and validate a new CT/LGV plasmid-based typing assay targeting the pgp3 gene, to increase sensitivity and thus reduce the number of non-typeable results.

Methods

The new pgp3 PCR assay using LNA probes to detect point mutations was analytically and prospectively validated in a routine diagnostic laboratory setting. For the analytical tests, quantified nucleotide constructs (gBlocks) were used to perform limit of detection analyses. Quality control panel samples from 2018 and 2019 for CT were also tested. For the clinical study patient samples which were collected in two months in 2018 were tested simultaneously using the pmpH PCR and the pgp3 PCR.

Results

Analytically, the assay proved to be 100% specific relative to the previously used LGV typing assay targeting the single copy pmpH gene but it was much more sensitive to detect non-LGV CT. In the quality control panel 2 nonLGV samples and 7 LGV samples were solely positive with the pgp3 PCR and not with the pmpH PCR. None of the samples from analytical specificity panels were positive, indicating 100% specificity. In a prospective panel of 152 clinical samples, 142 (93%) were successfully typed with the pgp3 PCR compared to 78% with the pmpH PCR. The pgp3 PCR was fully concordant with the pmpH PCR to identify all LGV subtypes and detected an increased number of clinical samples of non-LGV subtype.

Conclusion

We developed and validated a sensitive and specific plasmid-based typing assay to discriminate LGV from non-LGV CT subtypes. This is useful in a clinical setting to quickly determine the optimal treatment for Chlamydia trachomatis infections.

Introduction

Chlamydia trachomatis (CT) infection is worldwide one of the leading bacterial sexually transmitted infections (STI) [1,2]. Typing of CT is traditionally performed by characterising the ompA gene, resulting in more than a dozen different genovars, A to L [3]. In the last decades other more discriminating typing techniques were also developed, leading to even more CT genotypes, which could be clustered in specific lineages [4,5]. Ocular ompA types are A, B, Ba and C and are still found only in non-Western countries but sometimes also occur in urogenital infections [4,6–10]. The urogenital genovars B and D to K, infect cervical and vaginal sites in women and anal sites in men and can all also be detected in urine samples. So genovars B and Ba may be found both at ocular and urogenital locations [6,9] All of the ocular and urogenital genovars are non-invasive types, in contrast to the ompA type L, which is associated with invasive infection leading to Lymphogranuloma venereum (LGV) disease, with swollen lymph nodes and anal ulcers. HIV seropositivity is a strong risk factor for LGV [11] and these LGV infections are mostly found in men who have sex with men (MSM) but in rare cases also in women [6].

LGV testing is strongly recommended for MSM with anorectal chlamydia since LGV associated types need longer and more stringent treatment. If untreated or treated inadequately LGV infection may cause chronic or irreversible complications, including fistulas, strictures, genital elephantiasis, frozen pelvis, or infertility [11, 12]. An urogenital nonLGV chlamydia is treated with a single dose of 1 g of azithromycin [13]. According to the most recent European guideline, an LGV infection is treated longer and more stringent with doxycycline 100 mg, twice a day, orally for 21 days [14]. This same treatment is recommended also in asymptomatic patients and contacts of LGV patients. If another regimen is used, a test of cure must be performed. Therefor it is very important to distinguish between LGV and non-LGV types. In many diagnostic laboratories, and also in our laboratory, a very sensitive screening assay is used to detect all Chlamydia types. In case of our laboratory this is the commercial Aptima Combo2 test which uses transcription mediated amplification (TMA) that detects RNA copies of the 23SrRNA gene [15]. Per bacterial cell hundreds to thousands of these RNA molecules are present leading to ultra-high sensitivity of the TMA. For subsequent typing to discriminate between LGV and nonLGV a diagnostic PCR was developed already in 2005 [16], targeting the pmpH gene. The sensitivity of this PCR was improved [17] but detection of this single copy pmpH gene was still at best 85% relative to the TMA screening assay. This leaves 15–20% of the CT positive samples non-typeable. In this study we now aimed to improve the LGV/non-LGV typing PCR by looking for suitable genes located on the CT plasmid, which was described to occur in 6 to 18 copies per bacterial cell [18–20], thus improving the sensitivity of the LGV typing PCR tenfold. The CT plasmid is 7.5 kb long and encodes 8 open reading frames (ORF), coding for several regulatory and virulence factors, being all plasmid glycoproteins (pGP) [21]. Indicative SNPs were assessed and finally pgp3-ORF5 was selected. The limit of detection, linearity and correctness in quality control panels were assessed. Subsequently we performed a clinical validation by testing diagnostic samples prospectively using both typing PCRs to compare sensitivity and specificity of the new plasmid gene PCR with the routinely used PCR targeting the single copy, chromosomal pmpH gene.

Materials & methods

Strategy of the study

Plasmid DNA sequences were obtained in silico from the BigsDB database and assessed for LGV differentiating SNPs [13]. The main goal was to reduce the proportion of non-typeable sample results. In addition, the acceptability criteria were to reach at least >95% sensitivity and specificity relative to the existing typing PCR, targeting the chromosomal pmpH gene. For the analytical validation quantified nucleotide constructs (gBlocks) and quality control samples were used. For the clinical validation diagnostic patient samples were tested simultaneously using the routine pmpH PCR and the plasmid gene PCR. Further details on the analytical and clinical part are described below.

Nucleic acid extraction and PCR

Nucleic acid (NA) extraction was performed as described previously [22]. In brief, isopropanol precipitation was applied to extract NA from 200 μL transport medium (Hologic, San Diego, USA) and the pellet was dissolved in 50 μL Tris-EDTA buffer pH 8.0. All CT positive samples were further tested with the pmpH LGV real time PCR [17]. Briefly, the real time PCR was performed in 20 μL, containing Platinum Quantitative PCR SuperMix-UDG (Invitrogen, Breda, the Netherlands), 2 μL of DNA solution, 4.3 mM MgCl2, 0.40 μM of primer F3_LGV, 0.39 μM of primer F4_nonLGV and 0.92 μM of primer R2_ LGV/nonLGV, 0.15 μM of probe LGVtotP and 0.21 μM of probe P4_nonLGV (Table 1). Cycling conditions for the real-time PCR were: uracil DNA glycosylase step at 50°C for 2 minutes and denaturation at 95°C for 2 minutes, followed by 45 cycles of 15 seconds at 95°C and 1 minute at 60°C.

Table 1. Primer sequences used in this study.

Locked nucleic acids are indicated with ‘+’.

