Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jun 1.
Published in final edited form as: J Pediatr Surg. 2020 Feb 28;55(6):1099–1106. doi: 10.1016/j.jpedsurg.2020.02.037

Effects of High Fat Diet on Liver Injury After Small Bowel Resection

Emily J Onufer 1, Yong-Hyun Han 2, Rafael S Czepielewski 2, Cathleen M Courtney 1, Stephanie Sutton 1, Gwendalyn J Randolph 2,*, Brad W Warner 1,*
PMCID: PMC7299751  NIHMSID: NIHMS1574748  PMID: 32164985

Abstract

Background:

The optimal regimen for enteral nutritional support in the management of children with short bowel syndrome (SBS) is not well characterized. A high fat, enteral diet is theoretically beneficial due to increased caloric density and enhanced structural adaptation. We therefore sought to determine the long-term effects of a high fat diet (HFD) on liver injury, a common complication of SBS, compared to a standard chow (SC) diet.

Methods:

Using a parenteral nutrition-independent model of resection-associated liver injury, C57BL/6 mice underwent a sham operation or a 50% or 75% proximal small bowel resection (SBR). Mice in each group were then fed either a HFD (35% kcal fat) or SC (13% kcal fat). At post-operative week 15, markers of liver injury were quantified.

Results:

Liver triglyceride levels were increased from 7- to 19-fold in mice on the HFD compared to mice fed SC in the sham, 50%, and 75% resection groups. Serum ALT (2.2-fold increase in 75% resected mice compared to sham controls) and AST (2.0- and 2.7-fold increases in 50% and 75% resected mice, respectively) levels as well as fibrotic liver staining were elevated only in resected mice fed a HFD.

Conclusion:

Long-term enteral feeding of HFD in our murine SBS model is associated with hepatic steatosis and liver injury. Our observation that liver steatosis and injury occur independent of parenteral nutrition suggests that enteral feeding composition and magnitude of intestinal loss may make a significant contribution to intestinal failure-associated liver disease.

Keywords: Short bowel syndrome, Intestinal failure-associated liver disease, Small bowel resection, Adaptation, Enteral feeding

1. Introduction

Short bowel syndrome (SBS) is a malabsorptive state resulting from massive loss of intestine due to congenital diseases, such as gastroschisis, intestinal atresia, and midgut volvulus, or acquired etiologies, such as necrotizing enterocolitis or dysmotility, that necessitate surgical resection[1, 2]. The remaining bowel length dictates the subsequent degree of protein and caloric malabsorption[3, 4]. The overall incidence of neonatal SBS is estimated to be 24.5 per 100,000 live births, with an associated mortality ranging from of 20–40%[5–8]. In patients who are unable to sustain complete nutrient absorption, supplementation with intravenous alimentation is required. This is associated with its own morbidities, including central line complications, sepsis, cholestasis, and liver failure[9–12].

Intestinal failure-associated liver disease (IFALD) is one of the most consistent negative prognostic survival indicators in children with SBS[13–15]. The development of IFALD begins with steatohepatitis, leading to fibrosis and ultimately cirrhosis[16]. The pathogenesis of IFALD, although originally suspected to be driven by prolonged parenteral nutrition (PN), has now been shown to be multifactorial, including alterations in gut microbiome, sepsis, lack of enteral feeding, and supplementation with intravenous lipids[16, 17]. Diminished enteral feeding has been shown to contribute to IFALD by promoting intestinal stasis leading to bacterial overgrowth, disruption of enterally-stimulated hormones, biliary stasis, and reduced enteral-derived portal nutrient absorption[18–22].

Despite the importance of enteral feeding in SBS, the optimal regimen for nutritional support is not well characterized. Amino acid-based formulas are thought to improve outcomes by decreasing gastrointestinal allergies and lowering requirements for intestinal digestive and absorptive capacity[23, 24]. However, enteral feeding with a diet high in fat is theoretically beneficial due to greater caloric density. Animal models have shown that fatty acids enhance mucosal adaptation as well as osmotically prevent excessive fecal fluid loss[25, 26]. On the other hand, enteral lipids are packaged into chylomicrons; chylomicron remnants are ultimately delivered to the liver, with overfeeding leading to steatohepatitis[27]. However, considering that chylomicrons are transported from the intestine through lymphatic vessels and that intestinal resection greatly remodels intestinal lymphatics, it is unclear if chylomicron uptake after resection is normal[28, 29].

Given that enteral feeding helps to prevent IFALD in SBS, but also that a high fat diet in intact gut leads to steatohepatitis, we hypothesized that enteral lipid composition could impact lipid liver accumulation in SBS. We therefore sought to determine the long-term effects of a high fat diet (HFD) on liver steatosis and injury compared with a standard chow (SC) diet.

2. Methods

2.1. Animals and diet

C57BL/6J 11–12-week-old male mice from Jackson laboratories (Bar Harbor, ME) were housed in a temperature controlled, pathogen-free animal holding area on a 12-hour light-dark cycle. Mice were provided with water and either SC (13% kcal fat; PicoLab Rodent Diet 20, 53WU; LabDiet, St. Louis, MO) or liquid HFD (35% kcal fat; PMI Micro-Stabilized Rodent Liquid Diet LD 101; TestDiet,St. Louis, MO) ad libitum. In the HFD, the fat content is derived mainly from olive oil, corn oil, and safflower oil, which are highest in oleic acid, a monosaturated omega-9 long-chain fatty acid. In the SC diet, fat content is derived from soybean oil (composed mostly of polyunsaturated omega-6 linoleic acid) and, to a lesser extent, fish oil. Protocols and experiments were approved by the Washington University in St. Louis Animal Studies Committee (Protocol 20170252) in accordance with the National Institute of Health laboratory animal care and use guidelines.

