Abstract
Aim:
To evaluate the association between human leukocyte antigen (HLA) alleles and native Escherichia coli asparaginase hypersensitivity (AH) in children with acute lymphoblastic leukemia (ALL) who received Dana-Farber Cancer Institute treatment protocols.
Patients & methods:
HLA-DQA1, HLA-DRB1 and HLA-DQB1 alleles were retrieved from available whole exome sequencing data of a subset of childhood ALL patients from Quebec ALL cohort and analyzed for an association with AH. PCR assay was developed to analyze associated alleles in the entire discovery and replication cohorts.
Results:
Two alleles in linkage disequilibrium (HLA-DRB1*07:01 and DQA1*02:01) were associated with AH. Additional analyses, performed to distinguish between HLA-DRB1*07:01 haplotypes with and without DQB1*02:02 allele, showed that the association was dependent on the presence of DQB1*02:02.
Conclusion:
This study confirms the implication of HLA-DRB1*07:01, DQA1*02:01 and DQB1*02:02 alleles in developing AH in childhood ALL.
Keywords: : acute lymphoblastic leukemia, asparaginase, asparaginase hypersensitivity, human leukocyte antigen, pharmacogenetics, SNP
Over the past 50 years, ASNase has become a key component in the treatment of childhood acute lymphoblastic leukemia (ALL). With its addition to existing chemotherapeutic regimens, long-term survival rates in children with ALL have improved; however, the use of ASNase has been also associated with morbidities including hypersensitivity reactions [1–4]. Upfront identification of susceptible patients can further improve and complement ASNase monitoring [5], contributing to a more efficient decision-making process when choosing the appropriate formulation or dosage of ASNase. Several studies linked asparaginase hypersensitivity (AH) in childhood ALL patients to human leukocyte antigen (HLA) alleles. Association of DRB1*07:01 allele with an increased risk of Escherichia coli AH was first reported in a candidate gene study in childhood ALL patients of European ancestry, in which HLA imputation was performed from SNP data [6]. In the subsequent genome-wide association study (GWAS), an SNP linked to HLA-DRB1*07:01 was associated with AH in patients of diverse population background [7]. Soon after these initial observations, a study reported the analysis of 54 HLA-DRB1 and HLA-DQB1 alleles derived from sequencing data of ALL patients treated with Berlin–Frankfurt–Münster protocols. The association of E. coli AH not only with the HLA-DRB1*07:01 but also with two additional alleles, HLA-DQA1*02:01 and HLA-DQB1*02:02, was found. The highest risk was seen for the carriers of haplotype harboring all three alleles. Given that DQA1*02:01 and DRB1*07:01 alleles are in complete linkage disequilibrium (LD), the association seems to be dependent on HLA-DQB1*02:02 [8], at least in this population. Finally, in a recent GWAS conducted in childhood ALL patients treated with Nordic Society of Paediatric Haematology and Oncology ALL 2008 protocol, in which cases were defined by clinical hypersensitivity to polyethylene glycol (PEG) ASNase and no enzyme activity, SNP (rs9272131) in close proximity to the HLA-DQA1 gene was identified [9]. Here, we evaluated whether AH in childhood ALL patients treated with Dana Farber Cancer Institute (DFCI) protocols is similarly associated with the HLA locus, and whether the same or additional alleles encoding HLA class II (HLA-DQA1, HLA-DRB1 and HLA-DQB1) are responsible for the observed AH susceptibility in these patients.
Methods & study populations
Patients
The discovery of Quebec childhood ALL (QcALL) cohort consisted of 284 Caucasian children (mostly of French–Canadian origin) diagnosed with ALL between January 1989 and July 2005 who received E. coli ASNase as part of the DFCI ALL Consortium protocols 87-01, 91-01, 95-01 or 00-01 [3,15,16]. Details of ASNase administration across these treatment protocols were described elsewhere [3,15,16]. A validation set of Caucasian patients called the DFCI group was composed of 243 patients who received E. coli ASNase within the DFCI 95-01 and 00-01 ALL treatment protocols in remaining (without Sainte Justine University Health Center [SJUHC], Quebec, Canada) consortium institutions [15,17]. Hypersensitivity reactions to ASNase were characterized by local manifestations at the injection site as well as systemic manifestations (erythema, swelling, urticaria, rash, pruritus, tachypnea and wheezing) [17]. Both cohorts were described in previous reports [15,17,18]; patients’ characteristics are also provided in Supplementary Table 1.