LGV/nonLGV target Primer/probe Sequentie 5’ —> 3’
pmpH core genome F3_LGV CTACTGTGCCAACCTCATCAT
F4_nonLGV CTATTGTGCCAGCATCGACTC
R2_LGV/nonLGV GACCCTTTCCGAGCATCA
P4_nonLGV Hex-AAAGAGCTTGAAGCAGCAGGAGC-BHQ2
LGVtotP 6-FAM-CTTGCTCCAACAGT-MGB
PGP3_ORF5 Forward_PGP3 TTATTGCATCAAGAATGGAAGG
Reverse_PGP3 GCCTGATGAGTATCCATAACTA
LGV probe_PGP3 56-FAM/CCC+T+A+CGC+G+AT/3IABkFQ
nonLGV probe_PGP3 5HEX/CCC+T+G+CGCGA/3IABkFQ
Open in a new tab

The pgp3 real time PCR was performed in 20 μL, containing Quantinova Pathogen (QNP) master mix (Qiagen, Germany), 5 μL of DNA solution, 0.25 μM of forward and reverse primer, 0.125 μM of LGV probe and nonLGV probe with locked nucleic acids (LNA) for specificity to detect a point mutation. LNA probes and primers were conceived and ordered from IDT diagnostics (Integrated DNA technologies, Leuven, Belgium) and are shown in Table 1. Cycling conditions were identical to the pmpH PCR. All tests were performed on a Rotor-GeneQ thermocycler (Qiagen, Hilden, Germany).

Analytical validation

The pgp3 PCR efficiency and limit of detection was determined using spiked Tris-EDTA buffer pH 8.0 with the specific gBlocks (Integrated DNA technologies, Coralville, USA) with known concentration of CT DNA. A 10-fold dilution range was used in triplicate to determine the efficiency. To determine the 95% limit of detection (LOD95), a dilution series was prepared with factor 5 between the dilutions. Each dilution was tested 8 times.

Two proficiency panels (2018 and 2019) from Quality Control for Molecular Diagnostics (QCMD) were tested by the TMA and the two LGV/nonLGV PCR assays. Both panels contained CT and LGV positives and for each panel 9 out of 10 original samples were still available for this study. In addition, a CT panel was used to test the sensitivity for a diverse set of urogenital genovar types, D to K [23]. In addition, a specificity panel consisting of 48 microbial species, including several Chlamydia non-trachoma species, was used to assess the specificity of the newly developed assay.

Prospective clinical study

In September and October 2018 we included all routine samples which were sent to be tested for CT from patients attending the STI Public Health service of Amsterdam. The samples were screened for CT by amplification with the AC2 assay (Aptima Combo test, Hologic, USA) which tests concomitantly for CT and Neisseria gonorrhoeae. Anal swabs, ulcer swabs or urine samples from men were subsequently typed for LGV. Positive CT samples were genotyped using the validated pmpH polymerase chain reaction to differentiate LGV and non-LGV type infections [8].

Ethical clearance

This study was a methodological assessment to improve our diagnostic services. For this type of study the Medical Research Involving Human Subjects Act (WMO) does not apply, according to the Ethics of the Dutch law as declared by the Medical Ethics Review Committee AMC W19_496. #20.014.

Results

Test development

Full genome sequences of 157 Chlamydia trachomatis (CT) strains, including plasmid genes, were collected from the BIGsDB database (accessed in June 2017) [24]. ORF coding for the eight plasmid genes, pgp1 to pgp8, were analyzed for single nucleotide polymorphisms (SNP’s) differentiating LGV and non-LGV. These were detected in pgp1 (ORF3) and pgp3 (ORF5) with discriminating SNPs respectively on position 453 and 572 and conserved flanking sequences suitable for a forward and reverse primer. After initial technical validation, only the pgp3 assay validation was continued since the pgp1 assay proved to give low false-positive signals (not shown). In Fig 1 the alignment of the primers and probes relative to LGV and nonLGV consensus sequences is shown as generated from the 157 CT sequences. There is one G to A (LGV associated) SNP at position 572 and the LGV probe has an extra T nucleotide.

Fig 1. Alignment of primers and probes for the CT-LGV typing PCR targeting the pgp3 PCR.

Fig 1

Open in a new tab

For the position of the LNA bases see Table 1.

Technical specifications

The pgp3 PCR efficiency was 1.87 for the LGV target and 1.93 for the non-LGV target, suggesting efficient amplification of ~2 (doubling of PCR product with each cycle). The 95% limit of detection (LOD95) was 0.95 copies/μL for LGV and 1.2 copies/μL for non-LGV.

Specificity and sensitivity for different genovars

Genomic DNA from 48 non-Chlamydia trachomatis species, including C. psittacci, C. caviae, C. muridarum and C. abortus were tested. None were positive by the pgp3 assay, indicating 100% specificity.

To assess the sensitivity of the pgp3 assay, 23 DNA isolates from 8 different CT genovars D-K (all non-LGV) were tested as well. All were positive for non-LGV and negative for LGV. In addition, 18 quality control samples (9 from QCMD 2018 and 9 from QCMD 2019) were evaluated. The expected QCMD results were 2 nonLGV, 13 LGV and 3 negative samples. The TMA assay was 100% concordant for CT positivity with the expected QCMD results (S1 Table). The pmpH PCR assay had 47.4% concordance, with 0/2 nonLGV, 5/13 LGV and 3/3 negatives. In contrast the new pgp3 PCR assay had 94.7% concordance, with 2/2 nonLGV, 12/13 LGV and 3/3 negatives (S1 Table).

Prospective clinical validation

The new LNA pgp3 PCR assay was performed in parallel to the routinely used pmpH PCR on a prospective panel of 152 routine diagnostic samples. There were 145 (95.4%) rectal swabs, 3 (2%) ulcer swabs, 2 (1.3%) urines and 2 (1.3%) samples of unknown origin.

Out of 152 samples, 119 (78.3%) were successfully typed with pmpH PCR and 142 (93.4%) samples with the new pgp3 PCR assay. No LGV discrepancy was found between both assays (Table 2). The internal control was valid in all but one sample in these PCRs. So a substantial reduction in non-typeable results was observed, with only 6.6% for the pgp3 PCR assay versus 21.7% not typeable for the pmpH PCR assay. All those that could be additionally typed were non-LGV samples.

Table 2. Prospective comparison of 152 clinical samples between the new pgp3 PCR and the pmpH PCR to discriminate LGV from nonLGV types.

Total of 152 samples pmpH PCR N (%) pgp3 PCR N (%)
LGV positive 15 (9.9) 15 (9.9)
Non-LGV positive 101 (66.4) 124 (81.6)
Double positive 3 (2.0) 3 (2.0)
Non-typeable 33 (21.7) 10 (6.6)
Open in a new tab

Although both assays are not used quantitatively, the mean PCR Ct values were much lower for the pgp3 assay compared to the pmpH target. For LGV positives the mean difference was 3.7 Ct (mean of Ct 28.8 for pmpH PCR and Ct 25.1 for pgp3 PCR) and for non-LGV positives this was 3.2 Ct (mean of Ct 30.3 for pmpH PCR and Ct 27.1 for pgp3PCR). This translates to factor 13 (= 23.7) and factor 6.4 (= 23.2) increase in sensitivity for respectively the LGV and the nonLGV strains in patient samples.

Discussion

In this study we developed and validated a new LGV typing assay, to replace or add to the commonly used pmpH PCR [16,17]. While the performance of the pmpH PCR to detect LGV types is mostly satisfactorily in the clinical setting, the performance to detect non-LGV was too low, resulting in 15% to 25% non-typeable outcomes in this and in previous studies [17,25]. The newly developed assay targets one of the CT plasmid genes, which is estimated to be up to18 fold more frequently present compared to genomic CT DNA [18] and for the highly prevalent genovars D, E and F it was reported to be even up to 30 plasmid copies [26]. Using the data from the 152 Chlamydia trachomatis (CT) positive samples that were typed in this study we noted a factor 6.4 increase for nonLGV and factor 13 for LGV, which may be translated to the presence of a mean of 6 plasmid copies in the nonLGV strains and 13 copies in the LGV strains. This is of course an inaccurate way of calculating plasmid copies and further studies are needed.