2.2. Operations and harvest

Mice underwent either a sham control operation, 50% proximal small bowel resection (SBR), or 75% proximal SBR. Preoperatively, mice were placed on the liquid HFD for 24 hours. As previously described, sham operations involved transection of the bowel 12cm proximal to the ileocecal junction with re-anastomosis alone (no bowel resection). 50% SBRs were performed by resection of the small bowel 1–2cm distal to the ligament of Trietz and approximately 12cm proximal to the ileocecal junction[30]. For 75% resections, the small bowel was resected from 1–2cm distal to the ligament of Trietz to 6cm proximal to the ileocecal junction[31]. All anastomoses were constructed with a handsewn end-to-end anastomosis using interrupted 9–0 nylon sutures. All mice from all groups were fed liquid HFD starting on postoperative day one for one week to prevent luminal obstruction and then either transitioned to SC or maintained on HFD. Small bowel, liver, serum, and portal venous blood were collected at postoperative week 15. Food intake, glucose tolerance testing, and triglyceride transport for mice on HFD was measured on a different set of C57BL/6J mice.

2.3. Confirmation of structural adaptation

Intestinal tissue from the distal end of the IO specimen and bowel distal to the anastomosis at postoperative week 15 were fixed in 10% formalin and embedded in paraffin. These were processed to generate 5-μm thick longitudinal sections which were then stained with hematoxylin and eosin. To assess for structural adaptation, villus height and crypt depth were then measured (NIS elements AR 4; Nikon, Melville, NY), as previously described[32].

2.4. Daily caloric intake

Food intake was measured at postoperative week 14 for mice on SC and postoperative week 15 for mice on HFD. Mice were either singly-housed or cohoused with same operation type with food intake measured by weight for mice on SC or amount ingested for mice on liquid HFD over 24 hours for 4–5 day; this was then converted to average daily caloric intake.

2.5. Body composition

As previously described, accretion of body fat mass and lean mass were measured preoperatively and on postoperative week 12 for mice on SC and postoperative week 14 for mice on HFD using a quantitative nuclear magnetic resonance instrument (Echo Medical Systems, Houston, TX)[33].

2.6. Glucose tolerance testing

Glucose tolerance testing was performed at postoperative week 12 and 13 for mice on SC and HFD, respectively [34, 35]. Prior to testing, mice were fasted overnight for 12 hours on wood chip bedding and kept in a low stimulation environment. Mice were given an intraperitoneal 2mg/gm glucose load and blood glucose levels were measured at 0, 15, 30, 60, 90, and 120 minutes via tail vein.

2.7. Triglyceride transport

As previously described, intestinal uptake of triglycerides was performed at postoperative week 12–14 and 14–15 for mice on SC and HFD, respectively[36, 37]. Mice were fasted for six hours overnight and then given an intraperitoneal injection of Poloxamer 407 (1g/kg; Sigma-Aldrich, St. Louis, MO). Poloxamer 407 inhibits lipoprotein lipase, which facilitates lipid uptake into tissues[38]. Of note, this inhibition does not exclude hepatic production of endogenous triglycerides. Thirty minutes after injection, mice were gavaged with olive oil (10μg/mg; Sigma-Aldrich, St. Louis, MO). Tail vein serum was measured prior to intraperitoneal injection, and at time points 0, 1, 2, 4, and 6 hours after gavage. Serum triglyceride concentrations were determined using commercially available L-Type TG-H kit (Wako Chemicals, Richmond, VA).

2.8. Liver lipid extraction and analysis

As previously described, livers were homogenized in PBS and protein concentration was determined[39]. The homogenate was extracted with chloroform/methanol (2:1) and 0.1% sulfuric acid. The organic phase was then dried under nitrogen and resuspended using 2% Triton X-100. Liver total triglyceride, cholesterol, and free fatty acid concentrations were determined using commercially available L-Type TG-H, Cholesterol E, and NEFA C kits, respectively (Wako Chemicals, Richmond, VA).

2.9. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels

Serum was obtained via the submandibular vein prior to sacrifice. Liver enzyme activity levels were measured using ALT and AST kits (Sigma-Aldrich, St. Louis, MO).

2.10. Liver fibrosis staining

Liver tissues fixed in 10% formalin and 3μm sections of paraffin-embedded tissue were then stained with Sirius red, a marker of fibrosis. As previously described, quantification of total fibrotic area was performed using Image-J software[40]. Slides were scanned at 20X magnification, with ten fields captured of each specimen. All slides were analyzed by the same investigator in a blinded fashion.

2.11. Liver RNA isolation and PCR

Total RNA from the liver was isolated using RNeasy Mini kits per the manufacturer’s protocol (Qiagen, Germantown, MD). qRT-PCR was conducted using the ABI StepOnePlus Real-Time PCR system with specific primers (GSS: forward primer GCCTCCTACATCCTCATGGA, reverse primer CCACATGCTTGTTCATCACC; HO-1: forward primer GCTCGAATGAACACTCTGG, reverse primer GTTCCTCTGTCAGCATCAC; NOX2: forward primer CGGAGAGTTTGGAAGAGCATAA, reverse primer GGTACTGGGCACTCCTTTATTT; Applied Biosystems, Waltham, MA). The relative mRNA levels were estimated from the equation 2−ΔCt (ΔCt = Ct of target gene minus Ct of 18S rRNA). Fold changes in the mRNA level of genes were calculated with a control group level set at 1.

2.12. Portal venous inflammatory cytokines

The Mesoscale Discovery VPLEX Proinflammatory Panel 1 mouse kit (Catalog #K15AOH-1; Rockville, MD) was used to detect interleukin 1-beta (IL-1β) and tumor necrosis factor alpha (TNFα) in portal venous blood at 15 weeks after operation. Samples were prepared using the manufacturer’s protocol and an electrochemiluminescence signal was measured. The emitted fluorescence intensity was analyzed using the MSD Discovery Workbench analysis software.

2.13. Statistical Analysis

Statistical analysis was performed using GraphPad-Prism 6 software (La Jolla, CA). Adaptation data was analyzed using a Student’s t test. Food intake, liver lipid compositions, liver enzyme levels, oxidative stress markers, Sirius red staining quantification, and portal venous cytokines were transformed into a log scale to minimize variance effects and analyzed using a two-way ANOVA with Tukey’s multiple comparison tests between groups. Body composition, glucose tolerance, and triglyceride transport were analyzed using a two-way ANOVA with Tukey’s multiple comparison tests between groups. Graphs show the sample means on the original scale with significance of Student’s t tests or Tukey’s multiple comparison tests from the transformed scale, if used, indicated. A p value of <0.05 was considered significant.

3. Results

3.1. Functional changes of enteral feeding after SBR

When compared with baseline IO bowel measurements, villus height significantly increased in all resected mice on both diets by week 15, affirming appropriate structural intestinal adaptation (Figure 1A)[39]. The effect of resection on average daily caloric intake differed between diets (Figure 1B). There was no difference in caloric intake in sham versus resected mice fed a SC diet; however, for mice on a HFD, caloric intake significantly decreased by 24–32% with increasing resection of bowel. Furthermore, in comparing the 75% resection groups on the two diets, there was a significant 30% lower average daily caloric intake in mice fed a HFD compared to SC.

Figure 1. Measurements of intestinal adaptation and body composition changes of enteral feeding after SBR.

Figure 1.

Open in a new tab

(A) To assess adaptation, villus height was measured intraoperatively (IO, n=11, 13) and at week 15 for 50% SBR (n=6, 5) and 75% SBR (n=5, 8) mice on SC and HFD, respectively. ****p<0.0001, ***p=0.0001. (B) Average daily caloric intake was measured in sham, 50% resected, and 75% resected mice on SC (n=6, 6, 4) and HFD (n=6, 7, 5) at week 14 and 15. *p<0.05, **p<0.01. (C) Percentage change in weight, lean mass, and fat mass from baseline to >10 weeks after operation in sham, 50% resected, and 75% resected mice fed SC (n=6, 6, 5) or HFD (n=6, 5, 9). **p<0.01, ****p<0.0001.

Body weight significantly decreased with increasing lengths of bowel removed in both SC and HFD groups; the magnitude of body weight change was greater in the HFD group (Figure 1C). Across the HFD group, there was a significantly greater loss in percentage body weight with increasing lengths of bowel resected. The 50% SBR mice lost 23% and 75% SBR mice lost 33% of initial body weight. Further, there was a significant 24% increase in weight in sham operated mice on a HFD compared to SC. More lean mass was lost with increasing loss of bowel on both diets, while fat mass percentage from baseline significantly decreased (Figure 1C). The contrast between sham to 75% SBR when comparing changes in both lean and fat mass were greater in the HFD group, but there were no differences between both 50% or 75% resected mice across diets.

Bowel resection significantly promoted glucose intolerance compared to sham controls on both diets (Figure 2A). There was a 58% and 35% increase in total area under the curve in comparing sham control to 50% resected mice on HFD and SC, respectively. Additionally, the HFD was significantly associated with glucose intolerance in shams and 50% SBRs compared to mice fed SC. Intestinal uptake of triglycerides decreased in 50% SBR compared to sham controls on both diets (Figure 2B). There was significant 40% and 28% increases in total area under the curve from 50% resected mice to sham controls on a SC and HFD, respectively. Across diets, triglyceride uptake was significantly higher in both sham and 50% SBR on a HFD compared to SC. In conclusion, intestinal resection compromised triglyceride uptake and glucose tolerance on both diets, with greater magnitude in the HFD group.

Figure 2. Functional changes of enteral feeding after SBR.

Figure 2.

Open in a new tab

(A) Intraperitoneal glucose tolerance testing at in sham and 50% SBR mice on SC (n=6, 6) and HFD (n=3, 4) at week 12 and 13, respectively. #p=0.06, **p<0.005 (B) Triglyceride transport testing in sham and 50% SBR mice on SC (n=10, 5) and HFD (n=6, 7) at weeks 12–14 and 14–15, respectively. *p<0.05, ***p<0.0005, ****p<0.0001.

3.2. Liver steatosis and injury after SBR

To assess steatosis after SBR, triglyceride, cholesterol, and free fatty acid levels were measured in liver tissue (Figure 3A). Hepatic triglyceride, cholesterol, and free fatty acid levels were significantly higher in mice on a HFD compared to those on SC. Triglyceride levels were increased from 7- to 19-fold in mice on the HFD compared to mice fed SC in the sham or 75% resection groups. Liver cholesterol levels were doubled in mice on HFD compared with mice fed SC in the sham or 75% SBR groups. Liver free fatty acid levels were also doubled in mice receiving sham surgery compared with those receiving 75% resection. Resection did not affect liver lipid levels regardless of diet type.

Figure 3. Liver steatosis and inflammation after SBR.

Figure 3.

Open in a new tab

(A) Liver triglyceride and cholesterol levels were measured in sham (n=5, 6), 50% SBR (n=6, 5), and 75% SBR (n=5, 10) mice on SC and HFD at week 15, respectively. Liver free fatty acid levels were measured in sham (n=5, 6), 50% SBR (n=4, 5), and 75% SBR (n=5, 10) mice on SC and HFD at week 15, respectively. ****p<0.0001, ***p<0.001, **p<0.01. (B) ALT and ALT levels at week 15 in SC and HFD mice. ****p<0.0001, ***p<0.0005, **p<0.005, *p<0.05.

Serum AST and ALT levels were elevated only in mice receiving bowel resection surgery on HFD (Figure 3B). Neither the surgery alone, nor the diet without surgery, produced significant elevations. The greater extent of bowel resection (50% vs 75%) increased the extent of liver injury markers in the context of HFD feeding and particularly reduced variability between replicates. Specifically, there was a 2.2-fold increase in ALT levels in 75% resected mice compared to sham controls and 2.0- and 2.7-fold increases in AST levels in 50% and 75% resected mice, respectively, compared to sham controls. Taken together, ALT and AST demonstrate considerable liver damage in 75% SBR on HFD.

3.3. Increased oxidative stress and hepatic fibrosis

To assess for oxidative stress in the liver leading to fibrosis, we first measured the relative expression of glutathione synthetase (GSS), heme oxygenase-1 (HO-1), and NADPH oxidase 2 (NOX2). Expression levels of GSS, HO-1, and NOX2 demonstrated a significant increasing trend from sham to 75% resection among the HFD mice, but not among the SC mice (Figure 4). On HFD, there was a 2- and 1.6-fold increase in GSS expression in 75% resected mice compared to sham controls and 50% SBR, respectively. There was also a 3.8-fold increase in HO-1 expression in 75% resected mice, and a 1.9- and 3-fold increase in NOX2 expression in 50% SBR and 75% SBR, respectively. Additionally, we identified a 2.7- and 4.2-fold increase in GSS expression and a 2.3- and 3.7-fold increase in HO-1 expression in 50% and 75% resected mice on HFD compared to SC, respectively. Finally, there is a 3.6-fold increase in NOX2 expression 75% resected mice on HFD compared to SC.

Figure 4. Hepatic oxidative stress markers after SBR.

Figure 4.

Open in a new tab

mRNA expression levels in liver tissue from sham (n=5, 5), 50% SBR (n=5, 5), and 75% SBR (n=5, 5) mice at 15 weeks on SC and HFD, respectively. *p<0.05, **p<0.005, ***p<0.001, ****p<0.0001.

Sirius red staining of the liver qualitatively and quantitatively showed increasing fibrosis with loss of bowel in mice on a HFD (Figure 5A–B). There was a 6.6-fold increase in fibrosis in 75% resected mice on a HFD than sham controls. When sham controls were compared to mice receiving 75% intestinal resection, fibrosis increased significantly, but again only in mice also fed a HFD, pointing to a strong interaction between diet and resection surgery.

Figure 5. Hepatic fibrosis after SBR.

Figure 5.

Open in a new tab

(A) Representative examples of Sirius red staining of livers of sham, 50% SBR, and 75% SBR on SC and HFD at 15 weeks. Scale bar 100μm. (B) Quantification of Sirius red staining for hepatic fibrosis in sham (n=5, 5), 50% SBR (n=5, 3), and 75% (n=5, 7) mice on SC and HFD mice at 15 weeks, respectively. **p<0.005. (C) IL-1β and TNFα cytokine expression levels in the portal vein of sham (n=5, 5), 50% resected (n=4, 2), and 75% resected (n= 5, 9) mice on a SC and HFD, respectively.

3.4. Portal venous inflammatory markers

Portal venous IL-1β expression increases from sham to 75% resection, regardless of diet (Figure 5C, p<0.05). TNFα trended to be more highly expressed in 75% resected mice than sham controls (p=0.05).

4. Discussion

In SBS, enteral feeding has been shown to stimulate intestinal adaptation, improving the absorptive and functional capacity to meet metabolic demands[41–43]. Additionally, increasing enteral caloric intake has been shown as an effective treatment for IFALD[44]. Given these findings and their therapeutic implications, research has been largely dedicated to determining which trophic factors drive adaptation. Currently, it is recommended that SBS patients have an enteral diet with a mixture of long chain fatty acids (LCFA) and medium chain fatty acids (MCFA); the LCFAs have been found to stimulate adaptation, whereas MCFAs are more rapidly absorbed into portal circulation and thought to be an important caloric source[45–47]. However, the impact of how these dietary fats could affect the development of the highest morbidity associated with SBS, IFALD, has not been described. In this study, we demonstrate in a SBS mouse model that enteral feeding with a diet high in a LCFA worsens liver steatosis and compounds the liver injury present secondary to resection.

In our HFD formulation, 35% of calories are from fat, derived from olive oil, corn oil, and safflower oil. These oils are composed mainly of oleic acid, which is a monosaturated omega-9 LCFA. On the other hand, the SC diet is composed of 13% fat calories derived from soybean oil (composed mostly of polyunsaturated omega-6 linoleic acid). In humans, hepatic steatosis leading to nonalcoholic associated liver disease has been shown to be associated with accumulation of excess oleic acid[48, 49]. It is therefore possible that oleic acid is the factor acting as a pro-inflammatory signal to the liver in mice with SBS. An argument against this notion is that the average caloric intake in the HFD group was lower for each magnitude of resection. This suggests that the amount of oleic acid consumed is not the only contributor to intestinal injury after SBR.

Therefore, in addition to oleic acid, liver injury may also be related to the lack of fiber in the HFD formulation (0.7% in HFD vs 4.5% in SC). Short chain fatty acids (SCFA) are derived from microbial fermentation of dietary fibers[50]. When SCFAs are unavailable, microbes digest proteins and other dietary fats, with their byproducts implicated in the development of insulin resistance[51, 52]. It has been previously shown that on this HFD, there is an increase in the abundance of Firmicutes in the small intestine after SBR, which has also been implicated in the development of obesity[53, 54]. In this study, resected mice showed increased glucose intolerance when compared to sham controls, which was only further worsened with the addition of a HFD. We propose that the pro-inflammatory effects of oleic acid and altered microbial metabolites from low enteral fiber intake lead to IFALD via the oxidative stress pathway in resected mice on a HFD, as we have shown significant increases in oxidative stress markers in the livers of these mice[55].

Although we hypothesized that the high oleic acid and low fiber content in the HFD contributes to the development of IFALD, we acknowledge many limitations in our study design. Firstly, the SC is a solid diet, whereas the HFD is a liquid diet, which could alter gut transport time and, therefore, absorptive capacity. Despite sham controls having a significant increase in body weight and fat mass when on a HFD, the body composition of the resected mice (both 50% and 75%) did not differ from those on SC. Resected mice on a HFD had similar reductions in body weight and fat mass as the resected mice on the SC. Interestingly, resected mice on both a HFD and SC do not become hyperphagic to increase their caloric intake to counteract their loss of bowel; resected mice on a HFD actually have a reduction in caloric intake compared to sham controls. Although the mechanism for this is unknown, we have previously reported that resting energy expenditure is reduced after SBR[33]. It is therefore possible that reduced caloric intake was a consequence of lower metabolic demand. Although caloric intake was reduced in the HFD group after resection, the magnitude of resection was likely to be more of a contributing factor to changes in body weight after surgery.

In both 50% and 75% mice, distal villus length increased appropriately thus confirming that diet type did not alter normal intestinal adaptation in the setting of massive bowel loss[30]. Although it has been reported in the literature that a HFD consisting of LCFAs in many post-resection animal models is associated with increased villus growth, this was not replicated in our model[56]. We believe that the resected mice had no difference in villus heights between diet types because the of the chronic nature of this study, allowing for full adaptive growth in both groups as opposed to other models which have assessed the augmentation of villus growth with a HFD at early timepoints. Therefore, we believe that the components of the diet, in the type of fat and fiber content, seem more impactful than the diet consistency, as there was no difference in caloric consumption between sham controls on the HFD or SC and appropriate and paralleled villus growth. Future studies are needed to control for the fat composition as well as the fiber content in this model to determine their role in liver injury.

Quite strikingly, markers of liver injury including serum ALT and AST were elevated as a consequence of bowel resection, but this was confined to mice fed the HFD. Further evidence of injury was found in the Sirius red staining, with qualitative and quantitative fibrosis increasing as a consequence of resection but requiring HFD as an additional variable. Liver steatosis, although worsened on the HFD compared to the SC, was no different between sham and resected mice, pointing to the fact that fat load itself was the likely driver of steatosis, but the steatosis did not lead to injury in the absence of intestinal resection. These findings for the first time reveal the development of early end stage liver disease (fibrosis) in a PN-independent model of SBS.

At the molecular and cellular level, the driver(s) of liver injury associated with intestinal resection in conjunction with high fat diet remain unknown. It is possible that the increased delivery of inflammatory cytokines along the gut-liver axis via the portal vein occurs and serves as the culprit. Portal venous cytokines IL-1β and TNFα showed an increasing trend with decreasing amount of bowel length, independent of diet. Thus, these cytokines might provide part of the signal, that related to resection but not that related to diet, to promote liver injury. The increase in cytokines could be secondary to an altered microbiome with metabolites and bacteria more easily traversing resected bowel, which has been associated with increased permeability[57, 58]. Additionally, metabolic derangements of decreased glucose homeostasis seen previously in this model occurred in resected mice compared to control shams[59]. Furthermore, triglyceride uptake was elevated in the cohorts fed a HFD compared to those on SC, but mice with intestinal resection lagged behind their diet-matched counterparts in such uptake and transport. This decrease in transport was observed despite gene expression changes that foster reprogramming towards a proximal bowel identity, with significant upregulation of lipid metabolism genes[60]. The reduction in lipid transport in diet-matched cohorts may very well be due to adverse remodeling of intestinal lymphatics following SBR[29].

Our model of SBS does not involve PN administration. It could therefore be argued that we are not truly recapitulating the pathogenesis of liver injury in patients with SBS. On the other hand, we have clearly demonstrated that liver injury occurs in association with intestinal resection alone. The magnitude of resection and composition of enteral feeds both contribute to the severity of this injury. PN adds additional confounders that are difficult to control for and include fat composition (soy versus fish oil based), amount of fat administered, rates of glucose infusion, amount of enteral nutrition provided, and amino acid composition. We therefore feel that our PN-independent SBS model is a relevant starting point to illuminate molecular mechanisms of liver injury associated with intestinal loss. It would certainly be important in future studies to determine whether PN augments liver injury beyond what we are describing.

5. Conclusions

Long-term enteral feeding of a HFD in SBS is associated with hepatic steatosis and liver injury. These data underscore the importance of basic nutrient composition of enteral feeding formulations. Our observation that liver injury and steatosis occur independent of parenteral nutrition suggests that enteral feeding may play a significant role in contributing to the development of IFALD.

Acknowledgements

This work was supported by Pediatric Gastroenterology Training Grant NIH T32 DK077653 (EJO). the National Institutes of Health R01 DK119147 (GJR and BWW), the Digestive Diseases Research Core Center of the Washington University School of Medicine (NIH #P30DK52574), and the Children’s Surgical Sciences Research Institute of the St. Louis Children’s Hospital. We thank the Alvin J. Siteman Cancer Center at Washington University School of Medicine and Barnes-Jewish Hospital in St. Louis, MO, for the use of the Immunomonitoring Laboratory for multiplexing immunoassay service. The Siteman Cancer Center is supported in part by an NCI Cancer Center Support Grant #P30 CA091842.

Abbreviations:

SBS

short bowel syndrome

IFALD

intestinal failure-associated liver disease

PN

parenteral nutrition

SC

standard chow

HFD

high fat diet

SBR

small bowel resection

IO

intraoperative

ALT

alanine aminotransferase

AST

aspartate aminotransferase

GSS

glutathione synthetase

HO-1

heme oxygenase-1

NOX2

NADPH oxidase 2

IL-1β

interleukin 1-beta

TNFα

tumor necrosis factor alpha

LCFA

long chain fatty acid

MCFA

medium chain fatty acid

SCFA

short chain fatty acid

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Disclosures

The authors have no conflict of interest or financial disclosures.

References

  • [1].Duro D, Kamin D, Duggan C. Overview of Pediatric Short Bowel Syndrome. Journal of Pediatric Gastroenterology and Nutrition 2008;47:S33–S6. [DOI] [PubMed] [Google Scholar]
  • [2].Goulet O, Ruemmele F. Causes and management of intestinal failure in children. Gastroenterology 2006;130(2 Suppl 1):S16–28. [DOI] [PubMed] [Google Scholar]
  • [3].Galea MH, Holliday H, Carachi R, Kapila L. Short-bowel syndrome: A collective review. Journal of Pediatric Surgery 1992;27(5):592–6. [DOI] [PubMed] [Google Scholar]
  • [4].Wales PW, Christison-Lagay ER. Short bowel syndrome: epidemiology and etiology. Seminars in Pediatric Surgery 2010;19(1):3–9. [DOI] [PubMed] [Google Scholar]
  • [5].Wales PW, de Silva N, Kim J, Lecce L, To T, Moore A. Neonatal short bowel syndrome: population-based estimates of incidence and mortality rates. Journal of Pediatric Surgery 2004;39(5):690–5. [DOI] [PubMed] [Google Scholar]
  • [6].Spencer AU, Kovacevich D, McKinney-Barnett M, Hair D, Canham J, Maksym C, et al. Pediatric short-bowel syndrome: the cost of comprehensive care. The American Journal of Clinical Nutrition 2008;88(6):1552–9. [DOI] [PubMed] [Google Scholar]
  • [7].Vanderhoof JA, Langnas AN. Short-bowel syndrome in children and adults. Gastroenterology 1997;113(5):1767–78. [DOI] [PubMed] [Google Scholar]
  • [8].Grosfeld JL, Rescoria FJ, West KW. Short bowel syndrome in infancy and childhood: analysis of survival in 60 patients. The American Journal of Surgery 1986;151(1):41–6. [DOI] [PubMed] [Google Scholar]
  • [9].Wales PW, de Silva N, Kim JH, Lecce L, Sandhu A, Moore AM. Neonatal short bowel syndrome: a cohort study. Journal of Pediatric Surgery 2005;40(5):755–62. [DOI] [PubMed] [Google Scholar]
  • [10].Modi BP, Langer M, Ching YA, Valim C, Waterford SD, Iglesias J, et al. Improved survival in a multidisciplinary short bowel syndrome program. Journal of Pediatric Surgery 2008;43(1):20–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Spencer AU, Neaga A, West B, Safran J, Brown P, Btaiche I, et al. Pediatric short bowel syndrome: redefining predictors of success. Annals of Surgery 2005;242(3):403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Diamond IR, de Silva N, Pencharz PB, Kim JH, Wales PW. Neonatal short bowel syndrome outcomes after the establishment of the first Canadian multidisciplinary intestinal rehabilitation program: preliminary experience. Journal of Pediatric Surgery 2007;42(5):806–11. [DOI] [PubMed] [Google Scholar]
  • [13].Kelly DA. Liver complications of pediatric parenteral nutrition--epidemiology. Nutrition (Burbank, Los Angeles County, Calif) 1998;14(1):153–7. [DOI] [PubMed] [Google Scholar]
  • [14].Soden JS. Clinical assessment of the child with intestinal failure. Seminars in Pediatric Surgery 2010;19(1):10–9. [DOI] [PubMed] [Google Scholar]
  • [15].Bishay M, Pichler J, Horn V, Macdonald S, Ellmer M, Eaton S, et al. Intestinal failure-associated liver disease in surgical infants requiring long-term parenteral nutrition. Journal of Pediatric Surgery 2012;47(2):359–62. [DOI] [PubMed] [Google Scholar]
  • [16].Kelly DA. Intestinal Failure–Associated Liver Disease: What Do We Know Today? Gastroenterology 2006;130(2, Supplement):S70–S7. [DOI] [PubMed] [Google Scholar]
  • [17].Courtney CM, Warner BW. Pediatric intestinal failure-associated liver disease. Current Opinion in Pediatrics 2017;29(3):363–70. [DOI] [PubMed] [Google Scholar]
  • [18].Greenberg GR, Wolman SL, Christofides ND, Bloom SR, Jeejeebhoy KN. Effect of total parenteral nutrition on gut hormone release in humans. Gastroenterology 1981;80(5):988–93. [PubMed] [Google Scholar]
  • [19].Lucas A, Bloom S, Aynsley-Green A. Metabolic and endocrine consequences of depriving preterm infants of enteral nutrition. Acta Pædiatrica 1983;72(2):245–9. [DOI] [PubMed] [Google Scholar]
  • [20].Touloukian RJ, Seashore JH. Hepatic secretory obstruction with total parenteral nutrition in the infant. Journal of Pediatric Surgery 1975;10(3):353–60. [DOI] [PubMed] [Google Scholar]
  • [21].Buchman AL, Dubin MD, Moukarzel AA, Jenden DJ, Roch M, Rice KM, et al. Choline deficiency: a cause of hepatic steatosis during parenteral nutrition that can be reversed with intravenous choline supplementation. Hepatology 1995;22(5):1399–403. [PubMed] [Google Scholar]
  • [22].Kaufman SS, Loseke CA, Lupo JV, Young RJ, Murray ND, Pinch LW, et al. Influence of bacterial overgrowth and intestinal inflammation on duration of parenteral nutrition in children with short bowel syndrome. The Journal of Pediatrics 1997;131(3):356–61. [DOI] [PubMed] [Google Scholar]
  • [23].Andorsky DJ, Lund DP, Lillehei CW, Jaksic T, DiCanzio J, Richardson DS, et al. Nutritional and other postoperative management of neonates with short bowel syndrome correlates with clinical outcomes. The Journal of Pediatrics 2001;139(1):27–33. [DOI] [PubMed] [Google Scholar]
  • [24].Voitk A, Echave V, Brown R, Gurd F. Use of elemental diet during the adaptive stage of short gut syndrome. Gastroenterology 1973;65(3):419–26. [PubMed] [Google Scholar]
  • [25].Tandon RK, Rodgers JB, Balint JA. The effects of medium-chain triglycerides in the short bowel syndrome. The American Journal of Digestive Diseases 1972;17(3):233–8. [DOI] [PubMed] [Google Scholar]
  • [26].Vanderhoof JA, Grandjean CJ, Kaufman SS, Burkley KT, Antonson DL. Effect of high percentage medium-chain triglyceride diet on mucosal adaptation following massive bowel resection in rats. Journal of Parenteral and Enteral Nutrition 1984;8(6):685–9. [DOI] [PubMed] [Google Scholar]
  • [27].Ito M, Suzuki J, Tsujioka S, Sasaki M, Gomori A, Shirakura T, et al. Longitudinal analysis of murine steatohepatitis model induced by chronic exposure to high-fat diet. Hepatology Research 2007;37(1):50–7. [DOI] [PubMed] [Google Scholar]
  • [28].Randolph GJ, Miller NE. Lymphatic transport of high-density lipoproteins and chylomicrons. The Journal of Clinical Investigation 2014;124(3):929–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Onufer EJ, Czepielewski R, Seiler KM, Erlich E, Courtney CM, Bustos A, et al. Lymphatic network remodeling after small bowel resection. Journal of Pediatric Surgery 2019;54(6):1239–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Helmrath MA, VanderKolk WE, Can G, Erwin CR, Warner BW. Intestinal adaptation following massive small bowel resection in the mouse. Journal of the American College of Surgeons 1996;183(5):441–9. [PubMed] [Google Scholar]
  • [31].Wakeman D, Longshore SW, McMellen ME, Santos JA, Guo J, Erwin CR, et al. Extent of small bowel resection does not influence the magnitude of intestinal adaptation in the mouse. Journal of Pediatric Surgery 2010;45(6):1274–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Wakeman D, Guo J, Santos JA, Wandu WS, Schneider JE, McMellen ME, et al. p38 MAPK regulates Bax activity and apoptosis in enterocytes at baseline and after intestinal resection. American Journal of Physiology-Gastrointestinal and Liver Physiology 2012;302(9):G997–G1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Tantemsapya N, Meinzner-Derr J, Erwin CR, Warner BW. Body composition and metabolic changes associated with massive intestinal resection in mice. Journal of pediatric surgery 2008;43(1):14–9. [DOI] [PubMed] [Google Scholar]
  • [34].Li B, Nolte LA, Ju J-S, Han DH, Coleman T, Holloszy JO, et al. Skeletal muscle respiratory uncoupling prevents diet-induced obesity and insulin resistance in mice. Nature Medicine 2000;6(10):1115. [DOI] [PubMed] [Google Scholar]
  • [35].Künnecke B, Verry P, Bénardeau A, Von Kienlin M. Quantitative body composition analysis in awake mice and rats by magnetic resonance relaxometry. Obesity Research 2004;12(10):1604–15. [DOI] [PubMed] [Google Scholar]
  • [36].Zhang F, Zarkada G, Han J, Li J, Dubrac A, Ola R, et al. Lacteal junction zippering protects against diet-induced obesity. Science 2018;361(6402):599–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Millar JS, Cromley DA, McCoy MG, Rader DJ, Billheimer JT. Determining hepatic triglyceride production in mice: comparison of poloxamer 407 with Triton WR-1339. Journal of Lipid Research 2005;46(9):2023–8. [DOI] [PubMed] [Google Scholar]
  • [38].Dumortier G, Grossiord JL, Agnely F, Chaumeil JC. A Review of Poloxamer 407 Pharmaceutical and Pharmacological Characteristics. Pharmaceutical Research 2006;23(12):2709–28. [DOI] [PubMed] [Google Scholar]
  • [39].Newberry EP, Xie Y, Kennedy S, Han X, Buhman KK, Luo J, et al. Decreased hepatic triglyceride accumulation and altered fatty acid uptake in mice with deletion of the liver fatty acid-binding protein gene. Journal of Biological Chemistry 2003;278(51):51664–72. [DOI] [PubMed] [Google Scholar]
  • [40].Han Y-H, Shin K-O, Kim J-Y, Khadka DB, Kim H-J, Lee Y-M, et al. A maresin 1/RORα/12-lipoxygenase autoregulatory circuit prevents inflammation and progression of nonalcoholic steatohepatitis. The Journal of Clinical Investigation 2019;129(4). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Menge H, Gräfe M, Lorenz-Meyer H, Riecken E. The influence of food intake on the development of structural and functional adaptation following ileal resection in the rat. Gut 1975;16(6):468–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Weser E Nutritional aspects of malabsorption: short gut adaptation. The American Journal of Medicine 1979;67(6):1014–20. [DOI] [PubMed] [Google Scholar]
  • [43].Buts J-P, Morin C, Ling V. Influence of dietary components on intestinal adaptation after small bowel resection in rats. Clinical and Investigative Medicine 1979;2(1):59–66. [PubMed] [Google Scholar]
  • [44].Chwals WJ. The metabolic response to surgery in neonates. Current opinion in pediatrics 1994;6(3):334–40. [DOI] [PubMed] [Google Scholar]
  • [45].Kollman KA, Lien EL, Vanderhoof JA. Dietary Lipids Influence Intestinal Adaptation After Massive Bowel Resection. Journal of Pediatric Gastroenterology and Nutrition 1999;28(1):41–5. [DOI] [PubMed] [Google Scholar]
  • [46].Park JH, Grandjean CJ, Hart MH, Baylor JM, Vanderhoof JA. Effects of dietary linoleic acid on mucosal adaptation after small bowel resection. Digestion 1989;44(2):57–65. [DOI] [PubMed] [Google Scholar]
  • [47].Choi PM, Sun RC, Guo J, Erwin CR, Warner BW. High-Fat Diet Enhances Villus Growth During the Adaptation Response to Massive Proximal Small Bowel Resection. Journal of Gastrointestinal Surgery 2014;18(2):286–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Araya J, Rodrigo R, Videla LA, Thielemann L, Orellana M, Pettinelli P, et al. Increase in long-chain polyunsaturated fatty acid n− 6/n− 3 ratio in relation to hepatic steatosis in patients with non-alcoholic fatty liver disease. Clinical Science 2004;106(6):635–43. [DOI] [PubMed] [Google Scholar]
  • [49].Cui W, Chen SL, Hu K-Q. Quantification and mechanisms of oleic acid-induced steatosis in HepG2 cells. American Journal of Translational Research 2010;2(1):95. [PMC free article] [PubMed] [Google Scholar]
  • [50].Cummings J, Pomare E, Branch W, Naylor C, Macfarlane G. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 1987;28(10):1221–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Newgard CB, An J, Bain JR, Muehlbauer MJ, Stevens RD, Lien LF, et al. A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metabolism 2009;9(4):311–26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Wall R, Ross RP, Shanahan F, O’Mahony L, O’Mahony C, Coakley M, et al. Metabolic activity of the enteric microbiota influences the fatty acid composition of murine and porcine liver and adipose tissues. The American Journal of Clinical Nutrition 2009;89(5):1393–401. [DOI] [PubMed] [Google Scholar]
  • [53].Ley RE, Bäckhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut microbial ecology. Proceedings of the National Academy of Sciences 2005;102(31):11070–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [54].Sommovilla J, Zhou Y, Sun R, Choi P, Diaz-Miron J, Shaikh N, et al. Small bowel resection induces long-term changes in the enteric microbiota of mice. Journal of Gastrointestinal Surgery 2015;19(1):56–64. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Machado MV, Michelotti GA, Xie G, Almeida Pereira T, Boursier J, Bohnic B, et al. Mouse models of diet-induced nonalcoholic steatohepatitis reproduce the heterogeneity of the human disease. PloS one 2015;10(5):e0127991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [56].Sukhotnik I, Mor-Vaknin N, Drongowski RA, Miselevich I, Coran AG, Harmon CM. Effect of dietary fat on early morphological intestinal adaptation in a rat with short bowel syndrome. Pediatric Surgery International 2004;20(6):419–24. [DOI] [PubMed] [Google Scholar]
  • [57].D’Antiga L, Dhawan A, Davenport M, Mieli-Vergani G, Bjarnason I. Intestinal absorption and permeability in paediatric short-bowel syndrome: a pilot study. Journal of Pediatric Gastroenterology and Nutrition 1999;29(5):588–93. [DOI] [PubMed] [Google Scholar]
  • [58].Bines J, Francis D, Hill D. Reducing parenteral requirement in children with short bowel syndrome: impact of an amino acid-based complete infant formula. Journal of Pediatric Gastroenterology and Nutrition 1998;26(2):123–8. [DOI] [PubMed] [Google Scholar]
  • [59].Barron L, Courtney C, Bao J, Onufer E, Panni RZ, Aladegbami B, et al. Intestinal resection-associated metabolic syndrome. Journal of Pediatric Surgery 2018;53(6):1142–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [60].Seiler KM, Waye SE, Kong W, Kamimoto K, Bajinting A, Goo WH, et al. Single-Cell Analysis Reveals Regional Reprogramming During Adaptation to Massive Small Bowel Resection in Mice. Cellular and Molecular Gastroenterology and Hepatology 2019. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES