Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jun 1.
Published in final edited form as: Mech Dev. 2020 Mar 23;162:103607. doi: 10.1016/j.mod.2020.103607

Rb family-independent activating E2F increases genome stability, promotes Homologous Recombination, and decreases Non-Homologous End Joining

Xun Pei 1, Elbert Du 2, Zhentao Sheng 1, Wei Du 1,#
PMCID: PMC7295657  NIHMSID: NIHMS1580496  PMID: 32217105

Abstract

The retinoblastoma protein Rb is a prototype tumor suppressor inactivated in a variety of cancers. In addition to deregulated cell proliferation, Rb inactivation also causes genome instability that contributes to tumorigenesis. Although the genome instability effects of Rb inactivation was shown to be mediated mainly by E2F-independent mechanisms, little is known about whether the constitutive free activating E2F proteins released by Rb-inactivation affects genome stability. In this manuscript, we take advantage of the dE2F1su89 mutant, which contains a point mutation in the conserved Rb-binding domain that disrupts its interaction with the Rb family proteins, to characterize the effect of constitutive free activating E2F on genome stability in the presence of WT Rb. We showed that dE2F1su89 promoted genome stability in the mwh genome stability assay. We found that the genome stability effects of dE2F1su89 was sensitive to the levels of activating E2F activity and to the levels of E2F targets involved in DNA replication and repair but not to the level of E2F cell cycle target Cyclin E. Importantly, we showed that dE2F1su89 promoted DNA double-strand break (DSB) repair by homologous recombination and decreased DSB repair by Non-homologous end joining (NHEJ). These results show that the constitutive free activating E2F promotes genome stability, which potentially contributes the observed tumor development in E2F1 knockout mice and the reported NHEJ defects in Rb mutant cells. These results also explain why constitutive free activating E2F alone was not sufficient for tumor development.

Keywords: E2F, genome stability, DSB repair, non-homologous end-joining (NHEJ), Homologous Recombination

1. Introduction

The retinoblastoma protein (Rb) is a prototype tumor suppressor often inactivated in different types of cancers by a variety of mechanisms (Du and Searle, 2009; Knudsen and Wang, 2010; Sherr and McCormick, 2002). Rb and the related family members p107 and p130 function by interacting with large numbers of cellular targets, including the E2F transcription factors (Du and Pogoriler, 2006; Morris and Dyson, 2001). E2F transcriptional factors, which can be subdivided into the activating and the repressive E2F subfamilies, are the key targets of Rb family proteins to regulate the expression of genes involved in cell cycle regulation, DNA replication and repair, cell cycle checkpoint, etc (Dimova and Dyson, 2005). The function and regulation of the Rb and E2F family of proteins are highly conserved in Drosophila. There are two E2F proteins in Drosophila (dE2F1 and dE2F2), which bind to a single DP protein (dDP) and function similarly to the activating and repressive E2F protein families in mammalian systems, respectively (Dynlacht et al., 1994; Frolov et al., 2001). The Rbf protein, which binds to both dE2F1 and dE2F2, functions similarly to the Rb protein (Dimova and Dyson, 2005; Du et al., 1996; Frolov et al., 2001; Gordon and Du, 2011).

While Rb family proteins clearly play important roles regulating cell proliferation and DNA replication, studies from both Drosophila and mammalian systems suggest that the Rb family of proteins also play important roles in maintaining genome stability, which also contributes to its tumor suppressor function (Manning and Dyson, 2012). Loss of the Rb family proteins caused genome instability by increased Mad2 expression (Hernando et al., 2004), altered chromatin condensation (Longworth et al., 2008), centromeric localization of condensin II (Coschi et al., 2014; Manning et al., 2010), H4K20 methylation and centromere cohesion (Manning et al., 2014), and defective DNA double-strand break (DSB) repair by non-homologous end-joining (NHEJ) (Cook et al., 2015). Although the reported genome stability effects of Rb are mostly mediated through E2F-independent mechanisms, inactivation of the Rb family proteins will lead to the release of free activating E2F proteins, which will increase the expression of genes involved in DNA replication and repair and cell cycle checkpoint proteins including Mad2 and potentially affect genome stability. However, there has been no study directly examined how such constitutive free activating E2F affects genome stability. This could possibly be due to the lack of a suitable experimental system that can have constitutive free activating E2F while retaining the intact Rb function.

dE2F1su89 is an L to Q mutation in the conserved Rb binding domain of dE2F1, which disrupts its interaction with Rbf and results in an E2F that can activate E2F target gene expression-independent of Rbf (Weng et al., 2003). The dE2F1su89 mutant provides the perfect system to test the effect of constitutive free activating E2F on genome stability as this mutant retains the WT functional Rbf that will interact with its other targets except dE2F1su89. In this manuscript, we found that dE2F1su89 promoted genome stability, increased DSB repair by homologous recombination (HR) while decreased that by NHEJ.