Analyses of HLA alleles by sequencing & allele-specific PCR
Four-digit HLA alleles (DQA1, DRB1 and DQB1) were pooled from the whole exome sequencing (WES) data available from the discovery cohort (QcALL cohort composed of ALL patients diagnosed at SJUHC) [10,11]. HLA allele imputation was performed in a subset of patients (n = 71) who had their DNA sequenced on the Illumina HiSeq2500 platform (Integrated Clinical Genomic Centre in Pediatrics, SJUHC) and for whom clinical data on AH hypersensitivity were available. Reads were aligned to the hg19 reference genome using BWA-MEM [12]; PICARD [13] was used to mark PCR duplicates and collect sequencing quality control metrics; Bwakit implemented in BWA-MEM [14] was used to infer HLA alleles. Sixty-four HLA alleles were recovered from WES data (listed in Supplementary Table 2). Only alleles with at least 5% frequency were further analyzed (n = 33) for an association with AH using the Fisher exact test. The analyses for associated HLA allele (HLA-DRB1*07:01 and DQA1*02:01 in complete LD) were then extended to the entire discovery cohort as well as to the replication group.
PCR assay for identification of HLA DRB1*07:01 was based on the analysis of SNP rs28724121, which is uniquely tagging this HLA allele (Supplementary Figure 1). The analyses were performed by allele-specific PCR, using the following forward GTCCCCCAGACCCCCGTCCGCT and reverse GGTCTCCGGGAAAAACACTG primers (Supplementary Figure 2). Additional two-step PCR was designed exploiting rs281863414 and sequence-specific primers to distinguish between HLA-DRB1*07:01 haplotypes with or without HLA-DQB1*02:02 alleles and was based on forward sequence-specific primers and reverse primer amplifying major and minor rs281863414 alleles. Details of the assay design are depicted in Supplementary Figure 3 & 4. The concordance in HLA allele calling, as obtained by PCR analysis and alleles imputation from WES data in 71 patients was 100%.
Statistical analysis
Allele/haplotype association with AH, in the discovery and replication cohorts or combined cohort, was analyzed by the Fisher exact test or Chi-square, as applicable (univariate analyses). Multivariable logistic regression was performed in the combined discovery and replication cohorts to estimate the impact of HLA-DRB1*07:01-DQB1*02:02 haplotype in the presence of nongenetic covariates, which included sex, ALL immunophenotype (B- or T-ALL), age at diagnosis (≤10 or >10 years), National Cancer Institute risk group (standard or high risk), ASNase dose (fixed or individualized, according to ASNase activity, the latter available for the subset of patients treated on the 00-01 protocol) [16] and treatment protocol, as categorical covariates.
Results
Analyses of HLA alleles from WES data revealed the association of two alleles, HLA-DRB1*07:01 and HLA-DQA1*02:01 that reside on the same haplotype (odds ratio [OR]: 4.9; 95% CI: 1.1–22.8; p = 0.04; Table 1). Given that these two alleles are in complete LD, we further analyzed HLA-DRB1*07:01 only, which was performed in all patients of discovery cohort by rs28724121 genotyping. The association remained significant with OR of 2.2 (95% CI: 1.2–4.3; p = 0.01; Table 2). It was mostly applicable to AH cases with systemic allergy given that only a few cases with local allergies were seen in the discovery group (Supplementary Table 1). To further understand its relationship with AH in patients treated with DFCI protocols, we also analyzed HLA-DQB1*02:02 allele that can be present or not in HLA-DRB1*07:01 carriers (Supplementary Figure 3 & 4). Increased risk of AH was noted only in patients with DRB1*07:01 and DQB1*02:02 allele combination (OR: 2.6; 95% CI: 1.3–5.2; p = 0.006; Table 2). The analyses of both alleles were then performed in the replication cohort and the same association, dependent on allele combination was seen for systemic allergies (OR: 2.3; 95% CI: 1.1–5.2; p = 0.03; Table 3).