The new plasmid-based assay proved to have 100% sensitivity to detect LGV subtypes, while decreasing the non-typeable outcomes from 21.7% to 6.6%. No cross reactivity was observed for a wide range of organisms, including four other Chlamydia species, indicating the assay to be specific. One of these four was C. muridarum which is often used as a model for human C. trachomatis infection studies [27].

The chosen target region is expected to be more stable (see also below) than a previously used plasmid associated target in the commercial CT nucleic acid detection based assays from Roche and Abbott at that time [28,29]. A deletion in the target on the cryptic plasmid led to diminished detection of certain CT strains. This strain was named the ‘Swedish variant’ since it was predominantly found in Sweden [28,29]. Recently Borges et al (2019) reported that some LGV strains were missed by using only ompA typing of CT in Portugal. This was due to a CT strain in which part of the D/Da ompA gene was integrated by recombination in the L2b ompA gene in an L2 background CT genome. The variant LGV strain caused symptoms and was correctly diagnosed using another LGV typing test that targeted the pmpH gene [30]. We tested DNA from this recombinant ompA LGV strain and were able to detect <50 copies/μL, showing that the pgp3 LGV PCR is also able to detect this recombinant strain.

In a previous study we reported that the CT genovar and its plasmid type are highly associated [13]. We expect that the pgp3 gene on the plasmid is stable and thus suitable for diagnosis since it has been associated with virulence factors [20,21,24,27,31]. It has been reported that deficiency in the pgp3 product, pGP3, leads to severely reduced virulence in in vivo mouse models using the closely related C. muridarum strain [21]. Plasmid free CT strains are rarely reported and in vitro mouse studies indicate that this type of strains are attenuated [19,27,32] so these may not pose a clinical problem in the human setting. More research is needed here.

In addition, our testing strategy is to first detect CT using a very sensitive screening assay (based on TMA) followed by typing CT positive samples derived from men with an ulcer or from an anal sample. According to the 2019 IUSTI guideline it is not recommended to include LGV subtype determination within standard STI screening assays, but only in case of a positive CT signal [14]. Presently, commercial assays are on the market that offer the possibility to type LGV strains as part of broad STI pathogen screening assay which leads to over-testing. Depending on local agreements with companies and costumers a commercial assay may be more expensive. Our LGV typing PCR is dedicated to only type those specimens that need to be typed according to the IUSTI recommendation [14], making it cost-efficient.

The fact that all samples that qualify for typing were already positive in the highly sensitive TMA screening assay minimises the possibility that certain CT strains will be missed. Diagnostic targets can however always be missed by single target assays, which was recently shown with the occurrence of mutations in the 23SrRNA gene, which caused missed infections in samples from Finland and Norway using the TMA AC2 assay from Hologic [33,34]. Therefor it may be a good testing strategy to perform a multiplex PCR, targeting both the pgp3 and the pmpH genes in one reaction.

Because the plasmid-based LGV typing assay was a mean of 3.2 Ct values (for nonLGV strains) to 3.7 Ct (for LGV strains) lower, an increase in sensitivity is to be expected for both LGV and non-LGV subtypes. This can be seen in the QCMD panel results where also more LGV samples were detected using the pgp3 PCR (S1 Table). Based on these results, and from our experience with more than two decades of routine testing for LGV, we speculate that LGV is mostly present in a higher bacterial load in clinical samples compared to non-LGV subtypes, so these LGV types were probably seldomly missed with the pmpH based assay.

To conclude, we developed a sensitive and specific plasmid-based typing PCR assay to discriminate LGV from non-LGV subtypes and to detect double LGV plus non-LGV infections. Further evaluations at other laboratories are recommended to confirm our findings.

Supporting information

S1 Table. QCMD 2018 and 2019 results.

(XLSX)

Click here for additional data file. (14.5KB, xlsx)
S1 File

(PDF)

Click here for additional data file. (73.6KB, pdf)

Acknowledgments

We thank Bart Versteeg for providing his data on full genomes of Chlamydia trachomatis including plasmid sequences. Researchers from Integrated DNA technologies are acknowledged for contributing to conceiving the LNA probes. We thank Vitor Borges for providing us DNA of the recombinant ompA D/L2 chlamydia strain and Servaas Morré and Jolein Pleijster for providing C. muridarum DNA.

Data Availability

All relevant data is included in the paper and its supplementary files.

Funding Statement

The Authors received no specific funding for this work.