2. Experimental procedures

2.1. Flies stocks

All the flies were maintained at 25°C except those used in the Rr3 DNA break repair assay, which were grown at 20°C due to the significant level of lethality of the Rr3/+; dE2F1su89 flies at 25°C. The following fly stocks were used in this study: dE2F1su89 and de2f2 mutant flies (Weng et al., 2003), mei-41RT1 (B-4169), mwh1 (B-549), dE2F1729 (Du and Dyson, 1999), dDPa2 (Royzman et al., 1997), rnrL (B-10644), cycEAR95 (Du et al., 1996), Rr3, Rr3EJ1, and UIE-5B flies (Preston et al., 2006).

2.2. In situ hybridization of eye discs

PCNA in situ hybridization were done according to (Du, 2000). Briefly, Eye discs were dissected and fixed in 4% formaldehyde/PBS. Fixed eye discs were washed 3 times with PBST, dehydrated by adding 0.5 ml 300 mM ammonium acetate, and 0.5 ml ethanol, followed by an ethanol wash. The discs were treated with equal volume of xylene/ethanol for 10 minutes and then washed three times in ethanol, once with methanol, and once with equal volumes of methanol/4% formaldehyde. The eye discs were fixed again in 4% formaldehyde for 20 minutes, followed by 5 washes with PBST. These discs were then pre-hybridized and hybridized at 60°C.

2.3. Antibodies and DSB detection in developing oocytes

Newly hatched females were mated and fed with yeast for 2–3 days before egg chamber dissection. Early egg chambers were dissected in PBS, fixed, processed, and stained with antibodies as described (Lake et al., 2013). Antibodies used in this study include: Mouse and guinea pig anti-C(3)G antibody used at 1:500 (Page and Hawley, 2001), mouse and rabbit anti p-H2AV antibody at 1:500 (Lake et al., 2013; Mehrotra and McKim, 2006).

2.4. Rr3 DSB repair assay

The details of the Rr3 repair assay were described in (Preston et al., 2006). For assays described in this manuscript, UIE-5B, the I-SceI inserted on X chromosome, was used as the endonuclease source. In cross 1, individual UIE-5B; SP, Rr3, L/Cyo; dE2F1su89 (or WT on 3rd chromosome) males were crossed with WT virgin females. L and SP progenies that were males (I-SceI−) or females (I-SceI+) were separately scored for the presence of DsRed florescence to determine the rate of SSA or NHEJ repair, respectively (Fig. 4A). In cross 2, UIE-5B; SP, Rr3, L/Rr3EJ1; dE2F1su89 (or WT on 3rd chromosome) males were crossed with WT virgin females. L and SP progenies that were female (I-SceI+) and DsRed negative were repaired by HR or NHEJ and were further characterized by PCR as described (Preston et al., 2006). L and SP progenies that were male (I-SceI−) and DsRed were most likely repaired by SSA but may also include repair by HR (SDSA) that were annealed at the duplicated sequence (Fig. 4C). Standard errors were calculated using information from the single-male replicates as described (Preston et al., 2006). Permutation tests were used to compute P-values as explained in (Preston et al., 2006).

Fig. 4.

Fig. 4.

dE2F1su89 mutation increased the rate of DSB repair by HR and decreased repair by NHEJ. (A). A diagram of the Rr3 repair construct and its repair derivatives from Cross 1, which is used to measure SSA and NHEJ under conditions in which no template for HR is available on the homolog. The Rr3 reporter consists of a DsRed gene with an insertion of the cutting site for the I-SceI endonuclease franked by a 147-bp direct duplication of part of the DsRed sequence. The intact Rr3 element does not express functional DsRed protein. When a DSB is induced at the I-SceI cut site, repair via the SSA pathway results in a functional DsRed gene while repair by NHEJ does not with the I-SceI cut site destroyed. (B) Cross 1 Rr3 repair results from 56 WT single-G0 male replicates or 64 dE2F1su89 mutant single-G0 male replicates at the indicated temperature. Standard errors were calculated using information from the single-male replicates as described (Preston et al., 2006). Permutation tests were used to determine statistical significance of DSB repair rates. P=0.01 for SSA and p=0.04 for NHEJ for comparing between WT and dE2F1su89 mutants. (C) A diagram of the Rr3 repair construct and its repair derivatives from Cross 2, which measures HR in addition to SSA and NHEJ. PCR tests with primer specific for Rr3EJ1 were performed to distinguish between NHEJ and HR in the nonred (endonuclease-bearing) G1 offspring. (D) Cross 2 Rr3 repair results from 46 WT single-G0 male replicates or 44 dE2F1su89 mutant single-G0 male replicates at the indicated temperature. Standard errors and permutation tests were calculated as described (Preston et al., 2006). P=0.01 for NHEJ and p=0.28 for both HR and SSA between WT and dE2F1su89 mutants.

Because significant lethality of the Rr3/+; dE2F1su89 and the Rr3/Rr3EJ1; dE2F1su89 flies at 25°C but appeared to be healthy at 20°C, we carried out the Rr3 assays at 20°C.

2.5. RNA isolation and quantitative real-time PCR

Imaginal disc tissues (including brain) were dissected and total RNA was isolated using TRIzol (Invitrogen) for RT-PCR. Total RNA (2 μg) was reverse-transcribed using Moloney murine leukemia virus reverse transcriptase (Promega) and random primers following the protocol of the manufacturer. PCR was performed in triplicate using SYBR Green Mix (Sigma) and a real-time PCR system (Bio-Rad). The Primer sequences were: tefu(F): GGGATTCGATAAACTGGC; tefu(R): AAAGGCAGCAGGCAGGTC; Rad50(F): CGGAGTTTCGGCACCTATG; Rad50(R): TCTTTCCGCATCCGTTCTC; Rp49(F) ACAGGCCCAAGATCGTGAAGA; and Rp49(R) CGCACTCTGTTGTCGATACCCT.

2.6. mwh genome stability assay

Adult wings were dehydrated in isopropanol and mounted in 1:1 methylsalicilate: Canada balsam (Sigma) as described (Brodsky et al., 2000). Intervein wing hair cells were examined for the mwh phenotype. For γ irradiation-induced mwh LOH assay, 3rd instar larvae were treated with 10 Gy of γ radiation. Adult wings were examined for the mwh phenotype. At least six wings were examined for each genotype or treatment.

3. Results

3.1. dE2F1su89 promoted genome stability in mei-41 background

The effect of Rbf-independent dE2F1su89 on genome stability was determined using a loss-of-heterozygosity (LOH) assay based on the multiple wing hair (mwh) mutant phenotype (Baker and Smith, 1979). mwh is a recessive mutation that exhibited two or more trichomes per cell in the wing (Fig. 1A). While mwh/+ showed no mwh cells, mutation of mei-41, which is the Drosophila ATR ortholog that regulates genome stability, significantly decreased genome stability and increased the number of mwh clones to around 20 per wing (Fig. 1C, E). Interestingly, one copy of the dE2F1su89 mutation significantly reduced the number of mwh clones in mei-41 background to around 11 (p=3.8 × 10−13) and two copies of dE2F1su89 further reduced to around 7 mwh clones (p=3.3 × 10−10 between one and two copies of dE2F1su89). These results suggest dE2F1su89 increased genome stability in mei-41 background.

Fig. 1.

Fig. 1.

dE2F1su89 increased genome stability in mwh LOH assay. (A-D) images of Drosophila adult wing showing mwh phenotypes. The genotypes are: (A) mwh mutant, (B) mwh/+, (C) mei-41; mwh/+, and (D) mei-42; mwh dE2F1su89/+. mwh phenotypes were observed in A and in red circled clones in C and D. (E) a diagram of the number of mwh clones/adult wing observed in different genotype Drosophila wings. Scale bar in (A) is 25 μm. The average and standard deviation from at least 7 wings were shown. Genome stability results of each mutation were compared with mei-41;mwh/+ or mei-41;mwh dE2F1su89/+ using T test and were indicated. *** indicate p≤ 8.6×10−8, * indicate p=0.008, # indicate p=0.51. For each mutant with or without dE2F1su89, p≤ 4.7×10−7.

3.2. Endogenous dE2F1 activity promoted genome stability in mei-41 background

dE2F1su89 is an allele of dE2F1 that disrupts its binging with Rbf and can deregulate E2F target gene expression in the presence of functional Rbf (Weng et al., 2003). For example, in WT eye discs, dE2F1 target gene PCNA was highly expressed in the anterior proliferative region and in the second mitotic wave (SMW) but with low basal levels in the G1 arrested regions in the morphogenetic furrow (MF) and in the posterior (Fig. 2A). Interestingly, dE2F1su89 eye discs showed very high PCNA expression in the MF. In fact PCNA expression in the anterior, MF, and SMW was merged together (Fig. 2C) (Weng et al., 2003). This PCNA expression pattern is consistent with the high dE2F1 levels in MF region of eye disc and the fact that dE2F1su89 can activate E2F target gene independent of Rbf (Brook et al., 1996; Weng et al., 2003). These observations showed that dE2F1su89 exhibited deregulated dE2F1 activity, which could be linked with the effects on genome stability.

Fig. 2.

Fig. 2.

de2f2 mutation decreased PCNA expression in the MF region in dE2F1su89 background, which was reversed by expression of dDP. (A-D) in situ hybridization results of PCNA expression in eye disc of the following genotype: WT (A), de2f2 (B), dE2F1su89 (C), and de2f2; dE2F1su89 (D). (E-H) in situ hybridization results of PCNA expression in eye disc of the following genotypes after 1 hour heat shock: WT (E), Hs-dDP (F), de2f2; dE2F1su89 (G), and Hs-dDP, de2f2; dE2F1su89 (H). Arrows point to MF and arrowheads in A-D points to SMW. Scale bars are 50 μm.

