Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Recombinant DNA reagent (Homo sapiens) | APOL1-G0 | NCBI | BC143038.1 | cDNA |
| Recombinant DNA reagent (Homo sapiens) | APOL1-G1 | NCBI | AF305428.1 | cDNA |
| Recombinant DNA reagent (Homo sapiens) | APOL1-G2 | 1000 genomes project, this paper |
cDNA *Constructed from mutagenesis from APOL1-G0. Protein coding sequence based off of 1000 genomes data |
|
| Recombinant DNA reagent PRG977 |
PRG977 | Regeneron | ||
| Recombinant DNA reagent and transfected construct pcDNA5/FRT/TO | pcDNA5 | Thermo Fisher |
V652020 | APOL1 variants cloned into this plasmid to generate stable cell line (FT293-APOL1_ |
| Recombinant DNA reagent and transfected construct pOG44 | p0G44 | Thermo Fisher |
V600520 | |
| Recombinant DNA reagent and transfected pcDNA6/Tet-repressor | pcDNA6/Tet-repressor | Thermo Fisher |
R25001 | |
| Recombinant DNA reagent and transfected Str-KDEL-SBP-EGFP-GPI | RUSH | Addgene | 65293 | Gift from Franck Perez. APOL1 variants cloned into this plasmid for transfection into cells (RUSH-APOL1). GFP and GPI anchor removed |
| Recombinant DNA reagent and transfected pGP-CMVB-GCaMP6f | GCaMP6f | Addgene | 40755 | A gift from Douglas Kim and the GENIE project |
| Recombinant DNA reagent and transfected CMV-ER-LAR-GECO1 | ER-LAR-GECO | Addgene | 61244 | A gift from Robert Campbell |
| Recombinant DNA reagent and transfected CMV-FliCR |
FliCR | Addgene | 74142 | A gift from Robert Campbell |
| Sequence based reagent | APOL1_G0 K150E mutagenesis primers | This paper | PCR primer pair | F:5'TGAAAGAGTTTCCTCGGTTGAAAAGTGAGCTTGAGGATAAC
R:5'GTTATCCTCAAGCTCACTTTTCAACCGAGGAAACTCTTTCA |
| Sequence based reagent | APOL1-G0 E150 Conversion to G1 mutagenesis Round 1 (S243G) |
This paper | PCR primer pair | F:5'CGGATGTGGCCCCTGTAGGCTTCTTTCTTGTG
R:5'CACAAGAAAGAAGCCTACAGGGGCCACATCCG |
| Sequence based reagent | APOL1-G0 E150 Conversion to G1 mutagenesis Round 2 (I384M) (Round 1 as template) |
This paper | PCR primer pair | F:5'GGAGCTGGAGGAGAAGCTAAACATGCTCAACAATAATTATAAGA
R:5'TCTTATAATTATTGTTGAGCATGTTTAGCTTCTCCTCCAGCTCC |
| Sequence based reagent | APOL1-G0 E150 Conversion to G12 mutagenesis | This paper | PCR primer pair | F: 5'AGCTAAACATTCTCAACAATAAGATTCTGCAGGCGGAC R: 5'GTCCGCCTGCAGAATCTTATTGTTGAGAATGTTTAGCT |
| Sequence based reagent | Insertion of APOL1 cDNA into pcDNA 5 vector | This paper | PCR primer pair | F: 5'ATGATATCGCCACCATGGAGGGAGCTG R: 5'ATCTCGAGTCATCACAGTTCTTGGTCCGCCTG |
| Sequence based reagent | Insertion of APOL1 cDNA into RUSH vector | This paper | PCR primer pair | F: 5'ATGCCCTGCAGGAGAGGAAGCTGGAGCGAGG R: 5'ATGCTCTAGACTATCACAGTTCTTGGTCCGCC |
| Cell line (Homo sapiens) | HEK293 | ATCC | CRL-1573 | |
| Cell line (Homo sapiens) | FlpIn HEK 293 | Thermo Fisher | Gift from Dr. Christian Brix Folsted Andersen. Converted into FlpIn TREX293 | |
| Cell line (Homo sapiens) | Conditionally Immortalized Human podocytes | Saleem et al., 2002 | Gift from Dr. Moin Saleem and Dr. Jeffrey Kopp | |
| Cell line (Cricetulus griseus) | CHO | ATCC | CCL-61 | |
| Antibody | Mouse anti-APOL1 | Proteintech | 66124–1-Ig | WB 1:2000 IF 1:800 |
| Antibody | Rabbit anti-APOL1 | Proteintech | 11486–2-AP | WB 1:5000 |
| Antibody | Rabbit anti-GAPDH | Proteintech | 10494–1-AP | WB 1:5000 |
| Antibody | Rabbit anti-Calnexin | Stressgen | SPA-860 | IF 1:200 |
| Antibody | Goat anti-mouse 680RD | LICOR | 92568070 | WB 1:10,000 |
| Antibody | Donkey anti-rabbit 800CW | LICOR | 925–32213 | WB 1:10,000 |
| Antibody | anti-rabbit Alexa 488 plus | Thermo Fisher |
A32731 | IF 1:1500 |
| Antibody | anti-mouse Alexa 647 | Thermo Fisher |
A21236 | IF 1:1000 |
| Chemical compound, drug | HCS Nuclear Mask | Thermo Fisher |
H10325 | IF 1:400 |
| Chemical compound, drug | DRAQ7 | Abcam | ab109202 | Live cell microscopy 3 µM |
| Chemical compound, drug | Thapsigargin | Thermo Fisher |
T7458 | |
| Chemical compound, drug | Interferon gamma | R and D Systems | 285IF100 | |
| Chemical compound, drug | Lactate dehydrogenase assay | Promega | G1781 | Cytotox 96 Non-Radioactive Cytotoxicity Assay |
| Commercial assay kit | MultiTox-Fluor Multiplex Cytotoxicity Assay | Promega | G9201 | |
| Commercial assay kit | Quik Change II Mutagenesis Kit | Agilent | 200523 | |
| Software | TrackMate | Tinevez et al., 2017 | ||
| Software | Prism | GraphPad | ||
| Software | R-multicomp package | Hothorn et al., 2008 |