References

  • 1.WHO | Report on global sexually transmitted infection surveillance 2018. WHO [Internet]. 2019 [cited 2019 Jun 11]; https://www.who.int/reproductivehealth/publications/stis-surveillance-2018/en/
  • 2.Peipert JF. Genital Chlamydial Infections. N Engl J Med. 2003;349(25):2424–30. 10.1056/NEJMcp030542 [DOI] [PubMed] [Google Scholar]
  • 3.De Vries HJC, Schim Van Der Loeff MF, Bruisten SM. High-resolution typing of Chlamydia trachomatis: Epidemiological and clinical uses. Curr Opin Infect Dis. 2015;28(1):61–71. 10.1097/QCO.0000000000000129 [DOI] [PubMed] [Google Scholar]
  • 4.Dean D, Bruno WJ, Wan R, Gomes JP, Devignot S, Mehari T, et al. Predicting phenotype and emerging strains among Chlamydia trachomatis infections. Emerg Infect Dis. 2009; 15(9):1385–94. 10.3201/eid1509.090272 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hadfield J, Harris SR, Seth-Smith HMB, Parmar S, Andersson P, Giffard PM, et al. Comprehensive global genome dynamics of Chlamydia trachomatis show ancient diversification followed by contemporary mixing and recent lineage expansion. Genome Res. 2017; (7):1220–1229. 10.1101/gr.212647.116 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Giffard PM, Brenner NC, Tabrizi SN, Garland SM, Holt DC, Andersson P, et al. Chlamydia trachomatis genotypes in a cross-sectional study of urogenital samples from remote Northern and central Australia. BMJ Open. 2016;6(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Joseph SJ, Didelot X, Rothschild J, De Vries HJC, Morré SA, Read TD, et al. Population genomics of chlamydia trachomatis: Insights on drift, selection, recombination, and population structure. Mol Biol Evol. 2012;29(12):3933–46. 10.1093/molbev/mss198 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Andersson P, Harris SR, Smith HMBS, Hadfield J, O’Neill C, Cutcliffe LT, et al. Chlamydia trachomatis from Australian Aboriginal people with trachoma are polyphyletic composed of multiple distinctive lineages. Nat Commun. 2016;7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Giffard PM, Andersson P, Wilson J, Buckley C, Lilliebridge R, Harris TM, et al. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments. PLoS One. 2018;13(4):1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Holt DC, Andersson P, Buckley C, Whiley DM, Giffard PM. Identification and Discrimination of Chlamydia trachomatis Ocular and Urogenital Strains and Major Phylogenetic Lineages by CtGEM Typing, A Double-Locus Genotyping Method. In: Methods in Molecular Biology. 2019. [DOI] [PubMed] [Google Scholar]
  • 11.Van der Bij AK, Spaargaren J, Morre SA, Fennema HSA, Mindel A, Coutinho RA, et al. Diagnostic and Clinical Implications of Anorectal Lymphogranuloma Venereum in Men Who Have Sex with Men: A Retrospective Case-Control Study. Clin Infect Dis. 2006;15;42(2):186–94. 10.1086/498904 [DOI] [PubMed] [Google Scholar]
  • 12.Geisler WM, Morrison SG, Bachmann LH. Absence of Lymphogranuloma Venereum Strains Among Rectal Chlamydia trachomatis Outer Membrane Protein A Genotypes Infecting Women and Men Who Have Sex With Men in Birmingham, Alabama. Sex Transm Dis. 2008;35(10):856–9. 10.1097/OLQ.0b013e3181788313 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lanjouw E, Ouburg S, de Vries HJ, Stary A, Radcliffe K, Unemo M. 2015 European guideline on the management of Chlamydia trachomatis infections. Int J STD AIDS. 2016; (5):333–48. 10.1177/0956462415618837 [DOI] [PubMed] [Google Scholar]
  • 14.de Vries HJC, de Barbeyrac B, de Vrieze NHN, Viset J., White JA, Vall Mayans M, et al. 2019 European guideline on the management of lymphogranuloma venereum. J Eur Acad Dermatology Venereol. 2019;33(10):1821–1828.; [DOI] [PubMed] [Google Scholar]
  • 15.Chernesky M, Castriciano S, Jang D, Smieja M. Use of flocked swabs and a universal transport medium to enhance molecular detection of Chlamydia trachomatis and Neisseria gonorrhoeae. J Clin Microbiol. 2006;44(3):1084–6. 10.1128/JCM.44.3.1084-1086.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Morré SA, Spaargaren J, Fennema JSA, DeVries HJC, Coutinho RA, Peña AS. Real-time polymerase chain reaction to diagnose lymphogranuloma venereum. Emerg Infect Dis. 2005;11(8):1311–2. 10.3201/eid1108.050535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Quint KD, Bom RJM, Bruisten SM, van Doorn LJ, Nassir Hajipour N, Melchers WJG, et al. Comparison of three genotyping methods to identify Chlamydia trachomatis genotypes in positive men and women. Mol Cell Probes. 2010;24(5):266–77. 10.1016/j.mcp.2010.04.007 [DOI] [PubMed] [Google Scholar]
  • 18.Last AR, Roberts CH, Cassama E, Nabicassa M, Molina-Gonzalez S, Burr SE, et al. Plasmid copy number and disease severity in naturally occurring ocular chlamydia trachomatis infection. J Clin Microbiol. 2014;52(1):324–7. 10.1128/JCM.02618-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Pickett MA, Everson JS, Pead PJ, Clarke IN. The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): Accurate determination of copy number and the paradoxical effect of plasmid-curing agents. Microbiology. 2005;151(3):893–903. [DOI] [PubMed] [Google Scholar]
  • 20.Ferreira R, Borges V, Nunes A, Borrego MJ, Gomes JP. Assessment of the load and transcriptional dynamics of Chlamydia trachomatis plasmid according to strains’ tissue tropism. Microbiol Res. 2013;168(6):333–9. 10.1016/j.micres.2013.02.001 [DOI] [PubMed] [Google Scholar]
  • 21.Guangming Zhong. Chlamydial Plasmid-Dependent Pathogenicity. Physiol Behav. 2016;176(1):139–48. [Google Scholar]
  • 22.Van Houdt R, Bruisten SM, Koedijk FDH, Dukers NHTM, Op De Coul ELM, Mostert MC, et al. Molecular epidemiology of acute hepatitis B in the Netherlands in 2004: Nationwide survey. J Med Virol. 2007;79(7):895–901. 10.1002/jmv.20820 [DOI] [PubMed] [Google Scholar]
  • 23.Versteeg B, Himschoot M, Van Den Broek IVF, Bom RJM, Speksnijder AGCL, van der Loeff MFS, et al. Urogenital Chlamydia trachomatis strain types, defined by high-resolution multilocus sequence typing, in relation to ethnicity and urogenital symptoms among a young screening population in Amsterdam, The Netherlands. Sex Transm Infect. 2015;91(6):415–22. 10.1136/sextrans-2014-051790 [DOI] [PubMed] [Google Scholar]
  • 24.Versteeg B, Bruisten SM, Pannekoek Y, Jolley KA, Maiden MCJ, van der Ende A, et al. Genomic analyses of the Chlamydia trachomatis core genome show an association between chromosomal genome, plasmid type and disease. BMC Genomics. 2018;19(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Versteeg B, Bruisten SM, Heijman T, Vermeulen W, Van Rooijen MS, Van Dam AP, et al. Monitoring therapy success of urogenital Chlamydia trachomatis infections in women: A prospective observational cohort study. PLoS One. 2017;12(9). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lopez-Pintor J, Maruri A, Garcia L, Rodriquez M, Menendez B, GalanJ. O0028 Evaluation of virulence among different invasive and non-invasive genotypes in Chlamdyia trachomatis. In: ECCMID. 2019.
  • 27.Song L, Carlson JH, Whitmire WM, Kari L, Virtaneva K, Sturdevant DE, et al. Chlamydia trachomatis plasmid-encoded pgp4 is a transcriptional regulator of virulence-associated genes. Infect Immun. 2013;81(3):636–44. 10.1128/IAI.01305-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ripa T, Nilsson P. A variant of Chlamydia trachomatis with deletion in cryptic plasmid: implications for use of PCR diagnostic tests. Euro Surveill. 2006;11(11). [DOI] [PubMed] [Google Scholar]
  • 29.Herrmann B, Törner A, Low N, Klint M, Nilsson A, Velicko I, et al. Emergence and spread of Chlamydia trachomatis variant, Sweden. Emerg Infect Dis. 2008;14(9):1462–5. 10.3201/eid1409.080153 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Borges V, Cordeiro D, Salas AI, Lodhia Z, Correia C, Isidro J, et al. Chlamydia trachomatis: when the virulence-associated genome backbone imports a prevalence-associated major antigen signature. Microb Genom. 2019;5(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hou S, Sun X, Dong X, Lin H, Tang L, Xue M, et al. Chlamydial plasmid-encoded virulence factor Pgp3 interacts with human cathelicidin peptide LL-37 to modulate immune response. Microbes Infect. 2019;21(1):50–5. 10.1016/j.micinf.2018.06.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Lehr S, Vier J, Häcker G, Kirschnek S. Activation of neutrophils by Chlamydia trachomatis-infected epithelial cells is modulated by the chlamydial plasmid. Microbes Infect. 2018;20(5):284–292. 10.1016/j.micinf.2018.02.007 [DOI] [PubMed] [Google Scholar]
  • 33.Rantakokko-Jalava K, Hokynar K, Hieta N, Keskitalo A, Jokela P, Muotiala A, et al. Chlamydia trachomatis samples testing falsely negative in the Aptima Combo 2 test in Finland, 2019. Euro Surveill. 2019;24(22). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hokynar K, Rantakokko-Jalava K, Hakanen A, Havana M, Mannonen L, Jokela P, et al. The Finnish New Variant of Chlamydia trachomatis with a Single Nucleotide Polymorphism in the 23S rRNA Target Escapes Detection by the Aptima Combo 2 Test. Microorganisms. 2019; 7(8). [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Deborah Dean

26 Feb 2020

PONE-D-19-34266

Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples.