To determine whether the endogenous dE2F1 activity play an important role in genome stability, we tested the effects of reducing the gene dosage of de2f1 or the dE2F1 binding partner dDp. Reducing dE2F1 activity by the loss of function mutations of de2f1729 significantly increased the number of mwh clones in mei-41; dE2F1su89 background (p=5.4 × 10−19). Similarly, reducing dE2F1 activity introducing a copy of the dDP loss of function mutation significantly increased the number of mwh clones in either mei-41 or mei-41; dE2F1su89 background (Fig. 1E, p≤8.6 ×10−8). These results suggest that the effects of dE2F1su89 on genome stability are linked with the overall dE2F1 activity.

3.3. Complete inactivation of dE2F2 reduced dE2F1 activity and decreased genome stability

dE2F2 is known to function by recruiting the Rb family proteins to repress E2F target gene expression and functions antagonistically to dE2F1 (Frolov et al., 2001). Unexpectedly, complete inactivation of dE2F2 by removing both copies of de2f2 gene further increased number of mwh clones in either mei-41 or mei-41; dE2F1su89 background (Fig. 1E, p≤3.4 × 10−18). As inactivation of dE2F2 was shown to significantly reduce the level of dDP (Frolov et al., 2005), It is possible that the reduced level of dDP will limit the activity of dE2F1su89 and thus decrease genome stability. To test this possibility, we examined expression of an E2F target gene PCNA in different genotype eye discs. The de2f2 eye discs showed slightly elevated PCNA expression in the MF and posterior, where PCNA expression was repressed in WT eye discs, although the overall PCNA expression pattern in de2f2 eye discs was similar to that in WT (Fig. 2B). Interestingly, de2f2; dE2F1su89 double mutant eye discs showed lower PCNA expression in the MF region than the dE2F1su89 eye discs (Fig. 2C–D). To further determine whether decreased level of dDP might contribute to the reduced PCNA expression in MF region of the de2f2; dE2F1su89 eye discs, we overexpressed dDP in WT and de2f2; dE2F1su89 eye discs. While overexpression of dDP in WT background did not significantly affect the pattern of PCNA expression in 3rd instar eye disc (Fig. 2E–F), dDP expression significantly elevated PCNA expression in the MF region in de2f2; dE2F1su89 eye discs (Fig. 2G–H). These results showed that dE2F2 can have a positive role for E2F target gene expression through regulating dDP level in addition to the generally accepted repressive function.

3.4. Genome stability of mei-41; dE2F1su89 wing disc cells are sensitive to the levels of replication and repair factors but not to cell cycle regulator Cyclin E

The well-known dE2F1 targets include DNA replication and repair factors such as PCNA, RNR subunits, etc and cell cycle regulators such as Cyclin E. To determine the contributions of these E2F targets on genome stability, we examined the effects of removing a copy of these genes. Removing one copy of either PCNA or RNRL significantly increased the number of mwh clones in both the mei-41 and the mei-41; dE2F1su89/+ backgrounds (Fig. 1E, p≤8.6 × 10−12). These results, in conjunction with the observed deregulated PCNA expression in dE2F1su89 (Fig. 2A and 2C), suggest that the level of these E2F targets that function in DNA replication and repair were limiting in the mei-41 background and that increased expression of these factors by dE2F1su89 contribute to its genome stability effects. In contrast, similar number of mwh clones were observed when one copy of Cyclin E was removed in the mei-41; dE2F1su89/+ background (Fig. 1E, p=0.5), suggesting that Cyclin E is not a limiting factor that mediates the genome stability effects of dE2F1su89

3.5. dE2F1su89 can increase genome stability independent of mei-41 mutation

Since the above genome stability assay were all carried out in the mei-41 mutant background, a possible explanation for the observed genome stability effects of dE2F1su89 is simply due to the induction of certain gene, such as the ATM homology tefu, which can partially compensate the loss of mei-41 function. We directly tested this by qRT-PCR using RNA from larval tissues and found that similar levels of tefu were expressed between WT and dE2F1su89 with or without γ-irradiation to cause DNA damage (Fig. 3 B–C). In contrast, expression of Rad50, which encode a protein involved in DNA double strand break repair, was increased in dE2F1su89 in comparison to the WT control in both the normal and γ-irradiated samples (Fig. 3 B–C).

Fig. 3.

Fig. 3.

dE2F1su89 mutation reduced radiation induced mwh LOH and affected the expression of Rad50 but not ATM homolog tefu. (A) A diagram of the number of mwh clones/adult wing observed in WT and dE2F1su89 background after 10 Gy of gamma radiation. (B-C) qRT-PCR results of tefu and Rad50 expression in WT and dE2F1su89 imaginal discs with or without gamma irradiation. *** indicate p<5×10−6, * indicate p<0.05, # indicate p≥ 0.1.

To further characterize whether dE2F1su89 can promote genome stability independent of mei-41 mutation, we compared the levels of radiation–induced mwh LOH between WT and dE2F1su89 flies. As shown in Fig. 3A, 10 Gy of gamma radiation induced an average of 21.5±5.4 mwh clones/wing in WT background, but the number of mwh clones/wing was reduced to an average of 5.1±2.4 in dE2F1su89 (p=1.9 × 10−6). Therefore, dE2F1su89 decreased radiation-induced LOH in comparison to WT flies. These results showed that the dE2F1su89 can promote genome stability independent of the mei-41 mutation.

3.6. dE2F1su89 decreased NHEJ and increased HR

The observed effects of dE2F1su89 on genome stability raised the possibility that dE2F1su89 may promote high fidelity DNA repair. We used the Repair Reporter 3 (Rr3) assay to measure the relative levels of DSB repair by HR, NHEJ, or single-strand annealing (SSA) in the pre-meiotic germline of individual males (Preston et al., 2006). The Rr3 reporter contains an I-SceI endonuclease site flanked by two partial copies of the dsRed gene with 147 bp direct duplication (Fig. 4A). Expression of I-SceI causes DSB in the Rr3 reporter and repair of DSB in the male germline can be determined in the progenies using Cross 1 or Cross 2, which differs by the absence or presence of the repair template Rr3EJ1 (Fig. 4A, C).

Because Rr3/+; dE2F1su89 flies were not healthy at 25°C, we carried out the Rr3 assay at 20°C. Cross 1 allows the determination of relative repair frequency by NHEJ and SSA (Fig. 4A)(Preston et al., 2006). We found that NHEJ accounted for 18.6% of DSB repair while SSA accounted for 81.5% of DSB repair in WT flies at 20°C (Fig. 4B). The observed SSA repair rate was higher and NHEJ repair rate was lower than those reported previously (Preston et al., 2006). It appears that the difference was largely due to different temperature used for fly growth since the NHEJ and SSA repair rate at 25°C were 30.9% and 72.0% (Fig. 4B), respectively, which were similar to those reported previously (Preston et al., 2006). Interestingly, DSB repair in the dE2F1su89 flies through NHEJ was significantly reduced to 10.6% (Fig. 4B, p=0.04 in comparison to WT NHEJ repair rate) and the repair through SSA was correspondingly increased to 91% (Fig. 4B, p=0.01 in comparison to the WT SSA repair rate).

The presence of repair temperate Rr3EJ1 in Cross 2 allows the determination of DSB repair by HR as well as by SSA and NHEJ as described in Fig. 4C. HR in this DSB repair setting was mostly through synthesis-dependent strand annealing (SDSA) pathway (Preston et al., 2006). Since DSB repair through SDSA can potentially be mediated by annealing of the direct duplicated sequence (McVey et al., 2004), which will generate the intact DsRed gene, the I-SceI− flies that were DsRed could be derived from DSB repair by either SSA or SDSA annealing at the duplicated sequence (Fig. 4C). Therefore, the rate of HR (SDSA) described here (Fig. 4C–D) represented the rate of perfect HR repair and potentially underestimated the overall HR rate since the portion of SDSA repair annealed at the duplicated sequence would be counted together with SSA repair (Fig. 4C). As shown in Fig. 4D, in Cross 2 of WT flies, 9.9% of DSB were repaired by HR and 7.5% by NHEJ. The rate of NHEJ in Cross 2 was significantly lower than that in Cross 1, which is consistent with the idea that different DSB repair pathways compete with each other to repair a given DNA damage (Preston et al., 2006). On the other hand, the observed SSA rate from Cross 2 was actually slightly increased from that in Cross 1 (Fig. 4B, D). A likely explanation is that at the lower temperature (20°C), a significant portion of the SDSA were mediated by annealing at the direct repeat and counted with SSA. Importantly, DSB repair through NHEJ in dE2F1su89 flies was only 2.4%, which was significantly reduced in comparison to that in the WT controls (Fig. 4D, p=0.01). On the other hand, although DSB repair by HR in dE2F1su89 flies was 13.2%, which was higher than the 9.9% observed in WT, the difference did not achieve statistical significance. It is possible that WT HR rate is quite efficient such that it will be difficult to detect further increase in HR repair. In addition, the possibility that a significant portion of SDSA being counted as SSA at this temperature may also reduce the observed difference in DSB repair by HR.

Taken together, these results showed that dE2F1su89 mutation significantly decreased DSB repair by NHEJ, which likely contributed to its role of promoting genome stability. In addition, due to the limitation of the assay system, we could not be sure whether dE2F1su89 increased DSB repair by HR.