Table 1. . Association analyses of human leukocyte antigen alleles derived from whole exome sequencing data.
| Allele | Frequency | p-value | Allele | Frequency | p-value |
|---|---|---|---|---|---|
| HLA_DQA1*01:01 | 18.3 | 1 | HLA_DRB1*03:01 | 15.5 | 0.3 |
| HLA_DQA1*01:02 | 32.4 | 0.7 | HLA_DRB1*04:01 | 8.5 | 0.1 |
| HLA_DQA1*01:03 | 15.5 | 0.3 | HLA_DRB1*04:04 | 7 | 0.5 |
| HLA_DQA1*01:04 | 7 | 1 | HLA_DRB1*04:07 | 7 | 0.5 |
| HLA_DQA1*02:01† | 29.6† | 0.04† | HLA_DRB1*07:01† | 29.6† | 0.04† |
| HLA_DQA1*03:01 | 11.3 | 1 | HLA_DRB1*11:01 | 12.7 | 1 |
| HLA_DQA1*03:03 | 9.9 | 0.2 | HLA_DRB1*11:04 | 12.7 | 1 |
| HLA_DQA1*04:01 | 5.6 | 1 | HLA_DRB1*13:01 | 12.7 | 0.6 |
| HLA_DQA1*05:01 | 16.9 | 0.3 | HLA_DRB1*13:02 | 11.3 | 1 |
| HLA_DQA1*05:05 | 29.6 | 0.7 | HLA_DRB1*14:54 | 5.6 | 1 |
| HLA_DQB1*02:01 | 18.3 | 1 | HLA_DRB1*15:01 | 12.7 | 1 |
| HLA_DQB1*02:02 | 23.9 | 0.4 | |||
| HLA_DQB1*03:01 | 43.7 | 0.3 | |||
| HLA_DQB1*03:02 | 11.3 | 1 | |||
| HLA_DQB1*04:02 | 5.6 | 1 | |||
| HLA_DQB1*05:01 | 22.5 | 0.7 | |||
| HLA_DQB1*05:03 | 8.5 | 1 | |||
| HLA_DQB1*06:02 | 11.3 | 1 | |||
| HLA_DQB1*06:03 | 15.5 | 0.3 | |||
| HLA_DQB1*06:04 | 5.6 | 0.4 | |||
| HLA_DQB1*06:09 | 5.6 | 1 | |||
| HLA_DRB1*01:01 | 12.7 | 1 |
values indicate HLA allele p-value below 5%.
Alleles with ≥5% frequency were analyzed for an association with allergies in Quebec childhood ALL patients who received Escherichia coli asparaginase. Allele frequency, as obtained from analyzed cohort, is indicated. The p-value is obtained by the Fisher exact test.
ALL: Acute lymphoblastic leukemia; HLA: Human leukocyte antigen.
Table 2. . Distribution of HLA-DRB1*0701 and HLA-DRB1*0701-DQB1*02:02 combinations in childhood acute lymphoblastic leukemia patients in the discovery cohort with and without allergies.
| HLA allele | Genotype | Allergies | OR (95% CI) | p-value | |
|---|---|---|---|---|---|
| Presence N (%)† | Absence N (%)† | ||||
| DRB1*07:01 | 0 | 28 (58.3) | 179 (75.8) | 1 | |
| 1 | 20 (41.7) | 57 (24.2) | 2.2 (1.2–4.3) | 0.01 | |
| DRB1*07:01- (DQB1*02:02)+ | 1 | 17 (35.4) | 42 (17.8) | 2.6 (1.3–5.2) | 0.006 |
| DRB1*07:01- (DQB1*02:02)- | 1 | 3 (6.3) | 15 (6.4) | 1.3 (0.3–4.7) | 0.7 |
%: Frequency.
The association analysis in all patients treated with Escherichia coli ASNase for DRB1*07:01 allele and DRB1*07:01 accompanied (+) or not (-) with DQB1*02:02. Presence of indicated HLA allele or haplotype is 1, and absence is 0. OR with 95% CI are presented along with p-values.
HLA: Human leukocyte antigen; N: Number; OR: Odds ratio.
Table 3. . Distribution of HLA-DRB1*07:01 and DQB1*02:02 alleles in childhood acute lymphoblastic leukemia patients in the replication cohort with and without systemic allergies.
| HLA allele | Genotype | Allergies | OR (95% CI) | p-value | |
|---|---|---|---|---|---|
| Presence N (%)† | Absence N (%)† | ||||
| DRB1*07:01 | 0 | 21 (60.0) | 155 (74.5) | 1 | |
| DRB1*07:01- (DQB1*02:02)+ | 1 | 12 (34.3) | 38 (18.3) | 2.3 (1.1–5.2) | 0.003 |
| DRB1*07:01- (DQB1*02:02)- | 1 | 2 (5.7) | 15 (7.2) | 1.0 (0.2–4.6) | 1.0 |
%: Frequency.
The association analysis in patients treated with Escherichia coli ASNase for DRB1*07:01 allele accompanied (+) or not (-) with DQB1*02:02. Presence of indicated HLA allele or haplotype is 1, and absence of DRB1*07:01 is 0. OR with 95% CI are presented along with p-values.
HLA: Human leukocyte antigen; N: Number; OR: Odds ratio.
Similar univariate OR for DRB1*07:01-DQB1*02:02 was noted in combined discovery and replication cohort (Table 4) and remained significant in multivariable analyses when controlling for other nongenetic covariates (OR: 2.6; 95% CI: 1.5–4.5; p = 0.001; Table 4).
Table 4. . Logistic regression model assessing the relationship between HLA-DRB1*07:01–DQB1*02:02 and the development of systemic allergies in the combined discovery and replication cohorts in the presence of nongenetic covariates.
| p-value | OR (95% CI) | |
|---|---|---|
| HLA-DRB1*07:01–DQB1*02:02u | 0.001 | 2.4 (1.4–4.2) |
| HLA-DRB1*07:01–DQB1*02:02m | 0.001 | 2.6 (1.5–4.5) |
| NCI-risk groups | 0.07 | 0.5 (0.3–1.1) |
| ALL phenotype | 0.8 | 1.1 (0.4–3.3) |
| Protocols | 0.2 | 0.8 (0.5–1.1) |
| Age | 0.5 | 1.3 (0.6–3.2) |
| Sex | 0.1 | 1.5 (0.9–2.5) |
| ASNase dose | 0.7 | 1.1 (0.6–2.1) |
HLA-DRB1*0701–DQB1*0202, presence (1) or absence (0) of both alleles; NCI-risk groups are standard (0) or high (1); ALL phenotype is B- (0) or T-cell leukemia (1); Age is ≥10 (1) or >10 years (0) and for sex, boys are 1 and girls 0. ASNase dose, fixed (0) or individualized (1) according to ASNase activity. Protocols include all four DFCI protocols (87-01, 91-01, 95-01 and 00-01), recoded from 1 to 4 starting from the most recent protocol.
ALL: Acute lymphoblastic leukemia; DFCI: Dana Farber Cancer Institute; HLA: Human leukocyte antigen; m: Multivariate analysis; NCI: National Cancer Institute; OR: Odds ratio; u: Univariate analyses.
Discussion
Patients with childhood ALL treated with ASNase can develop hypersensitivity reactions; anti-ASNase antibodies inactivating ASNase activity could also increase the risk of leukemia relapse [2,3]. Understanding the mechanism leading to AH and identifying biomarkers that can upfront identify patients at higher risk of this complication can be helpful in the clinical management thereby reducing the incidence of this complication and improving treatment outcomes. It has been suggested that both classical and alternative pathways play a role in mediating ASNase allergies [6,19]. Indeed, in a mice model immunized with ASNase, AH was mediated by antigen-specific IgG and/or IgE antibodies through the immunoglobulin receptors Fc RIII and Fc RI, respectively [20]. Both pathways involve antigen-presenting cells expressing the HLA class II complex that will engage CD4+ helper T cells leading to cytokine secretion and antibody production. In agreement with these observations, pharmacogenetic studies [6–8] demonstrated the involvement of HLA II class alleles, notably, HLA-DRB1*07:01. Kutszegi et al. recently reported that the HLA-DRB1*07:01 occurs on the background of two haplotypes, one accompanied by HLA-DQB1*02:02 and the other by HLA-DQB1*03:03 [8]. Only the haplotype accompanied by HLA-DQB1*02:02 was reported to be associated with AH in that study. The same study [8] identified also the contributing role of DQA1*02:01. Our results showed an association of AH with all three alleles in Caucasian patients treated with DFCI protocols and further support their involvement in AH. DQA1*02:01 is in complete LD with DRB1*07:01 and the association is thus driven by DQB1*02:02 on the background of DRB1*07:01. It is interesting to note that HLA-DRB1*07:01 (and HLA-DQA1*02:01 in LD) has been linked to other toxicities such as lapatinib-induced hepatotoxicity [21] and susceptibility to pancreatitis induced by thiopurine in patients with inflammatory bowel disease [22]. Likewise, GWAS and meta-analyses on allergy, atopy and asthma have described SNPs in HLA-DR/DQ regions indicating their importance in mediating allergic reactions [23–25]. Fernandez et al. [6] predicted that the HLA-DRB1*07:01 was a high epitope-binding allele, which could explain its association with AH. Kutszegi et al. [8] showed that several amino acids within the HLA-DQB1 protein were associated with increased AH. However, these amino acids were not specific for HLA-DQB1*02:02, raising the possibility that the extended haplotype (together with HLA-DRB1*07:01 and HLA-DQA1*02:01) rather than the individual alleles could be more important to explain the observed association. The fact that not all previous studies discovered the role of DQB1*02:02 may be related to the differences in the study population, disease and treatment features and the fact that SNP arrays or single HLA allele analyses were performed.
Identifying desensitization therapeutics that can mitigate the severity of AH can be particularly useful for the patients who are predisposed to this complication. Several pretreatment strategies (antihistamine and dexamethasone) were reported to diminish the reaction severity in a murine model of clinical hypersensitivity to E. coli ASNase [26]. Administration of a desensitization protocol that contained dexamethasone was also reported to diminish recurrence of hypersensitivity reactions in patients during the subsequent doses of native E. coli ASNase [27].
We acknowledge that our study has drawbacks such as low number of patients for whom imputation of HLA alleles from sequencing data was possible, precluding the detection of alleles with lower effect sizes. The clinical data were collected retrospectively, which might have led to misclassification of cases with AH; furthermore, we did not include patients with silent inactivation or distinguish between hypersensitivity and allergy-like reactions with no reduction in ASNase activity. The study included patients treated with native E. coli ASNase only, and is not yet clear whether the same association is applicable to other ASNase formulation. Our study has nevertheless several strengths; it was conducted in a homogenous population of European descent, the effect of HLA DRB1*07:01 was captured even in the subset of patients with available WES data, the analyses were subsequently extended to the entire discovery and replication cohorts, which allowed identifying the effect of DQB1*02:02. Additionally, PCR-based assay for the detection of HLA DRB1*07:01 and DQB1*02:02 alleles was developed, which might be suitable for real-time testing in a clinical setting. It is worth nevertheless noting that other modulating effects of disease and exposure (disease subtypes, type and dose of ASNase, ASNAse levels, concomitant medication) [8,28,29], as well as other genetic factors [7,9,17,30] can contribute to ASNase-induced allergies in childhood ALL.
Conclusion
In conclusion, several independent studies conducted in patients treated with different protocols support now the association of ASNase AH with DRB1*07:01, which is further refined by DQB1*02:02. These alleles play a role in AH development and might be soon considered as important pharmacogenes whose prior genotyping may reduce the risk of this complication through personalized treatment modification, prophylaxis or closer patient monitoring.
Summary points.
ASNase is an essential component of acute lymphoblastic leukemia (ALL) treatment.
Subset of patients can develop ASNase-related hypersensitivity (AH) reactions.
Several studies suggested the involvement of human leukocyte antigen (HLA) alleles.
Alleles-encoding HLA class II (HLA-DQA1, HLA-DRB1 and HLA-DQB1) were pooled from whole exome sequencing data and analyzed for an association with AH in children with ALL treated with Dana Farber Cancer Institute protocols. Analyses were further refined by PCR-based assay.
Combination of HLA alleles, DRB1*07:01, DQA1*02:01 and DQB1*02:02 was associated with a higher risk of AH (odds ratio: 2.6; 95% CI: 1.3–5.2; p = 0.006) in the discovery and replication cohort and in multivariable model when controlling for other nongenetic variates (odds ratio: 2.6; 95% CI: 1.5–4.5; p = 0.001).
Identified HLA alleles are potential markers for ASNase-related hypersensitivity in childhood ALL.
Supplementary Material
Acknowledgments
The authors thank all patients and their parents who consented to participate in genetics studies related to leukemia.
Footnotes
Supplementary data
To view the supplementary data that accompany this paper please visit the journal website at: www.futuremedicine.com/doi/suppl/10.2217/pgs-2019-0195
Author contributions
M Krajinovic designed the study; V Gagné performed experiments; C Laverdière, J-M Leclerc, TH Tran, SE Sallan, D Neuberg, LB Silverman and D Sinnett contributed to sample, sequencing and clinical data collection and interpretation; P Beaulieu and P St-Onge performed bioinformatics analyses. V Gagné and M Krajinovic performed data analysis; M Krajinovic drafted the article; All the authors contributed to the interpretation of data and revised the manuscript.
Financial & competing interests disclosure
This study was supported by the Canadian Institute for Cancer Research, Leukemia Lymphoma Society of Canada, Cancer Research Society and Charles Bruneau Foundation. Dana-Farber Cancer Institute ALL treatment protocols are supported by the National Cancer Institute/NIH grant 5 P01CA06848. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of this manuscript.
References
- 1.Abaji R, Krajinovic M. Current perspective on pediatric pharmacogenomics. Expert Opin. Drug Metab. Toxicol. 12(4), 363–365 (2016). [DOI] [PubMed] [Google Scholar]
- 2.Egler RA, Ahuja SP, Matloub Y. L-asparaginase in the treatment of patients with acute lymphoblastic leukemia. J. Pharmacol. Pharmacother. 7(2), 62–71 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Silverman LB, Stevenson KE, O'Brien JE. et al. Long-term results of Dana-Farber Cancer Institute ALL Consortium protocols for children with newly diagnosed acute lymphoblastic leukemia (1985–2000). Leukemia 24(2), 320–334 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Asselin B, Rizzari C. Asparaginase pharmacokinetics and implications of therapeutic drug monitoring. Leuk. Lymphoma 56(8), 2273–2280 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.van der Sluis IM, Vrooman LM, Pieters R. et al. Consensus expert recommendations for identification and management of asparaginase hypersensitivity and silent inactivation. Haematologica 101(3), 279–285 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fernandez CA, Smith C, Yang W. et al. HLA-DRB1*07:01 is associated with a higher risk of asparaginase allergies. Blood 124(8), 1266–1276 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Fernandez CA, Smith C, Yang W. et al. Genome-wide analysis links NFATC2 with asparaginase hypersensitivity. Blood 126(1), 69–75 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kutszegi N, Yang X, Gezsi A. et al. HLA-DRB1*07:01-HLA-DQA1*02:01-HLA-DQB1*02:02 haplotype is associated with a high risk of asparaginase hypersensitivity in acute lymphoblastic leukemia. Haematologica 102(9), 1578–1586 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Hojfeldt SG, Wolthers BO, Tulstrup M. et al. Genetic predisposition to PEG-asparaginase hypersensitivity in children treated according to NOPHO ALL2008. Br. J. Haematol. 184(3), 405–417 (2019). [DOI] [PubMed] [Google Scholar]
- 10.Petrykey K, Lippe S, Robaey P. et al. Influence of genetic factors on long-term treatment related neurocognitive complications, and on anxiety and depression in survivors of childhood acute lymphoblastic leukemia: the Petale study. PLoS ONE 14(6), e0217314 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Spinella JF, Healy J, Saillour V. et al. Whole-exome sequencing of a rare case of familial childhood acute lymphoblastic leukemia reveals putative predisposing mutations in Fanconi anemia genes. BMC Cancer 15, 539 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Li H, Durbin R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25(14), 1754–1760 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Broad Institute. Picard tools. (2018). https://broadinstitute.github.io/picard/
- 14.Li H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 1303.3997v2, 1–3 (2013). [Google Scholar]
- 15.Rousseau J, Gagne V, Labuda M. et al. ATF5 polymorphisms influence ATF function and response to treatment in children with childhood acute lymphoblastic leukemia. Blood 118(22), 5883–5890 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Vrooman LM, Stevenson KE, Supko JG. et al. Postinduction dexamethasone and individualized dosing of Escherichia coli L-asparaginase each improve outcome of children and adolescents with newly diagnosed acute lymphoblastic leukemia: results from a randomized study – Dana-Farber Cancer Institute ALL Consortium protocol 00-01. J. Clin. Oncol. 31(9), 1202–1210 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Ben Tanfous M, Sharif-Askari B, Ceppi F. et al. Polymorphisms of asparaginase pathway and asparaginase-related complications in children with acute lymphoblastic leukemia. Clin. Cancer Res. 21(2), 329–334 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Abaji R, Gagne V, Xu CJ. et al. Whole-exome sequencing identified genetic risk factors for asparaginase-related complications in childhood ALL patients. Oncotarget 8(27), 43752–43767 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Finkelman FD. Anaphylaxis: lessons from mouse models. J. Allergy Clin. Immunol. 120(3), 506–515 (2007). [DOI] [PubMed] [Google Scholar]
- 20.Rathod S, Ramsey M, Relling MV, Finkelman FD, Fernandez CA. Hypersensitivity reactions to asparaginase in mice are mediated by anti-asparaginase IgE and IgG and the immunoglobulin receptors FcepsilonRI and FcgammaRIII. Haematologica 104(2), 319–329 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Spraggs CF, Budde LR, Briley LP. et al. HLA-DQA1*02:01 is a major risk factor for lapatinib-induced hepatotoxicity in women with advanced breast cancer. J. Clin. Oncol. 29(6), 667–673 (2011). [DOI] [PubMed] [Google Scholar]
- 22.Heap GA, Weedon MN, Bewshea CM. et al. HLA-DQA1-HLA-DRB1 variants confer susceptibility to pancreatitis induced by thiopurine immunosuppressants. Nat. Genet. 46(10), 1131–1134 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Bonnelykke K, Matheson MC, Pers TH. et al. Meta-analysis of genome-wide association studies identifies ten loci influencing allergic sensitization. Nat. Genet. 45(8), 902–906 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li X, Howard TD, Zheng SL. et al. Genome-wide association study of asthma identifies RAD50-IL13 and HLA-DR/DQ regions. J. Allergy Clin. Immunol. 125(2), 328–335; e311 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hinds DA, Mcmahon G, Kiefer AK. et al. A genome-wide association meta-analysis of self-reported allergy identifies shared and allergy-specific susceptibility loci. Nat. Genet. 45(8), 907–911 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Fernandez CA, Smith C, Karol SE. et al. Effect of premedications in a murine model of asparaginase hypersensitivity. J. Pharmacol. Exp. Ther. 352(3), 541–551 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Akbayram S, Dogan M, Akgun C, Caksen H, Oner AF. A desensitization protocol in children with L-asparaginase hypersensitivity. J. Pediatr. Hematol. Oncol. 32(5), e187–e191 (2010). [DOI] [PubMed] [Google Scholar]
- 28.Kutszegi N, Semsei AF, Gezsi A. et al. Subgroups of paediatric acute lymphoblastic leukaemia might differ significantly in genetic predisposition to asparaginase hypersensitivity. PLoS ONE 10(10), e0140136 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Yang L, Panetta JC, Cai X. et al. Asparaginase may influence dexamethasone pharmacokinetics in acute lymphoblastic leukemia. J. Clin. Oncol. 26(12), 1932–1939 (2008). [DOI] [PubMed] [Google Scholar]
- 30.Chen SH, Pei D, Yang W. et al. Genetic variations in GRIA1 on chromosome 5q33 related to asparaginase hypersensitivity. Clin. Pharmacol. Ther. 88(2), 191–196 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.