Abstract
We isolated a total of 653 strains from 64 community environmental samples in Massachusetts, USA. Among these isolates, 9.65 % (63 strains) were benzalkonium chloride (BC)-resistant staphylococci. All BC-resistant strains were collected from surfaces upon which antibacterial wipes or antibacterial sprays containing 0.02–0.12 % BC had frequently been used in the fitness centres. However, isolates from surfaces upon which antibacterial wipes or antibacterial sprays had not been used were all sensitive to BC. All BC-resistant strains were also resistant to erythromycin, penicillin and ampicillin. In addition, 51 strains showed resistance to cetyltrimethylammonium bromide (CTAB), 15 strains showed resistance to chloramphenicol, 12 strains showed resistance to ciprofloxacin and four strains showed resistance to meticillin. Resistance gene analysis demonstrated that 41 strains contained qacA/B, 30 strains had qacC, 25 strains contained qacG, 16 strains had qacH and eight strains contained qacJ. These data indicate that application of BC is associated with environmental staphylococcal antimicrobial resistance.
Introduction
Meticillin-resistant Staphylococcus aureus (MRSA) and coagulase-negative staphylococci (CoNS), such as Staphylococcus epidermidis, S. caprae and S. haemolyticus are important human pathogens causing skin, soft tissue, respiratory, bone and joint infections (Huebner & Goldmann, 1999; Kampf & Kramer, 2004; Heikens et al., 2005; Noguchi et al., 2005). According to a Centers for Disease Control and Prevention report, annual mortality in the USA from MRSA infections is around 20 000. Additionally, community-associated MRSA has been increasing recently (Wang et al., 2004; King et al., 2006). From 2000 to 2009, the rate of skin infections among children who required hospitalization increased from about 4.5 to 9.4 cases per 10 000 of the population, and most of these cases occurred in the community (King et al., 2006). So far, little is known regarding the distribution of MRSA and antibiotic-resistant CoNS in our community environment. Thus, detecting antibiotic-resistant staphylococci and their resistance mechanisms in this environment is important to help stop the spread of antibiotic-resistant staphylococci.
Benzalkonium chloride (BC) and cetyltrimethylammonium bromide (CTAB) are active components of the commonly used quaternary ammonium compounds (QACs) (McDonnell & Russell, 1999; Correa et al., 2008; Liu et al., 2009). QACs are widely used as disinfectants and antiseptics for control of bacterial growth in households and healthcare settings (Alam et al., 2003; Noguchi et al., 2005; Egusa et al., 2008). Low-dose, long-term and widely used BC in disinfectant solutions, soaps, hand sanitizers, etc. may confer selective pressures and thus contribute to the emergence of BC- and antibiotic-resistant micro-organisms (McDonnell & Russell, 1999; To et al., 2002; Aiello & Larson, 2003; Wang et al., 2004; Bjorland et al., 2005; Liu et al., 2009; McCay et al., 2010). Some staphylococci contain plasmids and transporters that are associated with resistance to BC, quinolones and other antibiotics (Fournier et al., 2000; Schmitz et al., 2000; Bjorland et al., 2001, 2005; Sidhu et al., 2002; Noguchi et al., 2005; Wang et al., 2007; Correa et al., 2008; Guillard et al., 2010). Furthermore, plasmid-containing staphylococci may donate resistance genes to more-virulent staphylococci and other bacteria (Aiello & Larson, 2003; Bjorland et al., 2003; Wang et al., 2004; Correa et al., 2008). Staphylococcal resistance to QACs is known in hospitals and has been reported from the food industry (Bjorland et al., 2003, 2005; Noguchi et al., 2005; Correa et al., 2008). Six different QAC resistance genes have been characterized: qacA/B, qacC (smr), qacG, qacH and qacJ (Yoshida et al., 1990; Bjorland et al., 2003, 2005; Noguchi et al., 2005; Truong-Bolduc et al., 2005; Correa et al., 2008). The genes qacC (smr), qacG and qacH encode membrane transporters of the small multidrug resistance (SMR) family (Alam et al., 2003; He et al., 2004; Liu et al., 2009; McCay et al., 2010; Pagedar et al., 2011). SMR family transporters confer multidrug resistance in many resistant bacteria (Alam et al., 2003; Bjorland et al., 2003). Thus, understanding the distribution of BC resistance genes in staphylococci isolated from the community environment is important for tracking the expansion of antibiotic-resistant staphylococci. Here, we report on the isolation, identification and detection of BC resistance genes from BC-resistant staphylococci that were isolated from the community environment.
Methods
Bacterial isolation and identification.
A total of 64 samples from surfaces of weight machines, exercise bikes, dumbbells, boxercise gloves, refrigerator door handles, toilet handles, television remote controls and bathroom sink handles were collected using sterile cotton saline-swabs. These samples were collected trimonthly from four fitness centres and two school dormitories in Massachusetts, USA, during 2008. To our knowledge, antibacterial wipes or antibacterial sprays containing 0.02–0.12 % BC were used very frequently for removing germs in weight machines, exercise bikes, dumbbells and boxercise gloves but were not used on other surfaces of the fitness centres and school dormitories. Each cotton swab sample was kept in a test tube with 2 ml saline solution on ice and transported to the laboratory within 2 h. After each sample had been vortexed and concentrated by centrifugation at 5000 r.p.m. for 5 min, the pellets were suspended in 100 µl saline solution. Each suspension was spread onto a mannitol salt agar (MSA) plate. All of these operations were performed aseptically. Bacterial isolation was performed under aerobic conditions at 37 °C for 48 h. The screening of BC-resistant strains was carried out using Mueller–Hinton agar (Sigma) plates containing 3 µg BC ml−1 according to the method reported by Bjorland et al. (2003, 2005). Strain type determination was carried out biochemically and using 16S rRNA gene sequencing (Heikens et al., 2005; Jones et al., 2006; Li et al., 2006; Chaieb et al., 2007; Kugelman et al., 2009). The 16S rRNA genes for all of the BC-resistant staphylococci were sequenced. The biochemical tests included those for catalase, coagulase and fermentation sensitivity. Coagulase plasma was from PRO-LAB. The remaining reagents were from Sigma. The primers for 16S rRNA gene sequencing were from Fisher (Table 1). DNA sequencing was performed using an ABI 3700 DNA analyser (Applied Biosystems). To confirm the sequencing results, 20 PCR fragments of 16S rRNA genes were resequenced by MiSeq System.
Table 1.
Primers used in this study
Primers were designed according to the work of Bjorland et al. (2001, 2005) and Correa et al. (2008) with minor modifications. F, forward primer; R, reverse primer.
| Gene or region | Sequence (5′→3′) | Product size (bp) | GenBank accession no. |
| qacA/B | F: ATTCCATTGAGTGCCTTTGC | ||
| qacA/B | R: TGGCCCTTTCTTTAGGGTTT | 198 | X56628 |
| qacC | F: GGCTTTTCAAAATTTATACCATCCT | ||
| qacC | R: ATGCGATGTTCCGAAAATGT | 249 | Z37964 |
| qacG | F: TCACTTACGCAACATGGGCA | ||
| qacG | R: TCAATGGCTTTCTCCAAATAC | 155 | Y16944 |
| qacH | F: CAAGTTGGGCAGGTTTAGGA | ||
| qacH | R: TGTGATGATCCGAATGTGTTT | 141 | Y16945 |
| qacJ | F: AATCGGATCCATAAAAAGCCCCCAGTTTG | ||
| qacJ | R: TCAGTCGACGAGCTCGAATTCTTAATGACT | 667 | AJ512814 |
| rpoB* | F: AAAGAGAAGAATGAATGAACTT | ||
| rpoB | R: ATCGTTTGAACGCCACTCTT | 540 | X64172 |
| 16S rRNA† | F: GCAAGCGTTATCCGGATTT | ||
| 16S rRNA | R: CTTAATGATGGCAACTAAGC | 1082 | D83356 |
rpoB is a housekeeping gene.
The 16S rRNA gene was used for strain identification.
Susceptibility tests.
The susceptibilities of BC-resistant strains were studied by determining MICs using the Kirby–Bauer (Table 2) and broth microdilution methods (Table 3), as recommended by Bjorland et al. (2005) and the Clinical and Laboratory Standards Institute (CLSI, 2006), respectively. The antibiotic discs for the Kirby–Bauer tests were from BD. S. aureus ATCC 25923 was used as a quality-control strain.
Table 2.
Susceptibilities of 63 community environmental isolates of BC-resistant staphylococci
Antibiotic breakpoint interpretations and MICs were determined using the Kirby–Bauer method according to the CLSI (2006). Susceptibility to BC was determined from MIC values (µg ml−1) as follows: resistant (R), >3; sensitive (S), <2; intermediate (I), 2–3. Bold numbers indicate the strains that were confirmed by 16S rRNA gene sequencing. AM, ampicillin; BC, benzalkonium chloride; CIP, ciprofloxacin; CP, chloramphenicol; E, erythromycin; P, penicillin; ME, meticillin; VA, vancomycin; OX, oxacillin.
| Strain (isolate no.) | MIC (µg ml−1 or mm) breakpoint interpretation | ||||||||
| BC | CIP | CP | E | P | AM | ME | VA | OX | |
| S. aureus | |||||||||
| ATCC 25923* | S | S | S | S | S | S | S | S | S |
| 1 | R | S | S | R | R | R | S | S | S |
| 2 | R | S | S | R | R | R | S | S | S |
| 3 | R | R | R | R | R | R | R | S | R |
| 4 | R | S | S | R | R | R | S | S | S |
| 5 | R | S | S | R | R | R | S | S | S |
| 6 | R | S | S | R | R | R | S | S | S |
| 7 | R | S | S | R | R | R | S | S | S |
| 8 | R | S | S | R | R | R | S | S | S |
| 9 | R | R | R | R | R | R | R | S | R |
| 10 | R | S | S | R | R | R | S | S | S |
| 11 | R | I | R | R | R | R | S | S | S |
| S. epidermidis | |||||||||
| 12 | R | S | R | R | R | R | S | S | S |
| 13 | R | R | R | R | R | R | S | S | S |
| 14 | R | S | S | R | R | R | S | S | S |
| 15 | R | S | S | R | R | R | S | S | S |
| 16 | R | S | S | R | R | R | S | S | S |
| 17 | R | R | R | R | R | R | S | S | S |
| 18 | R | S | R | R | R | R | S | S | S |
| 19 | R | S | R | R | R | R | S | S | S |
| 20 | R | S | R | R | R | R | S | S | S |
| 21 | R | S | R | R | R | R | S | S | S |
| 22 | R | I | R | R | R | R | S | S | S |
| 23 | R | R | S | R | R | R | S | S | S |
| 24 | R | S | S | R | R | R | S | S | S |
| 25 | R | S | S | R | R | R | S | S | S |
| 26 | R | R | S | R | R | R | S | S | S |
| 27 | R | I | R | R | R | R | R | S | R |
| 28 | R | S | S | R | R | R | S | S | S |
| 29 | R | S | S | R | R | R | S | S | S |
| 30 | R | S | S | R | R | R | S | S | S |
| 31 | R | S | S | R | R | R | S | S | S |
| 32 | R | S | S | R | R | R | S | S | S |
| 33 | R | S | S | R | R | R | S | S | S |
| 34 | R | S | S | R | R | R | S | S | S |
| 35 | R | S | S | R | R | R | S | S | S |
| 36 | R | R | R | R | R | R | S | S | S |
| 37 | R | S | S | R | R | R | S | S | S |
| 38 | R | S | S | R | R | R | S | S | S |
| 39 | R | S | R | R | R | R | S | S | S |
| S. haemolyticus | |||||||||
| 40 | R | S | R | R | R | R | S | S | S |
| 41 | R | R | S | R | R | R | S | S | S |
| 42 | R | S | S | R | R | R | S | S | S |
| 43 | R | S | S | R | R | R | S | S | S |
| 44 | R | S | S | R | R | R | S | S | S |
| 45 | R | I | S | R | R | R | S | S | S |
| 46 | R | S | S | R | R | R | S | S | S |
| 47 | R | S | S | R | R | R | S | S | S |
| 48 | R | S | S | R | R | R | S | S | S |
| S. hominis | |||||||||
| 49 | R | S | I | R | R | R | S | S | S |
| 50 | R | S | S | R | R | R | S | S | S |
| 51 | R | R | S | R | R | R | R | S | I |
| 52 | R | S | S | R | R | R | S | S | S |
| 53 | R | S | S | R | R | R | S | S | S |
| 54 | R | I | S | R | R | R | S | S | S |
| S. warneri | |||||||||
| 55 | R | S | S | R | R | R | S | S | S |
| 56 | R | R | S | R | R | R | S | S | S |
| 57 | R | R | S | R | R | R | S | S | S |
| 58 | R | S | S | R | R | R | S | S | S |
| 59 | R | S | S | R | R | R | S | S | S |
| S. saprophyticus | |||||||||
| 60 | R | S | S | R | R | R | S | S | S |
| 61 | R | R | S | R | R | R | S | S | S |
| S. caprae | |||||||||
| 62 | R | S | S | R | R | R | S | S | S |
| S. simulans | |||||||||
| 63 | R | S | S | R | R | R | S | S | S |
S. aureus ATCC 25923 was used as a control.
Table 3.
Distribution of BC resistance genes in 63 community isolates of staphylococci
Susceptibility to CTAB was determined from MIC values (µg ml−1) as follows: resistant, ≥8; sensitive, ≤4; intermediate, 5–7. Susceptibility to BC was determined as described in Table 2.
| Strain (isolate no.) | Gene | MIC | ||||||
| qacA/B | qacC | qacG | qacH | qacJ | rpoB* | BC | CTAB | |
| S. aureus | ||||||||
| ATCC 25923† | − | − | − | − | − | + | 1 | 2 |
| 1 | + | + | − | − | + | + | 8 | 16 |
| 2 | − | + | + | + | − | + | 32 | 16 |
| 3 | − | + | − | − | + | + | 4 | 8 |
| 4 | − | + | − | − | − | + | 16 | 16 |
| 5 | − | − | − | − | − | + | 8 | 8 |
| 6 | + | + | − | − | + | + | 4 | 32 |
| 7 | − | − | − | − | − | + | 4 | 4 |
| 8 | + | + | + | + | − | + | 8 | 32 |
| 9 | − | − | + | − | − | + | 4 | 8 |
| 10 | + | − | + | + | − | + | 16 | 8 |
| 11 | + | + | + | − | − | + | 32 | 128 |
| S. epidermidis | ||||||||
| 12 | + | + | − | + | − | + | 16 | 64 |
| 13 | + | + | + | + | − | + | 32 | 128 |
| 14 | + | + | − | + | − | + | 16 | 16 |
| 15 | + | + | + | − | − | + | 8 | 16 |
| 16 | + | + | + | − | − | + | 8 | 16 |
| 17 | + | − | + | − | − | + | 8 | 8 |
| 18 | − | − | − | − | − | + | 4 | 4 |
| 19 | − | + | − | − | − | + | 4 | 4 |
| 20 | + | + | − | + | − | + | 8 | 8 |
| 21 | + | − | + | + | − | + | 8 | 16 |
| 22 | − | − | − | − | + | + | 4 | 4 |
| 23 | − | + | − | − | − | + | 4 | 8 |
| 24 | + | + | + | − | − | + | 8 | 32 |
| 25 | + | + | − | − | − | + | 8 | 8 |
| 26 | + | − | − | + | − | + | 8 | 8 |
| 27 | − | + | − | − | − | + | 4 | 8 |
| 28 | + | + | − | − | − | + | 8 | 16 |
| 29 | + | − | − | − | − | + | 4 | 4 |
| 30 | + | + | + | − | − | + | 8 | 16 |
| 31 | + | − | − | − | − | + | 8 | 16 |
| 32 | + | + | + | − | − | + | 8 | 8 |
| 33 | − | − | − | − | − | + | 4 | 4 |
| 34 | + | + | − | − | − | + | 4 | 8 |
| 35 | + | + | + | + | − | + | 32 | 64 |
| 36 | + | + | − | + | − | + | 16 | 128 |
| 37 | − | − | − | − | − | + | 4 | 4 |
| 38 | − | + | + | − | − | + | 8 | 16 |
| 39 | − | − | + | − | − | + | 4 | 4 |
| S. haemolyticus | ||||||||
| 40 | + | + | − | − | + | + | 8 | 64 |
| 41 | + | + | + | − | − | + | 8 | 16 |
| 42 | + | − | − | − | − | + | 8 | 32 |
| 43 | + | − | − | − | − | + | 16 | 16 |
| 44 | + | + | + | − | − | + | 32 | 128 |
| 45 | + | − | − | − | − | + | 16 | 32 |
| 46 | − | − | − | + | − | + | 4 | 16 |
| 47 | + | − | − | − | − | + | 8 | 16 |
| 48 | − | − | − | − | − | + | 4 | 8 |
| S. hominis | ||||||||
| 49 | − | − | + | − | − | + | 4 | 16 |
| 50 | − | − | + | − | + | + | 8 | 32 |
| 51 | + | − | − | − | − | + | 4 | 4 |
| 52 | − | − | − | − | − | + | 4 | 4 |
| 53 | − | − | + | + | − | + | 8 | 16 |
| 54 | + | + | + | − | − | + | 32 | 64 |
| S. warneri | ||||||||
| 55 | + | − | − | − | + | + | 16 | 16 |
| 56 | + | − | − | − | − | + | 4 | 4 |
| 57 | + | − | + | − | − | + | 32 | 64 |
| 58 | + | − | + | − | − | + | 16 | 32 |
| 59 | − | − | − | + | − | + | 8 | 8 |
| S. saprophyticus | ||||||||
| 60 | + | − | − | + | + | + | 16 | 32 |
| 61 | + | − | − | − | − | + | 4 | 8 |
| S. caprae | ||||||||
| 62 | + | + | − | − | − | + | 8 | 32 |
| S. simulans | ||||||||
| 63 | + | − | + | + | − | + | 32 | 128 |
rpoB is a housekeeping gene.
S. aureus ATCC 25923 was used as a negative control.
Detection of BC resistance genes.
In order to understand the distribution of qac genes in these isolates, we detected qacA/B, qacC, qacG, qacH and qacJ using a simplex real-time PCR with a minor modification (McDonnell & Russell, 1999; Heikens et al., 2005; Liu et al., 2009), a method used previously for detecting resistance-conferring genes (McDonnell & Russell, 1999; To et al., 2002; Theis et al., 2007). DNA was prepared using a Plasmid Mini kit (Qiagen) according to the manufacturer’s instructions. Real-time PCR was performed with an iQ5 real-time PCR detection system (Bio-Rad) using SYBR GreenER qPCR SuperMix for iCycler (Invitrogen) according to Li et al. (2006), McDonnell & Russell (1999) and Kugelman et al. (2009). A total volume of 25 µl 1× reaction mixture contained 12.5 µl SYBR GreenER qPCR SuperMix, 1 µl each primer (10 µM), 1 µl DNA (2.5 ng) and 14.5 µl deionized water. Amplicons were distinguished by melting-curve analysis and melting temperature values.
Results and Discussion
A total of 653 strains were isolated and replicated from MSA plates. Among these, 63 were BC-resistant Staphylococcus isolates. Of these, 28 were identified as S. epidermidis, 11 as S. aureus, nine as S. haemolyticus, six as S. hominis, five as S. warneri, two as S. saprophyticus, one as S. caprae and one as S. simulans.
The susceptibilities of the BC-resistant strains are shown in Table 2. All strains were resistant to BC, erythromycin, penicillin and ampicillin. In addition, 12 strains were resistant to ciprofloxacin, 15 were resistant to chloramphenicol, 51 were resistant to CTAB, 36 were resistant to ethidium bromide (data not shown) and 21 were resistant to tetracycline (data not shown).
The BC resistance gene distributions of the 63 strains are shown in Table 3. Among these strains, 41 contained qacA/B, 30 contained qacC, 25 contained qacG, 16 contained qacH and eight contained qacJ.
The BC resistance gene distribution and antibiotic resistance patterns demonstrated that qacC (smr), qacG and qacH were responsible for both BC and CTAB resistances (Bjorland et al., 2001, 2005; Noguchi et al., 2005). As qac genes encode the SMR family efflux pumps, these genes were thus expected to be indicators of multidrug-resistant staphylococci. The BC resistance mechanisms in five strains were not clearly understood. We assume that other unknown resistance mechanisms may contribute to BC resistance in these strains. According to our data, 17.4 % of the BC-resistant isolates were S. aureus and 65.1 % of the BC-resistant strains contained one or more qac genes.
To our knowledge, although clinical isolates of staphylococci have resistance patterns similar to community-isolated staphylococci, their BC resistance mechanisms are not very similar to each other (Yoshida et al., 1990; Sidhu et al., 2002). Also, the BC resistance mechanism of S. aureus isolated from patients with staphylococcal scalded skin syndrome and impetigo and S. aureus isolated from patients with other diseases are very different (Yoshida et al., 1990). Thus, we expect that environmentally isolated staphylococci have unknown BC resistance mechanisms. In addition, the BC resistance rate of the isolates from the surfaces that frequently used antibacterial gymnasium wipes or antibacterial sprays was 23.51 %, while the isolates from the surfaces that did not use antibacterial gymnasium wipes or antibacterial sprays were all sensitive to BC.
In summary, disinfectants and antiseptic products containing BC have a high potential to bring about BC-resistant staphylococci as well as multidrug-resistant staphylococci.
Acknowledgements
This work was supported by an Internal Research Grant from the University of Massachusetts Lowell (G. X. H.) and by grants (M. F. V.) from the National Center for Research Resources (5P20RR016480-12). We are grateful to Dr David Hooper (Massachusetts General Hospital, Boston, MA, USA) and Dr Michael Shiaris (University of Massachusetts Boston, Boston, MA, USA) for helpful comments. The views presented in this article do not necessarily reflect those of the US Food and Drug Administration.
Footnotes
Abbreviations: BC, benzalkonium chloride; CATB, cetyltrimethylammonium bromide; CoNS, coagulase-negative staphylococci; MRSA, meticillin-resistant Staphylococcus aureus; QAC, quaternary ammonium compound; SMR, small multidrug resistance.
References
- Aiello A. E., Larson E. Antibacterial cleaning and hygiene products as an emerging risk factor for antibiotic resistance in the community. Lancet Infect Dis. 2003;3:501–506. doi: 10.1016/S1473-3099(03)00723-0. [DOI] [PubMed] [Google Scholar]
- Alam M. M., Ishino M., Kobayashi N. Analysis of genomic diversity and evolution of the low-level antiseptic resistance gene smr in Staphylococcus aureus. Microb Drug Resist. 2003;9(Suppl. 1):S1–S7. doi: 10.1089/107662903322541838. [DOI] [PubMed] [Google Scholar]
- Bjorland J., Sunde M., Waage S. Plasmid-borne smr gene causes resistance to quaternary ammonium compounds in bovine Staphylococcus aureus. J Clin Microbiol. 2001;39:3999–4004. doi: 10.1128/JCM.39.11.3999-4004.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bjorland J., Steinum T., Kvitle B., Waage S., Sunde M., Heir E. Widespread distribution of disinfectant resistance genes among staphylococci of bovine and caprine origin in Norway. J Clin Microbiol. 2005;43:4363–4368. doi: 10.1128/JCM.43.9.4363-4368.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chaieb K., Zmantar T., Chehab O., Bouchami O., Ben Hasen A., Mahdouani K., Bakhrouf A. Antibiotic resistance genes detected by multiplex PCR assays in Staphylococcus epidermidis strains isolated from dialysis fluid and needles in a dialysis service. Jpn J Infect Dis. 2007;60:183–187. [PubMed] [Google Scholar]
- CLSI (2006).Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, 7th edn. Approved standard M7–A7. Wayne, PA: Clinical and Laboratory Standards Institute.
- Correa J. E., De Paulis A., Predari S., Sordelli D. O., Jeric P. E. First report of qacG, qacH and qacJ genes in Staphylococcus haemolyticus human clinical isolates. J Antimicrob Chemother. 2008;62:956–960. doi: 10.1093/jac/dkn327. [DOI] [PubMed] [Google Scholar]
- Egusa H., Watamoto T., Matsumoto T., Abe K., Kobayashi M., Akashi Y., Yatani H. Clinical evaluation of the efficacy of removing microorganisms to disinfect patient-derived dental impressions. Int J Prosthodont. 2008;21:531–538. [PubMed] [Google Scholar]
- Fournier B., Aras R., Hooper D. C. Expression of the multidrug resistance transporter NorA from Staphylococcus aureus is modified by a two-component regulatory system. J Bacteriol. 2000;182:664–671. doi: 10.1128/JB.182.3.664-671.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guillard T., Cavallo J. D., Cambau E., Duval V., Bajolet O., Brasme L., de Champs C., Vernet-Garnier V. [Real-time PCR for fast detection of plasmid-mediated qnr genes in extended spectrum β-lactamase producing Enterobacteriaceae] Pathol Biol (Paris) 2010;58:430–433. doi: 10.1016/j.patbio.2009.03.003. [in French] [DOI] [PubMed] [Google Scholar]
- He G.-X., Kuroda T., Mima T., Morita Y., Mizushima T., Tsuchiya T. An H+-coupled multidrug efflux pump, PmpM, a member of the MATE family of transporters, from Pseudomonas aeruginosa. J Bacteriol. 2004;186:262–265. doi: 10.1128/JB.186.1.262-265.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heikens E., Fleer A., Paauw A., Florijn A., Fluit A. C. Comparison of genotypic and phenotypic methods for species-level identification of clinical isolates of coagulase-negative staphylococci. J Clin Microbiol. 2005;43:2286–2290. doi: 10.1128/JCM.43.5.2286-2290.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Huebner J., Goldmann D. A. Coagulase-negative staphylococci: role as pathogens. Annu Rev Med. 1999;50:223–236. doi: 10.1146/annurev.med.50.1.223. [DOI] [PubMed] [Google Scholar]
- Jones C. H., Tuckman M., Howe A. Y. M., Orlowski M., Mullen S., Chan K., Bradford P. A. Diagnostic PCR analysis of the occurrence of methicillin and tetracycline resistance genes among Staphylococcus aureus isolates from phase 3 clinical trials of tigecycline for complicated skin and skin structure infections. Antimicrob Agents Chemother. 2006;50:505–510. doi: 10.1128/AAC.50.2.505-510.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kampf G., Kramer A. Epidemiologic background of hand hygiene and evaluation of the most important agents for scrubs and rubs. Clin Microbiol Rev. 2004;17:863–893. doi: 10.1128/CMR.17.4.863-893.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- King M. D., Humphrey B. J., Wang Y. F., Kourbatova E. V., Ray S. M., Blumberg H. M. Emergence of community-acquired methicillin-resistant Staphylococcus aureus USA 300 clone as the predominant cause of skin and soft-tissue infections. Ann Intern Med. 2006;144:309–317. doi: 10.7326/0003-4819-144-5-200603070-00005. [DOI] [PubMed] [Google Scholar]
- Kugelman G., Tapsall J. W., Goire N., Syrmis M. W., Limnios A., Lambert S. B., Nissen M. D., Sloots T. P., Whiley D. M. Simple, rapid, and inexpensive detection of Neisseria gonorrhoeae resistance mechanisms using heat-denatured isolates and SYBR green-based real-time PCR. Antimicrob Agents Chemother. 2009;53:4211–4216. doi: 10.1128/AAC.00385-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li W., Hartung J. S., Levy L. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J Microbiol Methods. 2006;66:104–115. doi: 10.1016/j.mimet.2005.10.018. [DOI] [PubMed] [Google Scholar]
- Liu Q., Liu M., Wu Q., Li C., Zhou T., Ni Y. Sensitivities to biocides and distribution of biocide resistance genes in quaternary ammonium compound tolerant Staphylococcus aureus isolated in a teaching hospital. Scand J Infect Dis. 2009;41:403–409. doi: 10.1080/00365540902856545. [DOI] [PubMed] [Google Scholar]
- McCay P. H., Ocampo-Sosa A. A., Fleming G. T. A. Effect of subinhibitory concentrations of benzalkonium chloride on the competitiveness of Pseudomonas aeruginosa grown in continuous culture. Microbiology. 2010;156:30–38. doi: 10.1099/mic.0.029751-0. [DOI] [PubMed] [Google Scholar]
- McDonnell G., Russell A. D. Antiseptics and disinfectants: activity, action, and resistance. Clin Microbiol Rev. 1999;12:147–179. doi: 10.1128/cmr.12.1.147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Noguchi N., Suwa J., Narui K., Sasatsu M., Ito T., Hiramatsu K., Song J.-H. Susceptibilities to antiseptic agents and distribution of antiseptic-resistance genes qacA/B and smr of methicillin-resistant Staphylococcus aureus isolated in Asia during 1998 and 1999. J Med Microbiol. 2005;54:557–565. doi: 10.1099/jmm.0.45902-0. [DOI] [PubMed] [Google Scholar]
- Pagedar A., Singh J., Batish V. K. Efflux mediated adaptive and cross resistance to ciprofloxacin and benzalkonium chloride in Pseudomonas aeruginosa of dairy origin. J Basic Microbiol. 2011;51:289–295. doi: 10.1002/jobm.201000292. [DOI] [PubMed] [Google Scholar]
- Schmitz F. J., Sadurski R., Kray A., Boos M., Geisel R., Köhrer K., Verhoef J., Fluit A. C. Prevalence of macrolide-resistance genes in Staphylococcus aureus and Enterococcus faecium isolates from 24 European university hospitals. J Antimicrob Chemother. 2000;45:891–894. doi: 10.1093/jac/45.6.891. [DOI] [PubMed] [Google Scholar]
- Sidhu M. S., Heir E., Leegaard T., Wiger K., Holck A. Frequency of disinfectant resistance genes and genetic linkage with β-lactamase transposon Tn552 among clinical staphylococci. Antimicrob Agents Chemother. 2002;46:2797–2803. doi: 10.1128/AAC.46.9.2797-2803.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Theis T., Skurray R. A., Brown M. H. Identification of suitable internal controls to study expression of a Staphylococcus aureus multidrug resistance system by quantitative real-time PCR. J Microbiol Methods. 2007;70:355–362. doi: 10.1016/j.mimet.2007.05.011. [DOI] [PubMed] [Google Scholar]
- To M. S., Favrin S., Romanova N., Griffiths M. W. Postadaptational resistance to benzalkonium chloride and subsequent physicochemical modifications of Listeria monocytogenes. Appl Environ Microbiol. 2002;68:5258–5264. doi: 10.1128/AEM.68.11.5258-5264.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Truong-Bolduc Q. C., Dunman P. M., Strahilevitz J., Projan S. J., Hooper D. C. MgrA is a multiple regulator of two new efflux pumps in Staphylococcus aureus. J Bacteriol. 2005;187:2395–2405. doi: 10.1128/JB.187.7.2395-2405.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang C.-C., Lo W.-T., Chu M.-L., Siu L. K. Epidemiological typing of community-acquired methicillin-resistant Staphylococcus aureus isolates from children in Taiwan. Clin Infect Dis. 2004;39:481–487. doi: 10.1086/422642. [DOI] [PubMed] [Google Scholar]
- Wang J.-T., Fang C.-T., Chen Y.-C., Wu C.-L., Chen M.-L., Chang S.-C. Staphylococcal cassette chromosome mec in MRSA, Taiwan. Emerg Infect Dis. 2007;13:494–497. doi: 10.3201/eid1303.060247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yoshida H., Bogaki M., Nakamura S., Ubukata K., Konno M. Nucleotide sequence and characterization of the Staphylococcus aureus norA gene, which confers resistance to quinolones. J Bacteriol. 1990;172:6942–6949. doi: 10.1128/jb.172.12.6942-6949.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]