3.7. dE2F1su89 promoted repair of the programed meiotic DSB in mei-41 background

To further characterize whether dE2F1su89 affects DSB repair by HR, we decided to characterize DSB repair using the meiotic oocyte model. DSB in Drosophila ovary was shown to be induced and repaired at precise developmental stages during oogenesis (Lake et al., 2013; Mehrotra and McKim, 2006). Using an antibody against phosphorylated fly H2AV (p-H2AV) that recognizes DSB, DSB was found to be induced in early region 2A after the formation of synaptonemal complex (SC), which can be visualized by staining of the SC protein C(3)G (Fig. 5A) (Lake et al., 2013; Mehrotra and McKim, 2006). In WT germarium, programmed meiotic DSBs detected by p-H2AV (red) were observed within the pro-oocytes (marked by SC in green) in region 2A and region 2B. By the time pro-oocytes reached the region 3, p-H2AV signal disappeared, which indicated completion of DSB repair (Fig. 5A) (Lake et al., 2013; Mehrotra and McKim, 2006). As repair of this DSB requires the mei-41 function, DSB was not completely repaired (p-H2AV signal persisted) in pro-oocyte that had reached region 3 in mei-41 mutant germarium (Fig. 5B) (Joyce et al., 2011). Interestingly, p-H2AV signal was not observed in pro-oocyte that had reached region 3 in mei-41; dE2F1su89 germarium (Fig. 5C), suggest that DSB was already repaired by the time these oocyte reached region 3. Similarly, p-H2AV signal was not observed in region 3 pro-oocyte in dE2F1su89 germarium either (Fig. 5D). Taken together, these results support the notion that dE2F1su89 mutation promoted DSB repair by HR in mei-41 background, which likely contributed to the observed effects on genome stability.

Fig. 5.

Fig. 5.

dE2F1su89 mutation promoted DSB repair of the meiotic oocytes in germarium. (A-D) WT (A), mei-41 (B), mei-41; dE2F1su89 (C), and dE2F1su89 (D) germarium were stained with an anti p-H2AV antibody (red) to detect DSB break and an anti C(3)G antibody to detect synaptonemal complex (SC, green). Regions 1, 2A, 2B, and 3 described in (Lake et al., 2013) were indicated. In WT, programmed meiotic DSBs detected by p-H2AV (red) were observed within the pro-oocytes (marked by SC in green) in region 2A and region 2B. By region 3, p-H2AV signal were removed, which indicates completion of DSB repair. P-H2AV signal persisted in pro-oocytes of mei-41 mutants (B) but not the mei-41; dE2F1su89 (C). Yellow arrows point to pro-oocytes in region 2 and white arrows point to pro-oocytes in region 3. Scale bar is 5 μm.

4. Discussion

Although Rb inactivation is quite common in cancers, activating mutations that disrupt the Rb and E2F interaction have not been associated with cancer development. We showed here that the free activating E2F at endogenous level actually promoted genome stability, promoted HR repair and decreased NHEJ repair of DSB. The genome stability effects appears to be linked to the ability of dE2F1 activity to induce factors involved in DNA replication and repair such as PCNA, RNR, and Rad50 proteins but not cell cycle regulators such as Cyclin E. The increased genome stability effects of dE2F1su89 are consistent with the observed large number of E2F target genes function in DNA replication, repair, and DNA damage checkpoints (Dimova et al., 2003; Ren et al., 2002) and with the observations that DNA damage increased cellular E2F1 activity (Lin et al., 2001; Stevens et al., 2003). However, these studies focused on the role of E2F1 on DNA-damaged apoptosis and did not characterize the effects on DNA repair and genome stability.

The increased genome stability effects of free activating E2F1 are in contrast to the genome instability effects of Rb mutants observed in both fly and mammalian systems, which were shown to be mediated by non-E2F targets such as binding to Condensin and NHEJ proteins, and altered chromatin modification (Cook et al., 2015; Coschi et al., 2014; Longworth et al., 2008; Manning and Dyson, 2012; Manning et al., 2010; Manning et al., 2014). As increasing evidence suggest that Rb’s role in maintaining genome stability is critical for tumorigenesis (Coschi et al., 2014; Manning and Dyson, 2012; Manning et al., 2010), It is possible that the observed genome stability role of activating E2F also contributes to E2F1’s tumor suppressor role in addition to the accepted role of E2F1 on apoptosis (Yamasaki et al., 1996). Therefore, the distinct effects of Rb family-independent activating E2F and Rb family inactivation on genome stability may contribute to their different effects on tumorigenesis. Consistent with this, the RbΔG mice, which have an Rb mutation that disrupts the interaction between Rb and E2F proteins, did not show tumor development either (Cecchini et al., 2014). In addition, as the L to Q mutation in dE2F1su89 is in the conserved Rb-binding domain, we mutated the conserved L to Q in the mammalian activating E2F proteins and showed that the resulting E2FLQ mutants are also Rb family-independent (Liao and Du, 2017). Mice derived from such an E2F3LQ mutant showed some lactation defects but did not have obvious tumor development (Liao and Du, 2017; Liao and Du, 2018). Taken together, these observations support the idea that the genome instability effects of Rb-inactivation contribute significantly to cancer development.

In this manuscript, we showed that free activating E2F generated by a mutation that disrupts its interaction with the Rb family proteins promoted genome stability, increased DSB repair by HR, and decreased repair by NHEJ. Interestingly, loss of Rb family functions was found to cause significant reduced level of NHEJ in mammalian cells (Cook et al., 2015). Although the mechanism involved was shown to be mediated by the interaction between Rb and XRCC5 and XRCC6 proteins, it is possible that free activating E2F associated with Rb family loss of function may also contribute to the reduced NHEJ levels. Further studies will be needed to exam this possibility.

Highlights.

  • Rb family-independent activating E2F increases genome stability

  • Rb family-independent activating E2F promotes Homologous Recombination (HR)

  • Rb family-independent activating E2F decreases Non-Homologous End Joining (NHEJ)

  • Constitutive free activating E2F promotes genome stability and increases HR

  • Constitutive free activating E2F decreases NHEJ

Acknowledgement:

We would like to thank Dr. William Engels for providing the fly strains and software for the Rr3 DSB repair assay. We thank Drs. Scott Hawley and Kim McKim for providing antibodies, the Bloomington Stock Center (NIH P40OD018537) for providing fly stocks and the Developmental Studies Hybridoma Bank (DSHB, created by the NICHD of the NIH and maintained at The University of Iowa) for providing antibodies. This work is supported by a grant from National Institute of Health R01 GM120046.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of interests

The authors declare that they have no conflict of interest.

References:

  1. Baker BS and Smith DA (1979) The effects of mutagen-sensitive mutants of Drosophila melanogaster in nonmutagenized cells. Genetics 92, 833–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Brodsky MH, Sekelsky JJ, Tsang G, Hawley RS and Rubin GM (2000) mus304 encodes a novel DNA damage checkpoint protein required during Drosophila development. Genes Dev 14, 666–78. [PMC free article] [PubMed] [Google Scholar]
  3. Brook A, Xie J-E, Du W and Dyson N (1996) Requirements for dE2F function in proliferating cells and in post-mitotic differentiating cells. EMBO J. 15, 3676–3683. [PMC free article] [PubMed] [Google Scholar]
  4. Cecchini MJ, Thwaites MJ, Talluri S, MacDonald JI, Passos DT, Chong JL, Cantalupo P, Stafford PM, Saenz-Robles MT, Francis SM, Pipas JM, Leone G, Welch I and Dick FA (2014) A retinoblastoma allele that is mutated at its common E2F interaction site inhibits cell proliferation in gene-targeted mice. Mol Cell Biol 34, 2029–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Cook R, Zoumpoulidou G, Luczynski MT, Rieger S, Moquet J, Spanswick VJ, Hartley JA, Rothkamm K, Huang PH and Mittnacht S (2015) Direct involvement of retinoblastoma family proteins in DNA repair by non-homologous end-joining. Cell Rep 10, 2006–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Coschi CH, Ishak CA, Gallo D, Marshall A, Talluri S, Wang J, Cecchini MJ, Martens AL, Percy V, Welch I, Boutros PC, Brown GW and Dick FA (2014) Haploinsufficiency of an RB-E2F1-Condensin II complex leads to aberrant replication and aneuploidy. Cancer Discov 4, 840–53. [DOI] [PubMed] [Google Scholar]
  7. Dimova DK and Dyson NJ (2005) The E2F transcriptional network: old acquaintances with new faces. Oncogene 24, 2810–26. [DOI] [PubMed] [Google Scholar]
  8. Dimova DK, Stevaux O, Frolov MV and Dyson NJ (2003) Cell cycle-dependent and cell cycle-independent control of transcription by the Drosophila E2F/RB pathway. Genes Dev 17, 2308–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Du W (2000) Suppression of the rbf null mutants by a de2f1 allele that lacks transactivation domain. Development 127, 367–79. [DOI] [PubMed] [Google Scholar]
  10. Du W and Dyson N (1999) The role of RBF in the introduction of G1 regulation during Drosophila embryogenesis. EMBO J. 18, 916–925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Du W and Pogoriler J (2006) Retinoblastoma family genes. Oncogene 25, 5190–200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Du W and Searle JS (2009) The rb pathway and cancer therapeutics. Curr Drug Targets 10, 581–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Du W, Vidal M, Xie JE and Dyson N (1996) RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev 10, 1206–18. [DOI] [PubMed] [Google Scholar]
  14. Dynlacht BD, Brook A, Dembski M, Yenush L and Dyson N (1994) DNA-binding and trans-activation properties of Drosophila E2F and DP proteins. Proc Natl Acad Sci U S A 91, 6359–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Frolov MV, Huen DS, Stevaux O, Dimova D, Balczarek-Strang K, Elsdon M and Dyson NJ (2001) Functional antagonism between E2F family members. Genes Dev 15, 2146–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Frolov MV, Moon NS and Dyson NJ (2005) dDP is needed for normal cell proliferation. Mol Cell Biol 25, 3027–39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gordon GM and Du W (2011) Conserved RB functions in development and tumor suppression. Protein Cell 2, 864–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hernando E, Nahle Z, Juan G, Diaz-Rodriguez E, Alaminos M, Hemann M, Michel L, Mittal V, Gerald W, Benezra R, Lowe SW and Cordon-Cardo C (2004) Rb inactivation promotes genomic instability by uncoupling cell cycle progression from mitotic control. Nature 430, 797–802. [DOI] [PubMed] [Google Scholar]
  19. Joyce EF, Pedersen M, Tiong S, White-Brown SK, Paul A, Campbell SD and McKim KS (2011) Drosophila ATM and ATR have distinct activities in the regulation of meiotic DNA damage and repair. J Cell Biol 195, 359–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Knudsen ES and Wang JY (2010) Targeting the RB-pathway in cancer therapy. Clin Cancer Res 16, 1094–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lake CM, Holsclaw JK, Bellendir SP, Sekelsky J and Hawley RS (2013) The development of a monoclonal antibody recognizing the Drosophila melanogaster phosphorylated histone H2A variant (gamma-H2AV). G3 (Bethesda) 3, 1539–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Liao Y and Du W (2017) Rb-independent E2F3 promotes cell proliferation and alters expression of genes involved in metabolism and inflammation. FEBS Open Bio 7, 1611–1621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liao Y and Du W (2018) An Rb family-independent E2F3 transcription factor variant impairs STAT5 signaling and mammary gland remodeling during pregnancy in mice. J Biol Chem 293, 3156–3167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lin WC, Lin FT and Nevins JR (2001) Selective induction of E2F1 in response to DNA damage, mediated by ATM- dependent phosphorylation. Genes Dev 15, 1833–44. [PMC free article] [PubMed] [Google Scholar]
  25. Longworth MS, Herr A, Ji JY and Dyson NJ (2008) RBF1 promotes chromatin condensation through a conserved interaction with the Condensin II protein dCAP-D3. Genes Dev 22, 1011–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Manning AL and Dyson NJ (2012) RB: mitotic implications of a tumour suppressor. Nat Rev Cancer 12, 220–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Manning AL, Longworth MS and Dyson NJ (2010) Loss of pRB causes centromere dysfunction and chromosomal instability. Genes Dev 24, 1364–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Manning AL, Yazinski SA, Nicolay B, Bryll A, Zou L and Dyson NJ (2014) Suppression of genome instability in pRB-deficient cells by enhancement of chromosome cohesion. Mol Cell 53, 993–1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. McVey M, Adams M, Staeva-Vieira E and Sekelsky JJ (2004) Evidence for multiple cycles of strand invasion during repair of double-strand gaps in Drosophila. Genetics 167, 699–705. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mehrotra S and McKim KS (2006) Temporal analysis of meiotic DNA double-strand break formation and repair in Drosophila females. PLoS Genet 2, e200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Morris EJ and Dyson NJ (2001) Retinoblastoma protein partners. Adv Cancer Res 82, 1–54. [DOI] [PubMed] [Google Scholar]
  32. Page SL and Hawley RS (2001) c(3)G encodes a Drosophila synaptonemal complex protein. Genes & Development 15, 3130–3143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Preston CR, Flores CC and Engels WR (2006) Differential usage of alternative pathways of double-strand break repair in Drosophila. Genetics 172, 1055–68. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Ren B, Cam H, Takahashi Y, Volkert T, Terragni J, Young RA and Dynlacht BD (2002) E2F integrates cell cycle progression with DNA repair, replication, and G(2)/M checkpoints. Genes Dev 16, 245–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Royzman I, Whittaker AJ and Orr-Weaver TL (1997) Mutations in Drosophila DP and E2F distinguish G1-S progression from an associated transcriptional program. Genes & Dev. 11, 1999–2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sherr CJ and McCormick F (2002) The RB and p53 pathways in cancer. Cancer Cell 2, 103–12. [DOI] [PubMed] [Google Scholar]
  37. Stevens C, Smith L and La Thangue NB (2003) Chk2 activates E2F-1 in response to DNA damage. Nat Cell Biol 5, 401–9. [DOI] [PubMed] [Google Scholar]
  38. Weng L, Zhu C, Xu J and Du W (2003) Critical role of active repression by E2F and Rb proteins in endoreplication during Drosophila development. EMBO J 22, 3865–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yamasaki L, Jacks T, Bronson R, Goillot E, Harlow E and Dyson N (1996) Tumor induction and tissue atrophy in mice lacking E2F-1. Cell 85, 537–548. [DOI] [PubMed] [Google Scholar]

RESOURCES