PLOS ONE

Dear Dr. Bruisten,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please provide a point by point response response to the reviewers' comments with appropriate revisions.

We would appreciate receiving your revised manuscript by two months. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Deborah Dean, M.D., M.P.H.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Funding Section of your manuscript:

"Funding was provided by the Public Health laboratory for this study, no additional resources

were obtained."

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

"The author(s) received no specific funding for this work."

3. We note that you have indicated that data from this study are available upon request. PLOS only allows data to be available upon request if there are legal or ethical restrictions on sharing data publicly. For information on unacceptable data access restrictions, please see http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions.

In your revised cover letter, please address the following prompts:

a) If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially identifying or sensitive patient information) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent.

b) If there are no restrictions, please upload the minimal anonymized data set necessary to replicate your study findings as either Supporting Information files or to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. Please see http://www.bmj.com/content/340/bmj.c181.long for guidelines on how to de-identify and prepare clinical data for publication. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories.

We will update your Data Availability statement on your behalf to reflect the information you provide.

4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The study performed by Pieter W. Smit and colleagues aimed at presenting a sensitive and specific plasmid-based typing PCR assay to discriminate LGV from non-LGV subtypes. In my opinion, it deserves to be published if a proper revision is performed.

Major points:

- I have no doubts that this is a very useful study, presenting a very useful tool, which focuses a major ongoing problem in Chlamydia trachomatis. However, the authors do not properly explain why this is so important! There is a lack of information (either in the Introduction or in the Discussion), regarding the importance of detecting the LGV cases, the epidemic of the LGV cases during the last 10-15 years, the sexual networks behind this, the demand of multiple countries for the obligatory notification of the LGV cases, the different duration of the treatment, etc, etc.

- Also, the paper is not presented in an attractive fashion. It is sometimes too vague, lacking the rationale behind the used approaches. The order by which the sub-sections of the Methods is presented is a perfect example of this. The sub-set of samples are somehow confusing. The paper should follow the basic structure: Background on Chlamydia and LGV, identification of the problem, aims of the study to solve the problem, and adopted strategy.

- I would definitely add a detailed schematic figure presenting the plasmid region with the SNPs differentiating LGV and non-LGV strains and the location of the primers/probes.

Minor points to be considered:

-

- Page 3, Introduction: Refª 4 is too specific. I suggest replace it by a more general one or include additional refs;

- Page 3, Introduction: Line 5 states that types “B, D to K, infect cervical and vaginal sites (…)”. The reader may become confused as in the previous sentence, it is stated “ocular types are A, B and C…” Please rephrase it;

- Page 3, Introduction: “The LGV associated types need longer and more stringent treatment”. I would describe the dissimilar treatments for these two types of genital infections (non-LGV vs LGV) in order to make it a more comprehensive / interesting paper. At some instances, the paper seems excessively straightforward.

- Page 3, Introduction, last paragraph: “The sensitivity of this PCR was improved (8) but detection of this single copy pmpH gene was still at best 85% relative to the commercial TMA Aptima Combo2 test, as a screening assay, which detects RNA copies of the 23SrRNA gene (9)”. I suggest rephrasing or altering some refs because it is really weird the way it is written. In fact, ref 8 is from 2010 and ref 9 is from 2005. Obviously, ref 9 has nothing to do with ref 8. I would expect to see a ref posterior of 2008 to support the statement of the 85% sensitivity.

- Page 3, Introduction, last paragraph: As the present study is focused on the use of the plasmid, I would strengthen the refs supporting the plasmid copy number. Besides ref 10, I would add: Ferreira et al 2013, https://doi.org/10.1016/j.micres.2013.02.001 , and Pickett et al 2005, https://doi.org/10.1099/mic.0.27625-0

- Page 3, Methods: I suggest a different organization of the methods. Usually we start by the “study population”, the “N”, the “rationale for the different approaches”. It does not make sense to start by the “DNA extraction” without explaining the strategy and “N”;

- Page 5, Analytical validation: “fivefold dilution series was performed in eightfold”. Not sure what this means;

- Page 5, Analytical validation: Do not use the abbreviation TMA as it was not used before in the text;

- Page 5, Analytical validation, last paragraph: Please state how many samples were enrolled in these panels (i.e., QCMD and the second panel for types D to K). The information is too vague here. I realized later that only in page 7 this information is included.

- Page 7, Technical specifications: Where do this come from…? How was it calculated? What was the “N” use to calculate the efficiency? What is the meaning of “1.87” efficiency?

- Page 9, Discussion: Please rephrase the second sentence;

- Page 9, Discussion, line 6: I would add here the two references suggested above;

- Page 9, Discussion, line 7: Ref 15 is from an Abstract of a poster. I have no idea if PLoSOne accepts such references. Also, I do not know if the authors have used accurate real-time-based absolute quantitative approaches as the ones used in ref 10 and also in Ferreira et al 2013. Plasmid numbers of 30 seem to contrast with at least 3 previous accurate studies…

- Page 9, Discussion: Please complete ref 18. Why the bioRxiv? I found out that the paper is published.

- Page 10, Discussion, first sentence: Why ref 13, here? Others are much more appropriate, such as: Song et al 2013 (doi: 10.1128/IAI.01305-12), Lehr S et al 2018 (doi: 10.1016/j.micinf.2018.02.007), Zhong G 2017 (doi: 10.1016/j.tim.2016.09.006).

- Page 10, Discussion: “Presently, commercial assays are on the market that offer the possibility to type LGV strains as part of broad STI pathogen screening assay which thus are not in line with the IUSTI recommendations”. Why would this constitute a problem…? Only if it increments the cost of the already existing diagnostic test, right? Are they more expensive than the ones that exist for the last decade? Is that the case? If yes, please state it clearly, because it is a strong argument. However, you must be sure of what you are saying.

- Page 10, Discussion: “…an increase in sensitivity was only observed for non-LGV subtypes…” This statement makes no sense. One cannot compare such sensitivities by using radically different denominators (15 LGV samples versus more than 100 non-LGV samples). Please rephrase it.

Reviewer #2: The manuscript titled “Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples” by Smit et al was submitted to be published in PLoS ONE.

The work describes a new typing strategy in Chlamydia trachomatis based on real time PCR using a single nucleotide variation (SNV) in pgp3 gene, located in the cryptic plasmid. The authors found a higher sensitivity around 10-fold respect to the classical insertion/deletion in pmpH gene for non-LGV CT subtypes.

The work is well presented, and the results are interesting. I have a few questions for the authors. For instance,

Why they used 2mcL of DNA in pmpH approach and 5 mcL in pgp3. Could this difference have any impact in the sensitivity?

In the specificity test, Chlamydia muridanum must be included, because this specie is phylogenetically more related to C. trachomatis compared to C. caviae, C. abortus or C. psittacci.

If the authors found identical sensitivity for LGV using pmpH or pgp3 approach, could be suggested the typing based on pmpH gene in first step and those non-typeable cases analyzed using pgp3 gene?

The difference in Ct value is 2 (not 3 cycles as the authors are proposing) and consequently the sensitivity could be low to 10-fold.

The QCMD panels must be described, briefly. The section of result referred to sensitivity should be explained clearly.

could be commented the impact of plasmid free C.trachomatis strains?.

I would recommended to review the supplementary information; could you present this data in English language?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Juan Carlos Galan

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Jun 4;15(6):e0233990. doi: 10.1371/journal.pone.0233990.r002

Author response to Decision Letter 0

24 Apr 2020

To the Editor,

PlosOne

April 24, 2020

Cover letter regarding manuscript:

“Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples.”

Dear Prof. dr. Deborah Dean,

We are pleased to re-submit a manuscript on Chlamydia trachomatis (CT) typing which describes a new assay that allows sensitive discrimination of lymphogranuloma venereum (LGV) versus non-LGV strains. We are very greatful for the constructive comments of the reviewers. All points that were raised were answered to the best of our knowledge.

We sincerely hope that you will consider our manuscript to be suitable for publication in PLOS ONE.

On behalf of our co-authors,

Sincerely yours,

Dr Sylvia M. Bruisten, PhD (corresponding author)

Public health laboratory

Department of Infectious diseases,

Public Health Service of Amsterdam (GGD Amsterdam),

Nieuwe Achtergracht 100,

1018 WT Amsterdam,

the Netherlands

Phone: +31-20-5555376

E-mail: sbruisten@ggd.amsterdam.nl

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The study performed by Pieter W. Smit and colleagues aimed at presenting a sensitive and specific plasmid-based typing PCR assay to discriminate LGV from non-LGV subtypes. In my opinion, it deserves to be published if a proper revision is performed.

AU: Thank you for giving us the opportunity to improve our manuscript to make it more attractive for readers of PlosOne. We appreciate your input and your help with using the right references.

Major points:

- I have no doubts that this is a very useful study, presenting a very useful tool, which focuses a major ongoing problem in Chlamydia trachomatis.

However, the authors do not properly explain why this is so important! There is a lack of information (either in the Introduction or in the Discussion), regarding the importance of detecting the LGV cases, the epidemic of the LGV cases during the last 10-15 years, the sexual networks behind this, the demand of multiple countries for the obligatory notification of the LGV cases, the different duration of the treatment, etc, etc.

AU: Thank you for this valuable comment. Indeed we agree that detecting LGV types is very important and also to put this in the context of the ongoing LGV epidemic. We previously tried to submit this paper to another Journal where only a limited number of words and references were allowed. When opting for PlosOne we accidentally omitted to adjust the manuscript to all of the PlosOne requirements and use the possibility to expand the background and discussion. We have now elaborated more over these different subjects and have also used more suitable references.

To our defense: this is in essence a technical paper and we did not aim to write a review on LGV epidemics etc. Nevertheless, we have now rewritten parts of the Introduction and Discussion to strengthen our message that it is very important to sensitively type Chlamydia trachomatis positive samples for LGV.

- Also, the paper is not presented in an attractive fashion. It is sometimes too vague, lacking the rationale behind the used approaches. The order by which the sub-sections of the Methods is presented is a perfect example of this. The sub-set of samples are somehow confusing. The paper should follow the basic structure: Background on Chlamydia and LGV, identification of the problem, aims of the study to solve the problem, and adopted strategy.

AU; We again fully agree with the reviewer that the paper can be much improved by following a more strict format. We adjusted the structure of the total manuscript and hope that it has improved, making parts of the text more comprehensive.

Large parts of the manuscript were rewritten, with the study aims in the Introduction and we added and adjusted subject headings in Materials and Methods, which now starts with the study strategy which includes acceptance criteria. Sample selection is subdivided for the analytical phase and the clinical phase of this validation study; it seems most logical for us to still mention these in the relevant paragraphs.

- I would definitely add a detailed schematic figure presenting the plasmid region with the SNPs differentiating LGV and non-LGV strains and the location of the primers/probes.

AU: Thank you for this suggestion which we gladly follow. A new Figure 1 has been added which shows the location of primers and probes in the pgp3 gene and also shows the SNP which distinguishes the LGV from the nonLGV types, relative to 157 sequences of strains that were aligned earlier and were retrieve from GenBank (ref Versteeg et al, BMC Genomics, 2018).

Minor points to be considered:

-

- Page 3, Introduction: Refª 4 is too specific. I suggest replace it by a more general one or include additional refs;

AU: We agree and replaced it for a couple of more general references (Andersson et al Nature comm, 2016; Giffard et al PlosOne 2018, Holt et al, Methods Mol Biol. 2019 Joseph et al, Mol biol Evol 2012; Andersson et al, Nature communications, 2016, Giffard et al, 2018; Holt et al, Methods Mol Biol. 2019;2042:87-122).

- Page 3, Introduction: Line 5 states that types “B, D to K, infect cervical and vaginal sites (…)”. The reader may become confused as in the previous sentence, it is stated “ocular types are A, B and C…” Please rephrase it;

AU: We agree. However, we first want to mention that ocular types are A, B, Ba and C and then come to the urogenital types which are B to K. Indeed types B and Ba are found both at ocular and urogenital sites. We do not think this is confusing but still added another sentence to point this out:: ‘ So genovars B and Ba may be found both at ocular and urogenital locations (6,9).’

- Page 3, Introduction: “The LGV associated types need longer and more stringent treatment”. I would describe the dissimilar treatments for these two types of genital infections (non-LGV vs LGV) in order to make it a more comprehensive / interesting paper. At some instances, the paper seems excessively straightforward.

AU: Again we fully agree. Again, this short previous description is due to not realizing that for PlosOne we are not restricted to the number of words, nor to the number of references. We have now elaborated on this on page 3 and . :

“ LGV testing is strongly recommended for MSM with anorectal chlamydia sinceThe LGV associated types need longer and more stringent treatment. If untreated or treated inadequately LGV infection may cause chronic or irreversible complications, including fistulas, strictures, genital elephantiasis, frozen pelvis, or infertility (van der Bij, 2006). An urogenital nonLGV chlamydia is treated with a single dose of 1 g of azithromycin (Lanjouw et al, Int J STD Aids, 2016). According to the most recent European guideline, an LGV infection is treated much longer and more stringent with doxycycline 100 mg, twice a day, orally for 21 days (20= de Vries et al, J Eur acad, 2019). This same treatment is recommended also in asymptomatic patients and contacts of LGV patients. If another regimen is used, a test of cure must be performed.”

- Page 3, Introduction, last paragraph: “The sensitivity of this PCR was improved (8) but detection of this single copy pmpH gene was still at best 85% relative to the commercial TMA Aptima Combo2 test, as a screening assay, which detects RNA copies of the 23SrRNA gene (9)”. I suggest rephrasing or altering some refs because it is really weird the way it is written. In fact, ref 8 is from 2010 and ref 9 is from 2005. Obviously, ref 9 has nothing to do with ref 8. I would expect to see a ref posterior of 2008 to support the statement of the 85% sensitivity.

AU: We agree that these two tests, the CT-typing targeting the pmpH gene (ref 8) and the much longer existing TMA assay (ref 9) refer to different entities. In itself our statement was correct but we have now rephrased this part to:

“In many diagnostic laboratories, and also in our laboratory, a very sensitive screening assay is used to detect all Chlamydia types. In case of our laboratory this is the commercial Aptima Combo2 test which uses transcription mediated amplification (TMA) that detects RNA copies of the 23SrRNA gene (15). Per bacterial cell hundreds to thousands of these RNA molecules are present leading to ultra-high sensitivity of the TMA. For subsequent typing to discriminate between LGV and nonLGV a diagnostic PCR was developed already in 2005 (16), targeting the pmpH gene. The sensitivity of this PCR was improved (17) but detection of this single copy pmpH gene was still at best 85% relative to the TMA screening assay..”

- Page 3, Introduction, last paragraph: As the present study is focused on the use of the plasmid, I would strengthen the refs supporting the plasmid copy number. Besides ref 10, I would add: Ferreira et al 2013, https://doi.org/10.1016/j.micres.2013.02.001 , and Pickett et al 2005, https://doi.org/10.1099/mic.0.27625-0

AU: Thank you for your valuable suggestions of these references. We have now incorporated those mentioned and also some additional ones. We rephrased the statement to:

“In this study we now aimed to improve the LGV/non-LGV typing PCR by looking for suitable genes located on the CT plasmid, which was described to occur in 6 to 18 copies per bacterial cell (10) (15, Pickett el al, 2005; Ferreira et al, 2013) , thus improving the sensitivity of the LGV typing PCR tenfold. The CT plasmid is 7.5 kb long and encodes 8 open reading frames (ORF), coding for several regulatory and virulence factors, being all plasmid glycoproteins (pGP) (Zhong, Trends Microbiol, 2017) . (Page 4, Introduction)

- Page 3, Methods: I suggest a different organization of the methods. Usually we start by the “study population”, the “N”, the “rationale for the different approaches”. It does not make sense to start by the “DNA extraction” without explaining the strategy and “N”;

AU: We partly agree, please see also our reply in the general comments above.

- Page 5, Analytical validation: “fivefold dilution series was performed in eightfold”. Not sure what this means;

AU: This means that a dilution series was prepared with factor 5 between the dilutions. Each dilution was tested 8 times. This was also adjusted in the manuscript:

“To determine the 95% limit of detection (LOD95), a dilution series was prepared with factor 5 between the dilutions. Each dilution was tested 8 times. (Page7 Methods)

- Page 5, Analytical validation: Do not use the abbreviation TMA as it was not used before in the text;

AU: We have now adjusted it to ‘Transcription mediated amplification (TMA)’. In the same line, we have now also written ‘QCMD’ in full in the first instance where it appeared (Page 5).

- Page 5, Analytical validation, last paragraph: Please state how many samples were enrolled in these panels (i.e., QCMD and the second panel for types D to K). The information is too vague here. I realized later that only in page 7 this information is included.

AU: We agree and have now added more details both on page 5 and also in Results (Page,9) where we now refer to a Supplementary Table 1. In this added table all data on results for TMA, pmpH PCR and pgp3 PCR are shown, next to the expected results from QCMD.

- Page 7, Technical specifications: Where do this come from…? How was it calculated? What was the “N” use to calculate the efficiency? What is the meaning of “1.87” efficiency?

AU: PCR efficiency is expressed from 0-2 as being the amplification efficiency of the PCR product. The best PCR doubles its product with each cycle (2), the worst doesn’t amply at all, and thus has efficiency of 0. This has been addressed in the manuscript;” The pgp3 PCR efficiency was 1.87 for the LGV target and 1.93 for the non-LGV target, suggesting efficient amplification of ~2 (doubling of PCR product with each cycle).”

- Page 9, Discussion: Please rephrase the second sentence;

AU: This sentence is now rephrased as follows: While the performance of the pmpH PCR to detect LGV types is sensitive, the performance to detect non-LGV was too low, resulting in 15% to -25% non-typeable outcomes in this and in previous studies (8,14).

- Page 9, Discussion, line 6: I would add here the two references suggested above;

AU: Indeed we have now added these references as also mentioned above.

- Page 9, Discussion, line 7: Ref 15 is from an Abstract of a poster. I have no idea if PLoSOne accepts such references. Also, I do not know if the authors have used accurate real-time-based absolute quantitative approaches as the ones used in ref 10 and also in Ferreira et al 2013. Plasmid numbers of 30 seem to contrast with at least 3 previous accurate studies…

AU: Using an abstract as reference seems to be allowed for PlosOne (the editor may know this) so we have kept this reference. We now added also other references:

Pickett et al, Microbiol 2005; Song et al, Inf and Immun 2013; Lehr et al, microbes and Inf, 2018),. For our assay we quantitated by using known numbers of the gBlock constructs, please see result section.

With respect to the 30 plasmid copies in one bacterial cell: this is what the authors from that study claim. It seems that, depending on the Chlamydia lineage and on the virulence, the copy numbers of plasmids vary indeed between 6 to 30 copies. For our diagnostic assay, which is a qPCR that amplifies exponentially with factor 2 each cycle, this just means the following: if there is a ten-fold difference in input (so 10 plasmid copies per CT versus 1 chromosomal gene copy) the Ct value difference is 3.322 (= 2log(10)). In practice we measured a mean difference of 3.7 Ct values (=28.8 for pmpH – 25.1 for pgp3) for LGV strains which would be in agreement with a mean plasmid copy number of 13 (=2e3.7 for LGV types). For nonLGV types we found a mean difference of 3.2 Ct values (30.3 for pmpH – 27.1 for pgp3) leading to an estimated plasmid copy number of 6.4. So indeed, 30 plasmid copies is probably rare and 6 copies (for nonLGV) to 13 copies (for LGV) seems more realistic.

- Page 9, Discussion: Please complete ref 18. Why the bioRxiv? I found out that the paper is published.

AU: Indeed, when submitting to previous journals this paper was not published yet. This has now been updated (reference 30).

- Page 10, Discussion, first sentence: Why ref 13, here? Others are much more appropriate, such as: Song et al 2013 (doi: 10.1128/IAI.01305-12), Lehr S et al 2018 (doi: 10.1016/j.micinf.2018.02.007), Zhong G 2017 (doi: 10.1016/j.tim.2016.09.006).

AU: Thank you again for pointing out these interesting publications to us. We have looked up these references and indeed included them all now. We keep ref 13 since we showed here that the CT core genome and its plasmid genes are related per CT type this has been better specified Since PlosOne has no restriction on the number of references we are pleased to be able to expand the reference list.

- Page 10, Discussion: “Presently, commercial assays are on the market that offer the possibility to type LGV strains as part of broad STI pathogen screening assay which thus are not in line with the IUSTI recommendations”. Why would this constitute a problem…? Only if it increments the cost of the already existing diagnostic test, right? Are they more expensive than the ones that exist for the last decade? Is that the case? If yes, please state it clearly, because it is a strong argument. However, you must be sure of what you are saying.

AU: Actually there is no problem with using commercial tests in itself but in the guideline is recommended to first screen for CT and, if positive to also perform additional testing by typing for LGV in case of anal samples in men. Many commercial assays do both tests (CT detection and LGV typing) simultaneously, leading to over-testing. This is not recommended in the guideline for obvious reasons (See: de Vries et al, J Eur acad, 2019).

Indeed this in-house PCR is less expensive than most commercial assays in our setting. This can however not be a general argument, since it depends on many factors, such as cost of personal, deals with companies where the kits are purchased and of course also how much can be charged for performing the tests. Therefor we did not explicitly mention the cost argument. We have now adjusted this part (page 12, second paragraph).

- Page 10, Discussion: “…an increase in sensitivity was only observed for non-LGV subtypes…” This statement makes no sense. One cannot compare such sensitivities by using radically different denominators (15 LGV samples versus more than 100 non-LGV samples). Please rephrase it.

AU: We agree and have rephrased this part to:

Even though the plasmid-based LGV typing assay was a mean of 3.2 Ct values (for nonLGV strains) to 3.7 Ct (for LGV strains) lower, an increase in sensitivity is to be expected for both LGV and non-LGV subtypes. This can be seen in the QCMD panel results where also more LGV samples were detected using the pgp3 PCR (S1_Supplementary table 1).

Reviewer #2: The manuscript titled “Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples” by Smit et al was submitted to be published in PLoS ONE.

The work describes a new typing strategy in Chlamydia trachomatis based on real time PCR using a single nucleotide variation (SNV) in pgp3 gene, located in the cryptic plasmid. The authors found a higher sensitivity around 10-fold respect to the classical insertion/deletion in pmpH gene for non-LGV CT subtypes.

The work is well presented, and the results are interesting.

AU: Thank you.

I have a few questions for the authors. For instance,

Why they used 2mcL of DNA in pmpH approach and 5 mcL in pgp3. Could this difference have any impact in the sensitivity?

AU: In a PCR reaction, which is an exponential increase of amplimers, the original input does not formidably influence the Ct value. An input of 2µL versus 5µL is a factor 2.5 difference which will lead to a maximum difference in Ct value of 1.32 ( 21.32=2.5). In routine diagnostics there are always flaws, such as contaminants which (partly) inhibit a PCR. Therefor we define a difference in Ct values of <1 as ‘not relevant’. So also a difference in input of 2µL versus 5µL is really not much influencing the qualitative outcome: positive or negative. The choice for input volume is made on practical grounds, once it is used in combination with a certain mastermix or certain primer/probe sets.

In the specificity test, Chlamydia muridanum must be included, because this specie is phylogenetically more related to C. trachomatis compared to C. caviae, C. abortus or C. psittacci.

AU: We indeed see in the literature that C. muridarum is often mentioned as a good mouse model for human pathogenesis with C. trachomatis. Besides testing C. muridarum DNA, we also assessed the performance of the PCR using PrimeReport. Both showed that the pgp3 PCR is unable to detect in silico and in-vitro C. muridarum. We adjusted this both in Methods and results.

If the authors found identical sensitivity for LGV using pmpH or pgp3 approach, could be suggested the typing based on pmpH gene in first step and those non-typeable cases analyzed using pgp3 gene?

AU: This may indeed be a strategy, but then labs would have to perform multiple successive testing steps and that would delay the test result. If the aim is that no strains are missed in case one of the genes would mutate, it would be better to combine both targets (so perform a multiplex test) and then declare the result as positive if one of both targets is positive. But actually it is smarter to first use the TMA assay (since it is more sensitive) and then use the pgp3 assay, since it is more sensitive than the pmpH PCR. If in doubt (for example that plasmids may be lacking or that mutations had arisen in the primers or probe for the pgp3 gene, then use the pmpH gene PCR. as confirmatory assay. We have now added the strategy to multiplex both genes in the text (Discussion, page 12: Therefor it may be a good testing strategy to perform a multiplex PCR, targeting both the pgp3 and the pmpH genes in one reaction.

The difference in Ct value is 2 (not 3 cycles as the authors are proposing) and consequently the sensitivity could be low to 10-fold.

AU: we do not really get the point here. If we look at our Ct values these actually do show a mean difference of 3.2 Ct values (for nonLGV strains) and 3.7 Ct (for LGV strains. See also our reply to comments of reviewer 1.

The QCMD panels must be described, briefly. The section of result referred to sensitivity should be explained clearly.

AU: Thank you for this comment. We agree that the QCMD panels were not adequately described, as was also remarked by the other reviewer. We have now made adjustments in Methods and Results and added a Supplementary Table 1 in which all QCMD results are shown in detail.

could be commented the impact of plasmid free C. trachomatis strains?

AU: This is an important point, thank you for bringing it up. Actually an increasing number of publications show that several plasmid ORFs code for virulence factors (refs…). And truly plasmid free CT bacteria seem to be attenuated. We have now commented on this (Page…):

Plasmid free CT strains are rarely reported and in vitro/mouse studies indicate that this type of strains are attenuated (Song et al, Inf and Immun 2013; Lehr et al, microbes and Inf, 2018), so these may not pose a clinical problem in the human setting. More research is needed here.

I would recommended to review the supplementary information; could you present this data in English language?

AU: We do not know if we correctly understand this comment. In the original manuscript there was no supplementary data. Only the ethical statement which was supplied as demanded by the editor, was both in Dutch and in English. The Dutch version was only given to show the literal text.

In the present manuscript a Supplementary Table 1 was added showing the QCMD data; this table is in English only.

Decision Letter 1

Deborah Dean

18 May 2020

Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples.

PONE-D-19-34266R1

Dear Dr. Bruisten,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Deborah Dean, M.D., M.P.H.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (No Response)

Reviewer #2: The new version has greatly improved respect to first draft. The manuscript is now easy to read and the too vague aspects have been clarified. The authors have given response to all reviewer's questions. In fact, they have introduced in main text many of the recommendations suggested by reviewers.

The current version help us to understand better the impact and improvement in the LGV diagnosis.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Juan Carlos Galán Microbiology Department, Hospital Ramón y Cajal, Madrid, Spain; CIBER in Epidemiology and Public Health, Spain.

Acceptance letter

Deborah Dean

20 May 2020

PONE-D-19-34266R1

Reduction of non-typeable results using a plasmid oriented Lymfogranuloma venereum PCR for typing of Chlamydia trachomatis positive samples.

Dear Dr. Bruisten:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Deborah Dean

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Table. QCMD 2018 and 2019 results.

    (XLSX)

    Click here for additional data file. (14.5KB, xlsx)
    S1 File

    (PDF)

    Click here for additional data file. (73.6KB, pdf)

    Data Availability Statement

    All relevant data is included in the paper and its supplementary files.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES