Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jul 1.
Published in final edited form as: Ocul Surf. 2020 Apr 30;18(3):470–482. doi: 10.1016/j.jtos.2020.04.011

RvE1 Uses the LTB4 Receptor BLT1 to Increase [Ca2+]i and Stimulate Mucin Secretion in Cultured Rat and Human Conjunctival Goblet Cells

Menglu Yang a, Marit Lippestad a,b,c, Robin R Hodges a, Haakon K Fjærvoll a,b, Ketil A Fjærvoll a,b, Jeffery A Bair a, Tor P Utheim a,c,d, Charles N Serhan e, Darlene A Dartt a,*
PMCID: PMC7301495  NIHMSID: NIHMS1594832  PMID: 32361084

Abstract

Purpose

Specialized pro-resolving lipid mediator resolvin (Rv) E1 stimulates secretion including mucins from conjunctival goblet cells. RvE1 can use both its ChemR23 receptor and the LTB4 receptor BLT1 to increase [Ca2+]i. The purpose of this study was to determine the expression of ChemR23 and BLT1 and receptors on conjunctival goblet cells and the respective roles these two receptors play in goblet cell responses to RvE1.

Methods

Goblet cells were cultured from male rat or human conjunctiva from both sexes. Western blotting analysis, reverse transcription PCR and immunofluorescence microscopy were used to demonstrate the expression of ChemR23 and BLT1 in conjunctival goblet cells. High molecular weight glycoprotein secretion was determined using an enzyme-linked lectin assay. Signaling pathways were studied by measuring the increase in [Ca2+]i using fura 2/AM.

Results

ChemR23 and BLT1 and receptors were present on both rat and human conjunctival goblet cells. The BLT1 inhibitors LY293111 and U75302 significantly blocked RvE1- and LTB4-stimulated [Ca2+]i increase. RvE1- and LTB4-stimulated [Ca2+]i and secretion increases were blocked by BLT1-targeted siRNA. RvE1-stimulated [Ca2+]i and secretion increases were also blocked by ChemR23-targeted siRNA. Addition of RvE1 2 min before or simultaneously with LTB4 desensitized the LTB4 [Ca2+]i response. Addition of RvE1 and LTB4 simultaneously caused secretion that was decreased compared to either response alone.

Conclusion

RvE1, in addition to the ChemR23 receptor, uses the BLT1 receptor to increase [Ca2+]i and stimulate secretion in both rat and human cultured conjunctival goblet cells.

Keywords: RvE1, LTB4, BLT1 receptor, ChemR23 receptor, conjunctival goblet cells, Conjunctiva, goblet cells, inflammation, resolution, dry eye syndromes, secretion

1. Introduction

Conjunctival epithelium is a multi-layered stratified squamous epithelium covering the undersurface of the lids and surrounding the cornea. This epithelium helps create the wet surface of the anterior eye, and act as a barrier to protect the eye from external pathogenic and other dangerous factors. Interspersed within the conjunctival stratified squamous cells [1, 2], goblet cells secrete glycoproteins and mucins (mainly MUC5AC) to form the inner layer of tear film [3]. Under normal conditions this layer helps lubricate the ocular surface and forms the first defense against environmental pathogens, allergens, pollutants, and other environmental constituents. Uncontrolled inflammation involving goblet cells is characteristic of ocular surface disease such as dry eye, allergic conjunctivitis, and vernal keratoconjunctivitis. Either excessive or insufficient secretion by goblet cells causes discomfort: The up regulated mucin secretion leads to the catarrhus symptoms during allergenic diseases and while decreased mucin secretion causes discomfort in dry eye.

Multiple studies have suggested the pro-inflammatory role of LTB4 in ocular surface diseases. LTB4 is generated by epithelial cells from a mixed culture of goblet cell-like and stratified squamous-like epithelial cells in response to LPS exposure [4]. The concentration of LTB4 in tears from patients increases during allergy [5]. LTB4 also induces eosinophil infiltration in allergic conjunctivitis [6]. Increased mucin secretion [7] and increased level of LTB4 were observed in animal models of allergic conjunctivitis, implying that LTB4 directly targets goblet cells during allergy to increase the mucin secretion. The resolution of inflammation, as occurs in allergic conjunctivitis and dry eye, is an active process with the biosynthesis of specialized pro-resolving lipid mediators (SPMs), including lipoxins, resolvins (Rvs), protectins and maresins. These molecules counter-regulate the effects of inflammatory mediators [8, 9], increase phagocytosis [10] and help maintain homeostasis in both physiological and pathological situations [11].

RvE1 is biosynthesized from eicosapentaenoic acid (EPA). Endogenously RvE1 is biosynthesized from 18R-HEPE that is produced in an aspirin-independent manner from COX-2 or by p450 production of 18R-HEPE. The 18-HEPE is substrate for conversion by activated 5-LOX that produces an 18-hydroxy-5(6)-epoxide intermediate that is converted by the LTA4 hydrolase to RvE1 [12, 13].

In an in vitro model, RvE1 stimulates the increase in [Ca2+]i and in high molecular weight glycoprotein secretion with absence of pro-inflammatory signals in cultured conjunctival goblet cells [14]; meanwhile RvE1 blocks the goblet cell secretion triggered by inflammatory mediators [8]. The precursor of RvE1 has been found in healthy human tears [15]. In an in vivo model of dry eye, exogenous RvE1 protects against goblet cell loss [16]. Besides using ChemR23, RvE1 also directly interacts with the LTB4 receptor, BLT1 [11] in human polymorphonuclear leukocytes (PMNs) where RvE1 acts as a partial agonist on the BLT1 receptor, serving to locally dampen LTB4/BLT1 signals [11, 17]. Thus we hypothesize that the actions of RvE1 and its temporal relationship with LTs on goblet cell secretion is context dependent: RvE1 blocks the goblet cell secretion triggered by inflammatory mediators [8] during inflammation, yet also directly increases secretion from cultured conjunctival goblet cells[14, 18].

In the present study, we use goblet cells cultured from rat or human conjunctiva to investigate which of the known RvE1 receptors, ChemR23 or BLT1, are activated by RvE1 and LTB4 and how their interaction influences the increase in [Ca2+]i that stimulates secretion of protective high molecular weight glycoproteins including mucin.

1. Materials and Methods

1.1. Animals

All animal work conformed to the ARVO guidelines involving laboratory animals. Male Sprague Dawley rats weighing between 125 and 150 g obtained from Taconic Farms (Germantown, NY) were anesthetized with CO2 for 1 min and decapitated. The bulbar and forniceal conjunctiva were removed from both eyes. All experiments were approved by the Schepens Eye Research Institute Animal Care and Use Committee and adhere to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

1.2. Human material

Human conjunctival tissue was obtained from Eversight Eye Bank (Chicago, IL). Tissue was placed in Optisol media within 6 h of death.

1.3. Cell Culture

Goblet cells from rat or human conjunctiva were grown in organ culture as described previously [8, 9, 14, 18–21]. Pieces of minced conjunctival epithelium were placed on culture dishes and covered with RPMI 1640 medium supplemented with 10% FBS, 2 mM glutamine, and 100 μg/ml penicillin-streptomycin. The tissue pieces were removed after nodules of cells were observed. First passage goblet cells were used in all the experiments. To ensure that goblet cells predominated, the identity of cultured cells was periodically checked by evaluating by fluorescence microscopy staining with the lectins Ulex europaeus agglutinin (UEA)-1 for rat or Helix pomatia agglutinin (HPA) for human that detect goblet cell secretory product. The purity of cultured goblet cells was 98–99% determined by flow cytometry [22].

1.4. Immunofluorescence Microscopy

First passage goblet cells were grown on glass coverslips and fixed with paraformaldehyde. For immunofluorescence microscopy of intact conjunctiva, the rat eye and surrounding lids were removed and embedded in paraffin. Sections of 6 μm were made. The coverslips or the tissue sections were blocked in 1% bovine serum albumin (BSA) with 0.2% Triton X-100 in PBS for 45 min. Anti-BLT1 antibody or anti-ChemR23 antibody (Cayman Chemical, Ann Arbor, MI) was used at a 1:100 dilution overnight at 4°C. The anti-BLT1 receptor was a polyclonal antibody derived from rabbit against human BLT1 receptor, with reactivity against rat BLT1 receptor. The ChemR23 antibody was a polyclonal antibody derived from rabbit against human ChemR23 receptor, with reactivity against rat ChemR23 receptor. For rat goblet cells, UEA-I conjugated to FITC (Sigma-Aldrich, St. Louis, MO) was used at a 1:500 dilution. For human goblet cells, HPA conjugated to Alexa Fluor 488 (Invitrogen, Eugene, OR) was used at a 1:200 dilution. Secondary antibodies conjugated either to Cy2 or Cy3 (Jackson ImmunoResearch Laboratories, West Grove, PA) were used at 1:150 dilutions for 1.5 h at room temperature. Incubation of blocking peptides of BLT1 receptor and ChemR23 receptor (Cayman, Chemical, Ann Arbor, MI) and incubation with the absence of the primary antibody were used as negative controls.

2.5. RT-PCR

Cultured goblet cells were homogenized in TRIzol (Invitrogen, Carlsbad, CA) and total RNA was isolated. The total RNA was purified using TURBO DNA-free kit (Thermo Fisher, Waltham, MA). Five micrograms of purified total RNA were used for complementary DNA (cDNA) synthesis using the Superscript First-Strand Synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). The cDNA was amplified by the polymerase chain reaction (PCR) using primers specific to rat BLT1 or ChemR23 receptor using the Jumpstart REDTaq Readymix Reaction Mix (Sigma-Aldrich, St. Louis, MO) in a thermal cycler (Master Cycler, Eppendorf, Hauppauge, NY). Genome sequence was found in NCBI database (https://www.ncbi.nlm.nih.gov) and the primers were designed using primer blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) (BLT1 rat F: AATAGCTTTGTCGTGTGGAG R: GCTGGCATACATGCTTACT; ChemR23 rat F: TGGAGACAGAGAGCAGAGAA R: CCCAGGTTTCCGTGAAGAATA; BLT 1 human F: TGCGGAGT CAGCAT GT ACG R: ACAGGCTCATGTTCGTTTTCC; ChemR23 human F: CAGTTACGGTGATGAATACCCTG R: GACGATGCTGTAGACCACCAC). The conditions were as follows: 5 minutes at 95°C followed by 35 cycles of 1 minute at 94°C, 30 seconds at an annealing temperature of 39°C for BLT 1 (rat) and 61 °C for BLT 1 (human) and of 62°C for ChemR23 (rat and human), and 1 minute at 72°C with a final hold at 72°C for 10 minutes. Samples with no cDNA served as the negative control while the presence of β-actin was the positive control. Amplification products were separated by electrophoresis on a 1.5% agarose gel and visualized by ethidium bromide staining.

2.6. Western Blotting Analysis

Both rat and human goblet cells were lysed in radio-immunoprecipitation assay buffer (RIPA, 10 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1% deoxycholic acid, 1% Triton X-100, 0.1% sodium dodecyl sulfate, and 1 mM EDTA) in the presence of a protease inhibitor cocktail (Sigma-Aldrich). The homogenate was centrifuged at 2000 g for 30 min at 4° C. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and processed for western blotting analysis. Primary antibodies used were anti-BLT 1 and anti-ChemR23 (Cayman Chemical, Ann Arbor, MI), diluted at 1:100. THP-1 cells were used as the positive control and HEK239 cells as the negative control for both BLT1 [20] and ChemR23 receptors [21]. Immunoreactive bands were visualized by the enhanced chemiluminescence method. The films were analyzed with Image J software (U.S. National Institute of Health, Bethesda, MD; http://imagej.nih.gov; http://rsbweb.nih.gov/ij/).

2.7. Depletion of Proteins Using siRNA

First-passage goblet cells were grown in 6-well plates. Pre-designed siRNA specific to the BLT1 or ChemR23 receptors or scrambled siRNA (scsiRNA) (Dharmacon, Lafayette, CO) was added at a final concentration of 50 or 100nM in antibiotic-free RPMI 1640. Media was removed after 18 hours and replaced with fresh, complete RPMI 1640 and incubated for 48 hours before use. To ensure the successful depletion of receptors from the goblet cells, one well per condition was scraped, and Western blotting analysis using antibody against the receptor was performed as described above.

2.7. Measurement of High Molecular-weight Glycoprotein Secretion

First-passage, cultured goblet cells were plated in 24-well plates and grown to confluence. Cells were serum starved for 2h before use and stimulated with agonists for 2 hr in serum-free RPMI 1640 supplemented with 0.5% BSA. Goblet cell secretion was measured using an enzyme-linked lectin assay (ELLA) with the lectin UEA-I that detects rat conjunctival goblet cell high molecular weight glycoproteins including mucins. The media were collected and analyzed for the amount of lectin-detectable glycoproteins indicating goblet cell secretion, as described earlier [17]. Glycoprotein secretion was expressed as fold increase over basal that was set to 1.

2.8. Measurement of [Ca2+]i

First passage conjunctival goblet cells were plated onto 35-mm glass bottom culture dish and incubated at 37°C overnight. Cells were then incubated for 1 hour at 37°C with KRB-HEPES plus 0.5% bovine serum albumin containing 0.5 μM fura-2/AM (Invitrogen, Grand Island, NY, USA), 8 μM pluronic acid F127 (Sigma-Aldrich, St. Louis, MO, USA) and 250 μM sulfinpyrazone (Sigma-Aldrich) for 1h. Before calcium measurement, cells were washed by KRB-HEPES containing sulfinpyrazone. Calcium measurements were conducted using a ratio imaging system (In Cyt Im2; Intracellular Imaging, Cincinnati, OH, USA) using wavelengths of 340 and 380 nm and an emission wavelength of 505 nm. Cells were stimulated with agonists, antagonists, and inhibitors. The [Ca2+]i over time was displayed and the change in peak [Ca2+]i was calculated by subtracting the average of the basal value from the peak [Ca2+]i value.

2.9. Statistical Analysis

The data are presented as the fold-increase above basal as average ± SEM. Student’s t-test was used to perform statistical analysis and p < 0.05 was set as statistically significant.

2. Results

3.1. BLT1 and ChemR23 Receptors Are Present in both Rat and Human Conjunctival Goblet Cells

To determine the expression of BLT1 and ChemR23 receptors in conjunctival goblet cells, RT-PCR was performed in cultured rat goblet cells. Both BLT1 and ChemR23 receptor RNA are expressed at the expected sizes, 208bp and 548bp, respectively. (Fig 1A)

Fig 1. Identification of BLT1 and ChemR23 receptors in cultured rat conjunctival goblet cells and rat conjunctival epithelium.

Fig 1.

Fig 1.

Fig 1.

Fig 1.

RNA was isolated from cultured rat goblet cells and RT-PCR performed using primers for rat BLT1 or ChemR23 receptors and the standard control β-actin (A). L=molecular weight ladder. Protein was homogenized from cultured goblet cells and western blot performed using anti-bodies to BLT1 (B upper panel) and ChemR23 (B lower panel). Each lane indicates a separate animal. Immunofluorescence microscopy was performed on cultured goblet cells (C and D) using antibodies to BLT 1 (C) and ChemR23 (D). In C the left panel indicates immunofluorescence to BLT1 (red); the center panel to the directly conjugated lectin UEA-1 (goblet cell secretory product; green); and the right panel indicates an overlay of anti-BLT1, UEA-1, and DAPI (blue, indicates cell nuclei). In D the left panel indicates immunofluorescence to ChemR23 (red); the center panel to UEA-1 (green); the right panel indicates an overlay of anti-ChemR23, UEA-1, and DAPI (blue). Micrographs are representative of results from 3 rats. Anti-BLT1 antibody and anti-ChemR23 antibody were incubated with associated blocking peptide for overnight (E and F). In E the left panel indicates BLT1 immunofluorescence (Red) with DAPI (blue) and in F the left panel indicates the anti-BLT1 antibody pre-incubated with the BLT1 blocking peptide (red) and with DAPI (blue). In E the right panel indicates ChemR23 immunofluorescence (Red) and DAPI (blue) and in F the right panel indicates the anti-ChemR23 antibody pre-incubated with the ChemR23 blocking peptide (red) and DAPI (blue). In G the top left panel indicates anti-BLT1 immunoreactivity in epithelial sections, top middle panel indicates overlay of BLT1 immunoreactivity (red), UEA-1 (green, indicates secretory granules), and DAPI. The inset and top right panel indicates a higher magnification image (1000×). In the bottom left panel in E indicates the isotype control for BLT1. The bottom right panel in E indicates an overlay of UEA-1 fluorescence (green) and DAPI (blue). Magnification 400×.

Western blot analysis was conducted on homogenized cultured rat conjunctival goblet cells using antibodies specific to these receptors to determine the presence of BLT1 and ChemR23 protein. In cultured rat conjunctival goblet cells, the BLT1 receptor appeared as a single band at 50kDa and the ChemR23 receptor appeared as a single band at 45kDa (Fig 1B).

Rat conjunctival goblet cells grown on coverslips were analyzed by immunofluorescence microscopy. BLT1 receptor immunoreactivity was present as a fine punctate pattern throughout the cytoplasm (Fig 1C) of the majority of cultured rat goblet cells. ChemR23 receptor immunoreactivity was observed as a punctate pattern smoothly distributed in the cytoplasm and in larger groups surrounding the nucleus (Fig 1D). Incubation with the isotype control antibody showed no apparent immunoreactivity (Supplementary Figure 1). Receptor immunoreactivity was present in goblet cells as the goblet cells secretory granules were indicated by staining with UEA-1. Anti-receptor antibody and UEA-1 indicated co-staining of the goblet cells and that goblet cells contained each receptor (Figs 1 C and D). Blocking peptides of the BLT1 receptor and ChemR23 receptor were incubated overnight with corresponding antibody at a ratio of 5:1. In contrast to cells incubated with antibody alone, no immunoreactivity was observed on cells incubated with the combination of blocking peptide and antibody (Fig 1E and F).

We previously demonstrated that ChemR23 was present in conjunctival goblet and stratified squamous cells in sections of conjunctiva [8]. To show the localization of BLT1 receptors in rat conjunctival tissue, sections of rat conjunctiva were incubated with anti-BLT1 receptor antibodies (Fig 1G top left). To indicate the location of goblet cells within the epithelium, sections were also incubated with the lectin UEA-1 that stains goblet cell secretory granules. Green immunoreactivity shows the location of the secretory granules in the apical portion of clusters of goblet cells (Fig 1G top center). A higher magnification micrograph is shown in Fig 1G top right. The goblet cell nuclei are subjacent to the green labeling. The basal membranes of the goblet cells extend down to the basement membrane. The stratified squamous cells surround the goblet cells. BLT1 receptor immunoreactivity appeared in the cytoplasm and plasma membranes of both cell types throughout the entire section. Incubation with the isotype control antibody showed no apparent immunoreactivity (Fig 1G bottom left). Fig 1 G (bottom center) indicates the localization of the secretory granules of the goblet cells in green and cell nuclei in blue.

RT-PCR was also performed in cultured human goblet cells. Both BLT1 and ChemR23 receptor RNA were expressed at the expected sizes 214 and 115 bp, respectively (Fig 2A). Western blot analysis was also conducted on homogenized cultured human conjunctival goblet cells to determine the presence of BLT1 and ChemR23 protein. The BLT1 receptor appeared as a single band at 38kDa and the ChemR23 receptor appeared as a single band at 49kDa (Fig 2B top blots). Both of these receptors were detected in THP-1 cells, the positive control., but not in HEK239 cells, the negative control (Fig 2B bottom blots).

Fig 2. Identification of BLT1 and ChemR23 receptors in cultured human goblet cells.

Fig 2.

Fig 2.

Fig 2.

RNA was isolated from cultured human goblet cells and RT-PCR performed using primers for human BLT1 and ChemR23 receptors and the standard control β-actin (A). L= molecular weight ladder. Protein was homogenized from cultured goblet cells and western blot performed using antibodies to BLT1 (B left upper panel) and ChemR23 (B right upper panel). Homogenized THP1 cells were the positive control and HEK cells the negative control for BLT1 (B left lower panel) and ChemR23 (right lower panel). In B each lane indicates a separate individual. In C the left panel indicates immunofluorescence to BLT1 (red); the center panel indicates the directly conjugated lectin HPA that indicates goblet cell secretory product (green); the right panel indicates an overlay of anti-BLT1, HPA, and DAPI (blue, indicates cell nuclei). In D the left panel indicates immunofluorescence to ChemR23 (red); the center panel to HPA (green); and the right panel indicates an overlay of anti-ChemR23, HPA, and DAPI (blue). Anti-BLT1 antibody and anti-ChemR23 antibody were incubated with associated blocking peptide overnight (E and F). In E the left panel indicates BLT1 immunofluorescence (Red) with DAPI (blue) and in F the left panel indicates the anti-BLT1 antibody pre-incubated with BLT1 blocking peptide (red) and DAPI (blue). In E the right panel indicates ChemR23 immunofluorescence (red) and DAPI (blue) and in F the right panel indicates the anti-ChemR23 antibody pre-incubated with ChemR23 blocking peptide and DAPI (blue). Micrographs are representative of results from 3 individuals. Magnification 400×.

Fluorescence microscopy was also conducted on cultured human cells using the lectin HPA that stains the goblet cell secretory granules to identify the goblet cells. BLT1 receptor immunoreactivity was present as fine punctate pattern evenly distributed throughout the cytoplasm (Fig 2C left panel). The ChemR23 receptor immunoreactivity was observed as a punctate pattern smoothly distributed in the cytoplasm and in larger groups surrounding the nucleus (Fig 2D left panel). The presence of HPA immunoreactivity in Fig 2C and D center panels indicated that the cells were goblet cells. Co-staining each receptor in the goblet cells was illustrated in Fig 2 C and D right panels and showed that the goblet cells contained both receptors, ChemR23 and BLT1. Blocking peptides of BLT1 receptor and ChemR23 receptor were incubated overnight with corresponding antibody at a ratio of 5:1. In contrast to cells incubated with antibody alone, no immunoreactivity was observed on cells incubated with the combination of blocking peptide and antibody (Fig 2E and F).

3.2. Both RvE1 and LTB4 Use the BLT1 Receptor to Stimulate Goblet Cell Function in Culture

To determine the effect of LTB4 [Ca2+]i, cultured rat conjunctival goblet cells were stimulated with LTB4 10‒10 M, 10‒9 M and 10‒8 M. LTB4 (10‒10 - 10‒8 M) significantly increased [Ca2+]i compared to basal by 211.7±26.9 nM, 426.8±97.6 nM and 645.4±104.6 nM respectively (p<0.0009, 0.008, 0.002, respectively). (Supplementary Figure 2) LTB4 and RvE1 both stimulate the BLT1 receptor on polymorphonuclear leukocytes [14]. Previously we observed that RvE1 stimulates secretion from goblet cells by increasing [Ca2+]i [14]. In the present study we determined if RvE1 stimulates the BLT1 receptor in addition to the ChemR23 receptor by measuring changes in [Ca2+]i to indicate cellular activation of the goblet cells. To determine if RvE1 utilizes the BLT1 receptor to activate goblet cells, rat cells were incubated with the BLT1 and 2 inhibitor LY293111 (10−7 and 10−6 M) 30 min before adding RvE1 (10−8 M) or LTB4 (10−8 M), the positive control. The application of RvE1 (10−8 M) increased the [Ca2+]i level in a time and concentration dependent fashion (Fig 3A) with a peak increase of 117.8 ± 20.2 nM that was significantly higher than basal (p= 0.002) (Fig 3C). Incubation with LY293111 at 10−7 and 10−6 M significantly blocked the [Ca2+]i increase induced by RvE1 (p= 0.01, 0.006 respectively). LTB4 (10−8 M) increased [Ca2+]i over time with a peak increase of 244.0 ± 60.6 nM that was significantly higher than basal (p=0.01) (Fig 3B and C). Both concentrations of LY293111 (10−7 and 10−6 M) significantly blocked the [Ca2+]i increase induced by LTB4 (p=0.04 and 0.03 respectively) (Fig 3C).

Fig 3. RvE1 triggered [Ca2+]i increase can be blocked by BLT receptor inhibitor LY293111 in both rat and human conjunctival goblet cells.

Fig 3.

Fig 3.

Cultured rat or human goblet cells were incubated with vehicle or LY293111 (10−7 M and 10−6 M) for 30 min prior to addition of RvE1 at 10−8 M (A and C) or LTB4 at 10−8 M (B and C) in rat cells and RvE1 at 10−8 M (D and F) or LTB4 at 10−8 M (E and F) in human cells and [Ca2+]i was measured by fura2. The average [Ca2+]i level over time was shown in (A and B for rat; and D and E for human cells); Change in peak [Ca2+]i was calculated and shown in (C and F). Data are mean ± SEM from 6 rats and 5 humans. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #Indicates significance difference from RvE1 or LTB4 alone.

Similar results were obtained with cultured human goblet cells. RvE1 (10−8 M) increased the [Ca2+]i level over time (Fig 3D) with a peak increase of 433.7±91.0 nM that was significantly higher than basal (p=0.005) (Fig 3F). Incubation with LY293111 at 10−7 and 10−6 M significantly blocked the [Ca2+]i increase induced by RvE1 (p=0.02 and 0.01 respectively). The positive control LTB4 (10−8 M) increased [Ca2+]i over time with a peak increase of 407.4 ± 46.8 nM that was significantly higher than basal (p<0.001) (Fig 3E). Both concentrations of LY293111 (10−7 and 10−6 M) significantly blocked the [Ca2+]i increase induced by LTB4 (p=0.002 and 0.004 respectively) (Fig 3F).

The BLT1 specific inhibitor U75302 was then used to confirm our findings with LY293111. U75302 10−6 M was applied to cultured rat goblet cells 30 min before adding RvE1 (10−8 M) or LTB4 (10−8 M). In rat goblet cells, U75302 significantly decreased the RvE1-stimulated response to 49.11±4.43nM (p=0.02, Fig 4A and B). As a positive control, LTB4 response was significantly decreased to 78.5±21.4 nM (p=0.04, Fig 4A and B). In cultured human goblet cells, U75302 10−6 M significantly decreased the RvE1-induced [Ca2+]i increase to 52.79±15.80 nM (p=0.03, Fig 4C and D). As a positive control, LTB4-induced [Ca2+]i was significantly decreased by U75302 incubation to 59.60±8.47nM (p=0.02, Fig 4C and D). These results indicate that RvE1, similarly to LTB4, uses the BLT1 receptor to induce an increase in the [Ca2+]i in both rat and human goblet cells.

Fig 4. RvE1 triggered [Ca2+]i increase can be blocked by BLT1 receptor inhibitor U75302 in both rat and human conjunctival goblet cells.

Fig 4.

Fig 4.

Cultured rat or human goblet cells were incubated with vehicle or U75302 (10−6 M) for 30 min prior to addition of RvE1 at 10−8 M or LTB4 at 10−8 M (A and B rat cells and C and D human cells) and [Ca2+]i was measured by fura2. The average [Ca2+]i level over time was shown in (A and C). Change in peak [Ca2+]i was calculated and shown in (B and D). Data are mean ± SEM from 6 rats or 5 humans. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #Indicates significance difference from RvE1 or LTB4 alone.

3.3. RvE1 Uses Both the BLT1 and ChemR23 Receptors to Stimulate Goblet Cell Function in Culture

To determine if both BLT1 and ChemR23 receptors were used by RvE1, we used siRNA to knock down the expression of these receptors in cultured rat goblet cells. Two concentrations of siRNA were used for each receptor: 50 nM and 100 nM. The amount of inhibition of BLT1 or ChemR23 receptor expression was determined by Western blot analysis. BLT1 siRNA (50 nM and 100 nM) knocked down the BLT1 receptor by 12.7±9.5% and 44.0±4.4 % (p=0.0001) compared to the amount under non-transfected conditions (Fig 5A). Likewise, the ChemR23 receptor was knocked down by 30.7±19.4% by ChemR23 siRNA (50nM), and 64.0±11.2% (p=0.008) using 100 nM ChemR23 siRNA (Fig 5A). In Fig 5B the change in [Ca2+]i over time and the peak change was measured after siRNA knockdown. The addition of RvE1 (10−8 M) significantly increased the peak [Ca2+]i to 916.3±40.4 nM (p=0.0001) in non-transfected cells and to 1164.7±293.4nM (p=0.0007) in cells transfected with scrambled siRNA (Fig 5C). Both concentrations of BLT1 siRNA significantly blocked the [Ca2+]i increase induced by RvE1 by 80.0±14.9 and 86.9±6.6% respectively (p=0.002 for 50 nM, p=0.0001 for 100 nM). Both concentrations of ChemR23 siRNA also significantly blocked the [Ca2+]i increase induced by RvE1 by 86.7±4.7 and 92.5±2.6% respectively (p<0.0001 for 50nM, p<0.0001 for 100nM) (Fig 5B and C).

Fig 5. Depletion of BLT1 or ChemR23 blocked the RvE1 triggered [Ca2+]i increase in rat conjunctival goblet cells.

Fig 5.

Fig 5.

Cultured rat goblet cells were transfected with BLT1 and ChemR23 siRNA at 50 or 100 nM, scrambled siRNA (scsiRNA), or not transfected (NT). Western blot analysis of cells treated with scsiRNA or siRNA knockdown of BLT1 (upper panel) or ChemR23 (lower panel) receptor was shown in (A). RvE1 at 10−8 M was added and average [Ca2+]i over time was shown in (B). The change in peak [Ca2+]i was calculated and shown in (C). RvE1 was added and the glycoprotein secretion was measured after a 2-hr incubation (D). Data are mean ± SEM from 4 rats each for [Ca2+]i measurement and secretion measurement. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #Indicates significance difference from non-transfected group.

We also investigated if RvE1 used both receptors to stimulate secretion. The addition of RvE1 (10−9 M) significantly increased high molecular weight glycoprotein secretion in non-transfected (p=0.0002) and scrambled siRNA transfected (p=0.0006) cultured goblet cells to 1.8 ± 0.1 and 1.5 ± 0.08 respectively (Fig 5D). Secretion stimulated by RvE1 was significantly blocked by 100nM BLT1 (p=0.001) or 100nM ChemR23 (p=0.01) siRNA transfection and was 1.1 ± 0.06 and 1.0 ± 0.2-fold increase above basal, respectively.

These data demonstrate that RvE1 uses both BLT1 and ChemR23 receptors to increase [Ca2+]i and stimulate secretion in rat goblet cells.

3.4. LTB4 Induced Goblet Cell Response Can Be Desensitized by RvE1 in Culture

To determine if LTB4 and RvE1 both activate the BLT1 receptor on cultured conjunctival goblet cells, desensitization type experiments were performed in which the first agonist was added followed 2 minutes later by a second agonist. The change in the peak [Ca2+]i was measured after the addition of each agonist. In rat conjunctival goblet cells when RvE1 was added first the Ca2+ response was an increase to 500.1 ± 134.1nM (p=0.03). With the second addition of RvE1 the [Ca2+]i was significantly decreased from the first addition (p=0.04; Fig 6B) illustrating that RvE1 desensitizes its own receptor. When LTB4 was added first, the RvE1 response 2 min after LTB4 was 56.0 ± 13.7 nM and was significantly decreased from the response when RvE1 was added first (Fig 6B). When LTB4 (10−8 M) was added first, the [Ca2+]i increased to 574.5±110.8 nM. When LTB4 was added second this response was significantly decreased from the first one (574.5± 110.8 nM, p=0.005) (Fig 6A and B). This is a control to demonstrate than LTB4 desensitizes its own receptor. When RvE1 (10−8 M) was added first followed by LTB4, the LTB4 response was decreased from LTB4 alone to 88.3 ± 29.1 nM (p=0.02) (Fig 6A). These results are consistent with RvE1 and LTB4 activating the same receptor.

Fig 6. RvE1 and LTB4 activate a common receptor in rat and human conjunctival goblet cells.

Fig 6.

Fig 6.

Rat (A and B) or human (C and D) cells were stimulated with RvE1 at 10−8 M or LTB4 at 10−8 M alone followed by RvE1 or LTB4 after 2 min. Average [Ca2+]i over time was shown in time was shown in (A and C). The change in peak [Ca2+]i was calculated and shown in (B and D). Data are mean ± SEM from 4 rats and 5 humans. Arrows indicate the addition of the first and second stimuli. *Indicates significance difference from basal. #Indicates significance difference from adding stimuli alone.

In human cultured goblet cells, RvE1 (10−8 M) alone induced the [Ca2+]i increase to 391.1±114.4nM (p=0.009). When RvE1 (10−8 M) was added 2 min after RvE1, the second RvE1 response was significantly desensitized (p=0.03, Fig 6C and D). When LTB4 was added first followed by RvE1, the second RvE1 was also significantly desensitized (p=0.04, Fig 6C and D). LTB4 used alone increased the [Ca2+]i by 364.0±82.2 nM (p=0.006). When LTB4 was added 2 min after the first LTB4, the response was significantly desensitized to 49.6±13.7 nM (p=0.02, Fig 6C and D). When RvE1 was added first followed by LTB4, the second LTB4 response was significantly decreased to 43.0±22.6 nM (p=0.01, Fig 6C and D). In both rat and human goblet cells, RvE1 and LTB4 activate the same receptor and desensitize each other’s [Ca2+]i response. The receptors used are BLT1 and ChemR23.

In order to eliminate the possibility of calcium store depletion caused by the first agonist inhibiting the response to the second agonist, RvE1 and LTB4 were added at the same time and [Ca2+]i level was measured in cultured rat goblet cells. RvE1 alone significantly increased the [Ca2+]i by 117.8±58.9nM (p=0.001) and LTB4 alone significantly increased the [Ca2+]i by 244.0±122.0nM (p=0.005). When RvE1 and LTB4 were added together, the response was significantly decreased to 52.6±26.3nM (p=0.04) (Fig 7A and B). These results show that in both rat and human conjunctival goblet cells RvE1 and LTB4 desensitize each other’s intracellular Ca2+ response at the receptor level rather than by depleting intracellular Ca2+ stores.

Fig 7. Activation of a common receptor rather than depletion of Ca2+i accounted for the effect of RvE1 and LTB4 added simultaneously to rat conjunctival goblet cells.

Fig 7.

Fig 7.

Rat cells were stimulated with RvE1 (10−8 M) or LTB4 (10−8 M) alone, or RvE1 and LTB4 added together. The average [Ca2+]i level over time was shown in (A); change in peak [Ca2+]i was calculated and shown in (B). RvE1 (10−8 M) or LTB4 (10−8 M) alone or a mixture of RvE1 and LTB4 together was added and the glycoprotein secretion was measured after a 2-hr incubation (C). Data are mean ± SEM from 6 rats for calcium experiments and 4 rats for secretion experiments. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #indicates significance difference from adding stimuli alone.

We also investigated if LTB4 and RvE1 used the same signaling pathways to stimulate secretion by adding RvE1 and LTB4 alone compared to adding them together. The addition of RvE1 (10−8 M) and LTB4 (10−8 M) significantly increased glycoprotein secretion to 1.61 ± 0.12 and 1.63 ± 0.15-fold over basal (p=0.001 and 0.006 respectively). Secretion stimulated by RvE1 and LTB4 added together was 1.31 ± 0.19-fold over basal and was significantly decreased from the theoretical amount of secretion when either RvE1 and LTB4 were added separately, theoretical additivity (p=0.01). These secretion results were consistent with the results from calcium experiments. Thus, RvE1 and LTB4 each use a common receptor the BLT1 receptor. As a final experiment we insured that neither LTB4 nor RvE1 use the ALX/FPR2 receptor in goblet cells by using siRNA targeting ALX/FPR2. ALX/FPR2 siRNA did not block the peak [Ca2+]i response of either RvE1 (p=0.06) or LTB4 (p=0.1), but blocked the RvD1 response (p=0.01). These results indicate that neither LTB4 nor RvE1 uses the ALX/FPR2 receptor to stimulate goblet cells. (Supplementary Fig 3)

3. Discussion

We show that in both rat and human cultured conjunctival goblet cells, the pro-resolution mediator RvE1 uses the ChemR23 receptor to stimulate an increase in the [Ca2+]i and the [Ca2+]i increase stimulated by RvE1 directly triggers secretion [14]. In human and rat goblet cells RvE1 also activates another receptor, the LTB4 receptor BLT1 (Fig 8), an interaction that also occurs in human polymorphonuclear leukocytes (PMN) [17]. In the present study, RvE1 application two min before or simultaneously with LTB4 attenuated the LTB4 induced increases in [Ca2+]i suggesting that RvE1 acts as an agonist for the BLT1 receptor in these epithelial cells. That simultaneous addition of RvE1 and LTB4 give an inhibitory response suggests that RvE1 directly interacts with BLT1. As in cultured cells RvE1 activates both the ChemR23 receptor and the BLT1 receptor, this SPM could potentially block the actions of LTB4 either indirectly by an intracellular inhibitory effect mediated by interaction with ChemR23 or directly by interacting with BLT1 preventing activation of this receptor by LTB4.

Fig 8. Schematic of the activation of BLT1 and ChemR23 receptors by LTB4 and RvE1.

Fig 8.

LTB4 activates BLT1 receptor in the basal membrane leading to the increase of [Ca2+]i and secretion of high molecular weight glycoprotein across the apical membrane into tears. The activation of BLT1 receptor by LTB4 is blocked by the BLT inhibitor LY293111, the BLT1 receptor U75302, and BLT1 siRNA. RvE1 activates ChemR23 receptor in the basal membrane as well as BLT 1 receptor leading to the increase of [Ca2+]i and secretion of high molecular weight glycoprotein across the apical membrane into the tears. The RvE1-ChemR23 signal is blocked by ChemR23 siRNA.

BLT1 is a unique G protein coupled receptor. Instead of cysteine residues at the C-terminal tail it has a helical domain (helix 8 motif) in the intracellular domain which is responsible for BLT1 inactivation upon LTB4 binding [23]. The rat BLT1 receptor has 80.2% homology to human BLT1, and 93.2% homology to mouse BLT1 receptor [24].The major signaling pathway for LTB4 is Bordetella pertussis toxin (PTX)-sensitive Gi/o like pathway leading to the activation of phospholipase (PL) C and release inositol trisphosphate (IP3) to increase [Ca2+]i as described in human promyelocytic-leukaemia cell line HL60 [24, 25]. Subunits of Gq class have also been found associated with the BLT1 receptor. The IP3 production induced by the Gq class subunits cannot be blocked by PTX, and both PTX-sensitive and PTX-resistant pathways can be activated concomitantly [24]. In the current study, the increase in [Ca2+]i was used as the primary response to indicate goblet cell stimulation as the intracellular Ca2+ chelator BAPTA blocks RvE1 stimulated secretion in vitro [14]. Secretion was measured in select cases to demonstrate that the Ca2+ and secretory responses were similarly stimulated.

The ChemR23 receptor is also a Gi/o coupled receptor, which inhibits adenylyl cyclase, increases [Ca2+]i and activates p44/p42 MAPK (ERK1/2) [26]. There is a 79% similarity in the ChemR23 sequence between human and rat [27]. In our earlier studies the signaling pathway induced by RvE1 in cultured goblet cells was profiled. RvE1 activated PLC, PLD and PLA2, each of which increases [Ca2+]i to stimulate goblet cell secretion [14]. However, the receptor(s) activating these intracellular signaling pathways were not explored at that time. In the present study, we detected the presence of BLT1 and ChemR23 receptors in rat and human conjunctival goblet cells in culture and for rat in epithelial tissue. The inhibition of either BLT1 or ChemR23 receptor significantly attenuated the RvE1-induced [Ca2+]i increase and secretion indicating that RvE1 uses both receptors to stimulate conjunctival goblet cell function in vitro (Fig 8).

As the BLT1 receptor is activated by the pro-inflammatory mediator LTB4 to increase the [Ca2+]i, it is counter intuitive that this receptor is also stimulated by an SPM. We hypothesize that the actions of RvE1 and its temporal relationship with LTs on goblet cell secretion is context dependent. Conjunctival goblet cells secrete mucin to lubricate and moisturize the ocular surface during health. so RvE1 could act as a regulator to maintain the normal mucin layer. This hypothesis is supported by the finding that RvE1 precursor 18-HEPE in non-diseased human tears [15]. In addition, we have obtained as yet unpublished results suggesting that RvE1 is present in human conjunctival tissues isolated from cadavers (Unpublished data 2019). However, during inflammation when high concentrations of LTB4 are produced by invading leukocytes or possibly local epithelium cells, LTB4 may activate the BLT1 receptor causing overproduction of goblet cell secretion. In this scenario, shown in cultured cells, RvE1 would bind to ChemR23, but not BLT1. RvE1 binding to ChemR23 counter regulates LTB4 activation of Ca2+ and secretion using the BLT1 receptor bringing goblet cell secretion back to normal levels (manuscript in preparation). Our findings, together with the unpublished data, suggest that RvE1 plays a role in both homeostais and inflammation, but a more definitive study is needed to establish this regulatory pathway in the eye. A similar context dependent phenomenon was reported in lymphocytes: under normal, healthy conditions the lymphocytes biosynthesize resolvins, while during inflammation, the enzyme switches towards synthesis of leukotrienes [28].

In the present study we found that neither RvE1 nor LTB4 uses the lipoxin A4 receptor (ALX/FPR2). The ALX/FPR2 receptor has multiple agonists, including both lipids such as LXA4 and RvD1 and a protein annexin A1 [19, 29]. All three of these types of agonists activate the ALX/FPR2 in rat conjunctival goblet cells [19]. ChemR23 also has multiple ligands, both RvE1 and chemerin, but chemerin does not induce [Ca2+]i increase in cultured goblet cells [8].

The presence and action of the multiple ligands interacting with multiple receptors in the conjunctiva is consistent with the important protective role that goblet cell secretion plays in the conjunctiva and the neighboring cornea.

LTB4 binds to the G protein coupled receptors BLT1 and BLT2 [27]. Even though the BLT2 receptor is 45.2% structurally similar to the BLT1 receptor, the activation of BLT2 interacts with different signaling components than BLT1. The BLT2 receptor is coupled to Gi proteins, and is activated by LTB4, 12(S)-hydroxyheptadeca-5Z,8E,10E-trienoic acid (12-HHT) and 12-Hydroxyeicosatetraenoic acid (12(S)-HETE). In the present study using cultured cells, we eliminated the function and possible interaction of LTB4 with the BLT2 receptor by using the BLT1 selective inhibitor U75302 that blocked the effect of both LTB4 and RvE1 on the goblet cell response. In the present study it is unlikely that LTB4 activated the BLT2 receptor as the affinity of LTB4 binding to BLT2 is low [30], and the use of the BLT 1 selective inhibitor U75302 and BLT1 siRNA completely blocked the LTB4 effect.

In culture rat conjunctival goblet cells extensively resemble human conjunctival goblet cells. We demonstrated that the pro-inflammatory mediator LTD4 stimulates mucin secretion in both human and rat goblet cells, and the action of LTD4 can be blocked by RvD1 in both species [8]. We also observed that human and rat goblet cells are similar in their RvD1, aspirin-triggered RvD1 and histamine induced [Ca2+]i increase [21]. In this study we found that human and rat goblet cells are similar in the presence of both ChemR23 and BLT1, RvE1 and LTB4 induced [Ca2+]i increases, and all other actions studied herein. Hence, cultured rat goblet cells are an accurate and useful model for cultured human goblet cells.

In conclusion, in vitro RvE1 stimulates conjunctival goblet cells to increase [Ca2+]i and secretion via both the BLT1 receptor and its own receptor ChemR23. When activated by RvE1 these two receptors interact causing a decrease in response that can attenuate the effect of the pro-inflammatory mediator. Thus, the BLT1 receptor is an intersection in the action of the pro-inflammatory mediator LTB4 and the SPM RvE1 and provides a new target for developing treatments for ocular surface inflammation.

Supplementary Material

1

Supplemental Figure 1: Incubation of isotype control antibody for immunofluorescence microscopy on rat (top left panel) and human (bottom left panel) cultured goblet cells. The overlay of control and UEA-I or HPA which bind to secretory product in rat and human cells respectively (green) and DAPI (blue) were shown in the right panels.

Supplemental Figure 2: LTB4 stimulated [Ca2+]i increase in conjunctival goblet cells. LTB4 10−10M, 10−9M and 10−8M was added to fura 2 loaded conjunctival goblet cells. The increase of [Ca2+]i was measured and the change in peak [Ca2+]i was shown. Data are mean ± SEM from 5 rats. *Indicates significance difference from basal.

Supplemental Figure 3: Depletion of the ALX/FPR2 receptor did not block the RvE1 or LTB4 stimulated [Ca2+]i increase. Cultured rat goblet cells were transfected with ALX/FPR2 siRNA or scrambled siRNA (scsiRNA) or not transfected (NT). RvE1 at 10−8 M (A and D), LTB4 at 10−8 M (B and D), or RvD1 at 10−8 M (C and D) was added. The average [Ca2+]i level over time was shown in (A, B, and C). RvD1 served as a positive control (C). The change in peak [Ca2+]i was calculated and shown in (D). Data are mean ± SEM from 5 rats. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #Indicates significance difference from non-transfected.

Acknowledgments

We thank Dr. Marie Shatos for advice on conjunctiva and conjunctival goblet cell morphology.

This work was supported by NIH RO1EY019470 (DAD) and NIH PO1GM095467 (CNS).

Footnotes

Disclosure: The authors have no interests to disclose.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Gipson IK. Goblet cells of the conjunctiva: A review of recent findings. Prog Retin Eye Res. 2016;54:49–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hirakata T, Lee HC, Ohba M, Saeki K, Okuno T, Murakami A, et al. Dietary omega-3 fatty acids alter the lipid mediator profile and alleviate allergic conjunctivitis without modulating Th2 immune responses. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2019;33(3):3392–403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hodges RR, Dartt DA. Tear film mucins: front line defenders of the ocular surface; comparison with airway and gastrointestinal tract mucins. Exp Eye Research. 2013;117:62–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gipson IK, Spurr-Michaud S, Argueso P, Tisdale A, Ng TF, Russo CL. Mucin gene expression in immortalized human corneal-limbal and conjunctival epithelial cell lines. Invest Ophthalmol Vis Sci. 2003;44(6):2496–506. [DOI] [PubMed] [Google Scholar]
  • 5.Pelikan Z Inflammatory mediator profiles in tears accompanying keratoconjunctival responses induced by nasal allergy. Br J Ophthalmol. 2013;97(7):820–8. [DOI] [PubMed] [Google Scholar]
  • 6.Newsholme SJ, Griswold DE, Schwartz L. Conjunctival leukocyte infiltration evoked by leukotrienes: differing responses among rodent species. J Lipid Mediators Cell Signalling. 1994;9(3):197–203. [PubMed] [Google Scholar]
  • 7.Saban DR, Hodges RR, Mathew R, Reyes NJ, Yu C, Kaye R, et al. Resolvin D1 treatment on goblet cell mucin and immune responses in the chronic allergic eye disease (AED) model. Mucosal Immunol. 2019;12(1):145–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Dartt DA, Hodges RR, Li D, Shatos MA, Lashkari K, Serhan CN. Conjunctival goblet cell secretion stimulated by leukotrienes is reduced by resolvins D1 and E1 to promote resolution of inflammation. Journal Immunol. 2011;186(7):4455–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hodges RR, Li D, Shatos MA, Serhan CN, Dartt DA. Lipoxin A4 Counter-regulates Histamine-stimulated Glycoconjugate Secretion in Conjunctival Goblet Cells. Sci Rep. 2016;6:36124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fredman G, Oh SF, Ayilavarapu S, Hasturk H, Serhan CN, Van Dyke TE. Impaired phagocytosis in localized aggressive periodontitis: rescue by Resolvin E1. PloS One. 2011;6(9):e24422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Serhan CN, Chiang N. Resolution phase lipid mediators of inflammation: agonists of resolution. Curr Opin Pharmacol. 2013;13(4):632–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Oh SF, Pillai PS, Recchiuti A, Yang R, Serhan CN. Pro-resolving actions and stereoselective biosynthesis of 18S E-series resolvins in human leukocytes and murine inflammation. The Journal of clinical investigation. 2011;121(2):569–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Oh SF, Vickery TW, Serhan CN. Chiral lipidomics of E-series resolvins: aspirin and the biosynthesis of novel mediators. Biochimica et biophysica acta. 2011;1811(11):737–47. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Lippestad M, Hodges RR, Utheim TP, Serhan CN, Dartt DA. Signaling pathways activated by resolvin E1 to stimulate mucin secretion and increase intracellular Ca(2) + in cultured rat conjunctival goblet cells. Exp Eye Res. 2018;173:64–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.English JT, Norris PC, Hodges RR, Dartt DA, Serhan CN. Identification and Profiling of Specialized Pro-Resolving Mediators in Human Tears by Lipid Mediator Metabolomics. Prostag Leukotr ESS. 2017;117:17–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.de Paiva CS, Schwartz CE, Gjorstrup P, Pflugfelder SC. Resolvin E1 (RX-10001) reduces corneal epithelial barrier disruption and protects against goblet cell loss in a murine model of dry eye. Cornea. 2012;31(11):1299–303. [DOI] [PubMed] [Google Scholar]
  • 17.Arita M, Ohira T, Sun YP, Elangovan S, Chiang N, Serhan CN. Resolvin E1 selectively interacts with leukotriene B4 receptor BLT1 and ChemR23 to regulate inflammation. J Immunol. 2007;178(6):3912–7. [DOI] [PubMed] [Google Scholar]
  • 18.Lippestad M, Hodges RR, Utheim TP, Serhan CN, Dartt DA. Resolvin D1 Increases Mucin Secretion in Cultured Rat Conjunctival Goblet Cells via Multiple Signaling Pathways. Invest Ophthalmol Vis Sci. 2017;58(11):4530–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hodges RR, Li D, Shatos MA, Bair JA, Lippestad M, Serhan CN, et al. Lipoxin A4 activates ALX/FPR2 receptor to regulate conjunctival goblet cell secretion. Mucosal Immunol. 2017;10(1):46–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Li D, Carozza RB, Shatos MA, Hodges RR, Dartt DA. Effect of histamine on Ca(2+)-dependent signaling pathways in rat conjunctival goblet cells. Invest OphthalmolVis Sci. 2012;53(11):6928–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Li D, Hodges RR, Jiao J, Carozza RB, Shatos MA, Chiang N, et al. Resolvin D1 and aspirin-triggered resolvin D1 regulate histamine-stimulated conjunctival goblet cell secretion. Mucosal Immunol. 2013;6(6):1119–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Contreras-Ruiz L, Mir FA, Turpie B, Krauss AH, Masli S. Sjogren’s syndrome associated dry eye in a mouse model is ameliorated by topical application of integrin alpha4 antagonist GW559090. Experimental eye research. 2016;143:1–8. [DOI] [PubMed] [Google Scholar]
  • 23.Saeki K, Yokomizo T. Identification, signaling, and functions of LTB4 receptors. Semin Immunol. 2017;33:30–6. [DOI] [PubMed] [Google Scholar]
  • 24.Gaudreau R, Le Gouill C, Metaoui S, Lemire S, Stankova J, Rola-Pleszczynski M. Signalling through the leukotriene B4 receptor involves both alphai and alpha16, but not alphaq or alpha11 G-protein subunits. Biochem J. 1998;335 ( Pt 1):15–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Andersson T, Schlegel W, Monod A, Krause KH, Stendahl O, Lew DP. Leukotriene B4 stimulation of phagocytes results in the formation of inositol 1,4,5-trisphosphate. A second messenger for Ca2+ mobilization. Biochem J. 1986;240(2):333–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Berg V, Sveinbjornsson B, Bendiksen S, Brox J, Meknas K, Figenschau Y. Human articular chondrocytes express ChemR23 and chemerin; ChemR23 promotes inflammatory signalling upon binding the ligand chemerin(21–157). Arthritis Res Ther. 2010;12(6):R228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yokomizo T, Kato K, Terawaki K, Izumi T, Shimizu T. A second leukotriene B(4) receptor, BLT2. A new therapeutic target in inflammation and immunological disorders. Journal Exp Med. 2000;192(3):421–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Liu T, Xiang A, Peng T, Doran AC, Tracey KJ, Barnes BJ, et al. HMGB1-C1q complexes regulate macrophage function by switching between leukotriene and specialized proresolving mediator biosynthesis. Proc Natl Acad Sci U S A. 2019;116(46):23254–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Perretti M, Chiang N, La M, Fierro IM, Marullo S, Getting SJ, et al. Endogenous lipid- and peptide-derived anti-inflammatory pathways generated with glucocorticoid and aspirin treatment activate the lipoxin A4 receptor. Nature Med. 2002;8(11):1296–302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Watanabe M, Machida K, Inoue H. A turn on and a turn off: BLT1 and BLT2 mechanisms in the lung. Expert Rev Resp Med. 2014;8(4):381–3. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Supplemental Figure 1: Incubation of isotype control antibody for immunofluorescence microscopy on rat (top left panel) and human (bottom left panel) cultured goblet cells. The overlay of control and UEA-I or HPA which bind to secretory product in rat and human cells respectively (green) and DAPI (blue) were shown in the right panels.

Supplemental Figure 2: LTB4 stimulated [Ca2+]i increase in conjunctival goblet cells. LTB4 10−10M, 10−9M and 10−8M was added to fura 2 loaded conjunctival goblet cells. The increase of [Ca2+]i was measured and the change in peak [Ca2+]i was shown. Data are mean ± SEM from 5 rats. *Indicates significance difference from basal.

Supplemental Figure 3: Depletion of the ALX/FPR2 receptor did not block the RvE1 or LTB4 stimulated [Ca2+]i increase. Cultured rat goblet cells were transfected with ALX/FPR2 siRNA or scrambled siRNA (scsiRNA) or not transfected (NT). RvE1 at 10−8 M (A and D), LTB4 at 10−8 M (B and D), or RvD1 at 10−8 M (C and D) was added. The average [Ca2+]i level over time was shown in (A, B, and C). RvD1 served as a positive control (C). The change in peak [Ca2+]i was calculated and shown in (D). Data are mean ± SEM from 5 rats. Arrow indicates the addition of stimuli. *Indicates significance difference from basal. #Indicates significance difference from non-transfected.

RESOURCES