Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2020 Apr 26;295(25):8374–8386. doi: 10.1074/jbc.RA119.011917

The long noncoding RNA Arrl1 inhibits neurite outgrowth by functioning as a competing endogenous RNA during neuronal regeneration in rats

Dong Wang 1,‡, Yanping Chen 1,‡, Mingwen Liu 1,‡, Qianqian Cao 1, Qihui Wang 1, Shuoshuo Zhou 1, Yaxian Wang 1, Susu Mao 1, Xiaosong Gu 1,2, Zhenge Luo 3, Bin Yu 1,2,*
PMCID: PMC7307191  PMID: 32336677

Abstract

The intrinsic regeneration ability of neurons is a pivotal factor in the repair of peripheral nerve injury. Therefore, identifying the key modulators of nerve regeneration may help improve axon regeneration and functional recovery after injury. Unlike for classical transcription factors and regeneration-associated genes, the function of long noncoding RNAs (lncRNAs) in the regulation of neuronal regeneration remains mostly unknown. In this study, we used RNA-Seq–based transcriptome profiling to analyze the expression patterns of lncRNAs and mRNAs in rat dorsal root ganglion (DRG) following sciatic nerve injury. Analyses using the lncRNA-mRNA co-expression network, gene ontology enrichment, and Kyoto Encyclopedia of Genes and Genomes pathway databases indicated that the lncRNA Arrl1 decreases neurite outgrowth after neuronal injury. shRNA-mediated Arrl1 silencing increased axon regeneration both in vitro and in vivo and improved functional recovery of the sciatic nerve. Moreover, inhibiting an identified target gene of Arrl1, cyclin-dependent kinase inhibitor 2B (Cdkn2b), markedly promoted neurite outgrowth of DRG neurons. We also found that Arrl1 acts as a competing endogenous RNA that sponges a Cdkn2b repressor, microRNA-761 (miR-761), and thereby up-regulates Cdkn2b expression during neuron regeneration. We conclude that the lncRNA Arrl1 affects the intrinsic regeneration of DRG neurons by derepressing Cdkn2b expression. Our findings indicate a role for an lncRNA-microRNA-kinase pathway in the regulation of axon regeneration and functional recovery following peripheral nerve injury in rats.

Keywords: neuron; neurite outgrowth; neurite growth; long noncoding RNA (long ncRNA, lncRNA); regeneration; microRNA (miRNA); Arrl1; axon regeneration; competing endogenous RNA (ceRNA); long noncoding RNA; peripheral nerve injury; miR-761; cyclin-dependent kinase inhibitor 2B (Cdkn2b); RNA sponge; transcriptomics

Introduction

Peripheral nerve injury (PNI) is a common clinical issue due to the resulting dysfunction of sensory and motor nerves. Contrary to the central nervous system (CNS), which has poor regeneration ability, the peripheral nervous system (PNS) has a restricted regeneration power following the injury (1). The differential neuronal intrinsic regeneration ability and regenerative microenvironment are two major pivotal factors in axon regeneration and functional recovery (2, 3). The signal transduction and transcription response in the initiation of regeneration are well-understood, and many regeneration-associated genes (RAGs) are identified during the PNI (4). However, the molecular mechanisms of axon regeneration have focused mainly on transcriptional factors or RAGs; whether long noncoding RNAs (lncRNAs) have vital roles in this process remains largely unknown.

Genomic research has revealed that only 2% of genes encode coding RNA, whereas the others transcriptionally generate noncoding RNAs, especially lncRNAs, most of which until recently were still largely unknown (5). With the development of RNA-sequencing (RNA-Seq) technology, an increasing number of lncRNAs with a relatively low expression level have been identified to have crucial functions in many physiological and pathological processes (6–8). Previous studies have demonstrated that lncRNAs are involved in the occurrence of neurological disorders (9), such as Alzheimer's disease (10) and neuropathic pain (11). However, the role of lncRNAs in peripheral nerve injury repair remains to be investigated.

The transcriptome analyses based on the RNA-Seq and microarray have revealed the altered level of lncRNAs in the mouse and rat PNI models (12, 13). Our previous study indicated that the level of lncRNAs was changed following sciatic nerve injury (SNI) in rat (14, 15), and recent research has reported that lncRNAs impacted the neuronal outgrowth by regulating RAG expression (16). Nonetheless, the function of lncRNAs in PNI repair and the mechanism in axon regeneration are still little understood. In this study, we identified the co-expression regulation network between lncRNAs and mRNAs following PNI. Moreover, we determined the critical role of a new lncRNA, Arrl1, in axon regeneration and functional recovery of injured sciatic nerve. Finally, we explored the mechanism underlying the regulation of Arrl1 in neuronal intrinsic regeneration.

Results

The different expression profiles of lncRNAs and mRNAs following SNI

SNI is a common model for studying peripheral nerve regeneration. To characterize the transcriptome changes in peripheral nerve regeneration, we implemented RNA-Seq of DRG at different time points (0 h, 1 h, 3 h, 12 h, 1 day, 4 days, and 7 days) following SNI in rats. Then unsupervised cluster analysis was conducted to uncover the mRNA and lncRNA expression patterns. We identified 17 differentially expressed lncRNAs (Fig. 1A). Besides, we also identified 895 differentially expressed mRNAs (Fig. 1B), including RAGs: Atf3 (17), GAP43 (18), Sox11 (19), and Gadd45a (20), the detail data of differentially expressed lncRNAs and mRNAs was available in Table S1 in the supporting information. The expression changes of the differentially expressed lncRNAs (Fig. S1) and RAGs (Fig. S2) were validated by qRT-PCR. Next, we performed co-expression analysis of lncRNAs and mRNAs to search for the key regulators and found that nine of the differentially expressed lncRNAs were co-expressed or potentially interact with their target genes (Fig. 1C). Furthermore, gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that these differential co-expressed mRNAs were enriched in neuron development or axon regeneration–related processes (Fig. 1D), such as the Jak-STAT (21), cAMP (22), or mitogen-activated protein kinase signaling pathway (23, 24). The expression of candidate genes involved in those pathways were also validated by qRT-PCR (Fig. S2). According to the validated lncRNA expression patterns and lncRNA feature analysis with the coding potential and ORF prediction analysis (Fig. S3), we chose lncRNA NONRATT032301.1, which was named as axon regeneration–related lncRNA 1 (Arrl1), for further study.

Figure 1.

Figure 1.

The transcriptome sequence and bioinformatic analysis of the rat DRG after sciatic nerve injury. A and B, identification of the significantly differentially expressed lncRNAs and mRNAs at 0 h, 1 h, 3 h, 12 h, 1 day, 4 days, and 7 days following sciatic nerve injury. The red rectangular frame in A indicated NONRATT032301.1. C, co-expression network of the differentially expressed lncRNAs-mRNAs in A and B. D, gene ontology and KEGG pathway analysis for differential co-expression genes from C.

Expression and distribution of Arrl1 in DRG neuron post-SNI

QRT-PCR results indicated that Arrl1 expression was dramatically decreased in rat DRG post-SNI (Fig. 2A). Fluorescent in situ hybridization (FISH) experiments further validated that the level of Arrl1 was reduced on days 1 and 4 following the SNI and mainly distributed in the cytoplasm (Fig. 2B). The analysis of the Arrl1 sequence in the UCSC Genome Browser (RRID:SCR_005780) showed that no overlapping annotated genes were identified, and Arrl1 was located on chromosome 17p12 (Fig. S3). To examine the Arrl1 distribution in DRG neuron, cytoplasmic and nuclear RNA was isolated and then analyzed by qRT-PCR. The result indicated that Arrl1 was mainly distributed in the cytoplasm (Fig. 2C). The predominantly cytoplasmic distribution of Arrl1 was further validated by a FISH experiment. Arrl1 was co-localized with Tuj1, a neuronal marker, in the cytoplasm (Fig. 2D).

Figure 2.

Figure 2.

Expression and distribution of Arrl1 in DRG neuron following sciatic nerve injury. A, mRNA level of Arrl1 expression in DRGs at the indicated time point after SNI. Values represent means ± S.D. (error bars) (n = 3). **, p < 0.01; ***, p < 0.001. B, fluorescence intensity of Arrl1 in DRGs at 0 day (D 0), 1 day (D 1), and 4 days (D 4) post-SNI. The DRG was fixed and subjected to a FISH assay with the indicated probe. Red, Arrl1; blue, nucleus; bar, 100 μm. C, the distributed proportion of Arrl1 in DRG neuron nucleus and cytoplasm in the absence of sciatic nerve injury. Cytoplasmic and nuclear RNAs from DRG neurons were isolated, and then the Arrl1 expression was analyzed by qRT-PCR. β-Actin was used as a positive control for cytoplasm-distributed genes, and U6 was used as a positive control for nucleus-distributed genes. Values represent means ± S.D. (n = 3). D, Arrl1 colocalizes with Tuj1 in the cytoplasm of DRG neurons in the absence of sciatic nerve injury. The DRG neurons were fixed and subjected to a FISH assay with the indicated antibody. Red, Arrl1; green, Tuj1 (a marker for neuron); blue, nucleus. Bar, 50 μm.

Inhibiting Arrl1 promotes neurite outgrowth in DRG neurons in vitro

To investigate the role of Arrl1 in axon regeneration in vitro, two Arrl1-specific shRNAs were used to disturb Arrl1 expression. DRG neurons infected with adeno-associated virus (AAV) containing Arrl1-specific shRNA (KD1 or KD2) exhibited a reduced level of Arrl1, compared with those infected with AAV containing negative control shRNA (NC) (Fig. 3A). The immunostaining of axons with Tuj1 indicated that knockdown of Arrl1 significantly promoted axon regeneration of DRG neurons in vitro (Fig. 3, B–D). As shown in Fig. 3C, two batches of Arrl1 knockdown increased the total length of axons by 107.1 ± 12.2% and 90.7 ± 25.1%, compared with the control, respectively. Moreover, the length of the longest neurite was also increased in DRG neurons infected with AAV containing Arrl1-specific shRNA (Fig. 3D). Collectively, these data suggested that Arrl1 has a negative role in the regrowth of DRG neuron in vitro.

Figure 3.

Figure 3.

Knockdown of Arrl1 increased the neurite outgrowth in vitro. A, expression of Arrl1 in DRG neurons infected with AAV containing negative control shRNA (NC), Arrl1-specific shRNA-1 AAV (KD1), or Arrl1-specific shRNA-2 AAV (KD2). The level of Arrl1 expression was detected by qRT-PCR using RNA isolated from the DRG neurons. B, immunostaining for Tuj1 in DRG neurons infected with the indicated AAV. Red, Tuj1 (a marker for neurons); bar, 100 μm. C and D, quantification of the total and maximum neurite length by normalization with the NC group in B. All of the data are shown as mean ± S.D. (error bars) (unpaired, two-tailed Student's t test; n = 3). *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Arrl1 regulates sciatic nerve regeneration and behavioral recovery

As Arrl1 knockdown promoted neurite outgrowth in DRG neurons in vitro, we further explored its role in sciatic nerve regeneration and behavioral recovery in vivo. First, we intrathecally injected rats with AAV containing Arrl1-specific or negative control shRNA. Arrl1-specific shRNA can knock down Arrl1 in DRG in vivo (Fig. S4). Then the rats infected with the virus were subjected to SNI surgery. Finally, we collected the injured sciatic nerve at 3 days post-surgery and used SCG10 to label regenerated axons (Fig. 4A). The regeneration ability of sciatic nerve was significant enhanced by Arrl1 knockdown (Fig. 4, A–C). To assess the function of Arrl1 on the behavioral recovery, behavioral assays in rats were performed to quantify the latency of heat– or mechanical force–induced response. The rats in the control and Arrl1-knockdown groups exhibited similar response latency in a mechanical force–evoked test at 7 days post-SNI, whereas the rats in the Arrl1-knockdown group presented a significantly better functional recovery at 10 and 18 days post-SNI, compared with those in the control group (Fig. 4D). However, in the assay of heat-induced response, the rats in Arrl1-knockdown group exhibited a moderate thermal sensory recovery at 7 days post-SNI, when compared with the control group (Fig. 4E). Taken together, these results demonstrated that Arrl1 knockdown promotes sciatic nerve regeneration and improves behavioral recovery.

Figure 4.

Figure 4.

Arrl1 knockdown promotes sciatic nerve regeneration and sensory recovery following PNI. A, immunostaining for SCG10 in sciatic nerves of rats infected with AAV containing related shRNA at 3 days post-SNI. NC, negative control shRNA; KD1, Arrl1-specific shRNA-1; KD2, Arrl1-specific shRNA-2. Red, SCG10 (a marker for regenerated sensory axon). The white dotted line in the left of the image represents the crush site, and the white triangle represents the leading edge of regenerated axon. Bar, 1000 μm. B, quantitation of the normalized SCG10 fluorescence intensity from the crush site toward the distal end. Values represent means ± S.D. (error bars) (unpaired, two-tailed Student's t test; n = 3). *, p < 0.05; **, p < 0.01. C, quantification of the maximum regenerated axon length from the injury site in A. Values represent means ± S.D. (unpaired, two-tailed Student's t test; n = 3 for each group). *, p < 0.05. D and E, assessment of mechanical and thermal sensory recovery of the indicated rats at different time points after SNL. Values represent mean ± S.D. (n = 5; *, p < 0.05; two-way analysis of variance).

miR-761 is the target molecule of Arrl1

lncRNAs were reported to participate in the development of diseases in different manners (25, 26), including the competing endogenous RNAs (ceRNA) mode (27). The target genes of Arrl1 were predicted by MRE enrichment analysis (28), and 61 candidate genes and related miRNAs were found. Meanwhile, RNA-Seq analysis was performed following the knockdown of Arrl1 in DRG neurons. Compared with the control group, 229 genes with 1.5-fold down-regulation in the Arrl1-knockdown group were selected to conduct GO analysis, which showed that most of those genes were involved in neuronal development or maturation. Then we obtained the overlap between the target genes predicted by MRE enrichment analysis and the down-regulated gene analyzed by RNA-Seq and constructed an Arrl1-regulating ceRNA network (Fig. 5A). Based on this, we selected three candidate target genes of Arrl1 (Cda, Cdkn2b, and Kcnh4) potentially involved in neurite outgrowth and four related miRNA (miR-1956-5p, miR-761, miR-25-3p, and miR-185-5p) (Fig. 5B). Cda and Cdkn2b, but not Kcnh4, were dramatically decreased following Arrl1 knockdown (Fig. 5C), and interfering Arrl1 significantly increased the miR-761 expression and moderately enhanced miR-185–5p and miR-25–3p expression, whereas it had no effect on miR-1956-5p expression (Fig. 5D). To further explore the direct relationship between Arrl1, related miRNAs, and target genes, we constructed WT and miRNA binding site–mutated Arrl1 (MUT1 and MUT2) luciferase plasmid and performed luciferase assays. The result demonstrated that miR-761 and miR-25-3p significantly reduced the luciferase activity of Arrl1 compared with control miRNA mimic (NC), but miR-185-5p or miR-1956-5p had no notable effect. However, the mutated form (MUT1 and MUT2) of miR-761 or miR-25-3p with the miRNA-binding sites mutated lost their suppressive effect on the luciferase activity, suggesting that the ability of miR-761 and miR-25-3p to regulate Arrl1 expression depends on them binding with Arrl1 (Fig. 5E). Together, these data suggested that miR-761 and miR-25-3p are the target microRNA of Arrl1.

Figure 5.

Figure 5.

miR-761 is the target molecular of Arrl1. A, construction of the potential Arrl1-regulating ceRNA network. B, align score between target genes and related miRNAs in the Arrl1-regulating ceRNA network. C and D, expression level of three target genes and four miRNAs in DRG neurons infected with AAV containing negative control shRNA (NC), Arrl1-specific shRNA-1 AAV (KD1), or Arrl1-specific shRNA-2 AAV (KD2). E, interaction analysis of the Arrl1 and three candidate miRNAs. The HEK293T cells were transfected with indicated Arrl1 and miRNA. Then the transfected cells were subjected to luciferase analysis. WT Arrl1, pmirGlo-Arrl1; MUT1, miR-761 binding sites–mutated Arrl1; MUT2, miR-25-3p binding sites–mutated Arrl1; NC, control miRNA mimic. F, interaction analysis of the Cdkn2b and miR-25-3p or miR-761. The HEK293T cells were transfected with the indicated Cdkn2b and miRNA. Then the transfected cells were subjected to luciferase analysis. MUT, 3′-UTR–mutated Cdkn2b; NC, control miRNA mimic. G, mRNA levels of Cdkn2b expression in DRG neurons transfected with control miRNA mimic (NC) or miR-761 mimic (miR-761). All of the data are shown as mean ± S.D. (error bars) (unpaired, two-tailed Student's t test; n = 3). *, p < 0.05; **, p < 0.01; N.S., nonsignificant.

As shown in Fig. 5B, Cdkn2b has a high align score with both Arrl1 and miR-761/miR-25-3p, and Arrl1 knockdown significantly increased the Cdkn2b expression, so we proposed Cdkn2b as the target gene of Arrl1 for subsequent study. We constructed the WT and 3′-UTR–mutated Cdkn2b (MUT) plasmid for luciferase assays. Compared with control miRNA mimic (NC), miR-761 significantly reduced the luciferase activity of Cdkn2b, whereas miR-25-3p had no significant effect (Fig. 5F). However, the miR-761 had no effect on 3′-UTR–mutated Cdkn2b (MUT), suggesting that miR-761 regulates Cdkn2b expression through binding with its 3′-UTR domain (Fig. 5F). Moreover, miR-761 also suppressed the Cdkn2b expression (Fig. 5G). Taken together, these data suggested that Cdkn2b is the direct downstream target gene of miR-761, and miR-761 is the target molecule of Arrl1. In brief, Arrl1 works as a sponge for miR-761 targeting Cdkn2b.

Arrl1 impacts axon regeneration through the Arrl1/miR-761/Cdkn2b axis in ceRNA mode

Because miR-761 is a key target molecule of Arrl1, we investigated the role of miR-761 in axon regeneration. We found that DRG neurons transfected with miR-761 exhibited marked increased axon outgrowth (Fig. 6A), with the total and maximum length of neurite increased by 136.5 ± 27.8% and 119.2 ± 8.4%, respectively (Fig. 6, B and C). This result suggests that miR-761 promotes axonal regeneration.

Figure 6.

Figure 6.

miR-761 and Cdkn2b regulates axon regeneration in vitro. A, immunostaining for Tuj1 in DRG neurons transfected with control miRNA mimic (NC) or miR-761 mimic (miR-761). Red, Tuj1; bar, 100 μm. B and C, quantification of neurite length by normalization with the NC group in A. D, protein level of Cdkn2b in DRG neurons transfected with negative control siRNA (NC), Cdkn2b-specific siRNA-1 (Si-1), or Cdkn2b-specific siRNA-2 (Si-2). Top, quantitative analysis of results of Western blotting. Bottom, results of Western blotting. E, immunostaining of Tuj1 in DRG neurons transfected with negative control siRNA (NC), Cdkn2b-specific siRNA-1(Si-1), or Cdkn2b-specific siRNA-2 (Si-2); bar, 100 μm. F and G, quantification of neurite length by normalization with the NC group in E. All of the data are shown as mean ± S.D. (error bars) (unpaired, two-tailed Student's t test; n = 3). *, p < 0.05; **, p < 0.01.

We next explored the function of Cdkn2b, a downstream target gene of miR-761, in axonal growth. The Cdkn2b-specific siRNA (Si-1 or Si-2) was transfected into DRG neurons to knock down the expression of Cdkn2b (Fig. 6D). DRG neurons with Cdkn2b down-regulation exhibited significant increase in the total and maximum length of neurite compared with the negative control (Fig. 6, E–G), indicating that Cdkn2b has a negative effect on axonal growth.

As the miR-761 is the target microRNA of Arrl1, we assumed that the suppressive activity of Arrl1 on axonal growth depends on miR-761. To test the hypothesis, we transfected DRG neurons with vehicle control AAV or with Arrl1-specific shRNA-2 AAV(KD2), KD2 and miR-761 inhibitor (miR-I), then performed the neurite outgrowth assay in vitro (Fig. 7A). As expected, the total and maximum length of neurites were all increased in Arrl1-knockdown cells (Fig. 7, A–C). However, inhibiting miR-761 in Arrl1-knockdown cells abrogated the promoting effect of Arrl1 knockdown on axon growth (Fig. 7, B and C), suggesting that Arrl1 regulates axonal growth through miR-761. To further test the hypothesis in vivo, the miR-761 inhibitor, miR-761 antagomir (miR-A), was injected into DRG following Arrl1 knockdown in vivo. The sciatic nerve regeneration analysis was performed at day 3 after sciatic nerve crush. Consistent with the in vitro study, Arrl1 knockdown in DRG improved the sciatic nerve regeneration, whereas miR-761 antagomir eliminated the promoting effect of Arrl1 knockdown on sciatic nerve regeneration (Fig. 7, D and E). This result further demonstrates that Arrl1-regulated axon regeneration depends on miR-761.

Figure 7.

Figure 7.

Arrl1 regulates axon regeneration through the ceRNA mode. A–C, effect of inhibiting miR-761 on neurite outgrowth in Arrl1-knockdown DRG neurons in vitro. The DRG neurons were infected with AAV containing negative control shRNA (NC) or Arrl1-specific shRNA-2 (KD2). Then the KD2-infected DRG neurons were further transfected with miR-761 inhibitor (miR-I). The neurite outgrowth of the DRG neurons was visualized by immunostaining of Tuj1 (A) and quantification of the total and maximum neurite length by normalization with the NC group in A (B and C). Red, Tuj1; bar, 100 μm. D–F, effect of inhibiting miR-761 on sciatic nerve regeneration in Arrl1-knockdown DRGs in vivo. The miR-761 inhibitor for in vivo application, miR-A, was transfected into DRGs by DRG injection following Arrl1 knockdown in vivo. Immunostaining for SCG10 in the regenerative sciatic nerve. Red, SCG10. The white dotted line in the left of the image represents the crush site, and the white triangle represents the leading edge of regenerated axon. Bar, 1000 μm (D). ImageJ was applied to quantify the normalized fluorescence intensity of SCG10 from the crush site toward the distal end (E), and quantification of the maximum regenerated axon length from the injury site in D (F). All of the data are shown as mean ± S.D. (error bars) (unpaired, two-tailed Student's t test; n = 3). *, p < 0.05; **, p < 0.01 between the NC and KD2 groups; #, p < 0.05; ##, p < 0.01 between the KD2 and KD2 + miR-A groups or KD2 + miR-I groups.

Collectively, these data demonstrate that Arrl1 works as a sponge for miR-761 targeting Cdkn2 and regulates axonal regeneration through the Arrl1/miR-761/Cdkn2b axis in a ceRNA mode following SNI in rats (Fig. 8).

Figure 8.

Figure 8.

Graphical demonstration for the mechanism underlying Arrl1-regulated axon regeneration post-SNI. The expression of Arrl1 is decreased following sciatic nerve injury, attenuating the sponge effect on miR-761 and leading to increased miR-761. Increased miR-761 negatively regulates the downstream target gene, Cdkn2b, which is an inhibitor in neurite outgrowth, thus promoting the initiation of axon regeneration.

Discussion

Despite the PNS having the intrinsic regeneration ability, severe PNI also induces axonal regeneration delay and a functional recovery barrier (29). Intrinsic regeneration ability is the main mechanism of nerve repair after injury (30), so it is necessary to deeply explore the mechanism of axon regeneration. Identifying novel regulators in axon regeneration could provide new potential targets for treating PNI. Here, we demonstrated that a novel long noncoding RNA, Arrl1, is decreased upon sciatic nerve injury and functions as a sponge molecule to regulate DRG axonal growth and sensory function recovery.

Previous reports mainly focused on illustrating the effects of transcriptional factors or cytoskeleton-associated genes (31), such as Atf3 (32) and Klf4 (33). Only a few studies demonstrated the action of lncRNAs in nerve injury and repair. lncRNA, a multifunctional factor, participates in transcriptional modulation and post-transcriptional modification (34). In the present study, the RNA-Seq analysis revealed the differential expression pattern of lncRNA and mRNA in DRG neurons following SNI. The lncRNA-mRNA co-expression analysis suggested an important role of lncRNAs in nerve injury repair. The functional analysis of mRNAs in the co-expression network indicates that the expression of mRNAs involved in axonal regeneration process might be regulated by some co-expressed lncRNAs. The differentially expressed lncRNAs following SNI might be involved in earlier repair of nerve injury. Exploring the function of differentially expressed lncRNAs might help to identify new therapeutic targets for neuroregeneration.

In this study, we identified Arrl1, which was decreased during SNI, as a pivotal negative regulator on axon regeneration. Suppressing Arrl1 expression in DRG neurons promoted the robust neurite outgrowth both in vitro and in vivo, suggesting that Arrl1 might be an intrinsic regeneration inhibitor in SNI. A recent study (16) has uncovered a conserved lncRNA, Silc1, which plays a positive role in regulating mice sciatic injury repair. Knocking out Silc1 impaired axon regeneration, but the gain function of Silc1 in axon regeneration was not uncovered (16). Our previous study identified another conserved lncRNA, uc.217, as a negative regulator in DRG neuron neurite outgrowth in vitro (14). Although we found a comparable increase in axon regeneration following Arrl1 knockdown, the effect of Arrl1 overexpression in neurite outgrowth remains to be determined.

The distribution of lncRNAs may be related to their functions. lncRNAs localized in the nucleus can act as cis-regulatory elements or trans-acting elements to regulate gene expression, chromatin state, or protein/RNA molecules (35, 36), whereas lncRNAs expressed in the cytoplasm can perform as a molecular sponge of miRNA and function in ceRNA mode (37). In this study, Arrl1 was mainly expressed in DRG's cytoplasm, and we proposed that a ceRNA-modulated mode may underlie the mechanism of Arrl1 regulating axon regeneration. Moreover, the following bioinformatic analysis and experimental verification identified Cdkn2b as the potential downstream gene of Arrl1, which was involved in axon regeneration moderation. Previous reports indicated that the dysregulated expression of Cdkn2b impacts neurite extension in retinal ganglion cell degeneration diseases (38). In the present work, we found that Cdkn2b knockdown dramatically increased the axon outgrowth in DRG neurons. Our result demonstrated that Cdkn2b is a new potential target gene in nerve repair post-PNL.

The function of lncRNAs has been widely reported; lncRNAs directly interact with DNA, RNA, and proteins or perform as an miRNA sponge. In our work, we found a significantly increased expression of miR-761 after knocking down Arrl1. miR-761 was first reported in the regulation of the mitochondrial network via affecting the mitochondrial fission factor (39). Previous research has illustrated that miR-761 is involved in tumorigenesis (40) and synaptic plasticity in hippocampal neurons (41). However, the role of miR-761 in axon regeneration is still unknown. In our study, the transfection of miR-761 significantly increased the axonal outgrowth. Meanwhile, overexpression of miR-761 reduced the Cdkn2b level, and the inhibitor of miR-761 eliminated the promoting effect of Arrl1 knockdown on axon outgrowth. Thus, we proposed that Arrl1 regulates peripheral nerve regeneration in a ceRNA mode. Collectively, we explored the downstream targets of Arrl1 and found that miR-761 is the target miRNA of Arrl1, whereas Cdkn2b is the downstream target of miR-761. Both miR-761 and Cdkn2b play pivotal roles in neurite outgrowth. Arrl1 regulates peripheral nerve damage repair through the Arrl1/miR-761/Cdkn2b axis, but the molecular mechanism of Arrl1 differential expression post-PNI remains to be further studied.

In conclusion, our study constructed the lncRNA-mRNA co-expression network following the peripheral nerve injury and identified a novel lncRNA, Arrl1, which can regulate the intrinsic regeneration ability of DRG neurons through sponging miR-761 to modulate Cdkn2b expression. Our finding provides a new mechanism of lncRNA in axon regeneration and functional recovery following peripheral nerve injury.

Experimental procedures

Animals

SPF degree male Sprague–Dawley (SD) rats (180–220 g) were provided by the Experiment Animal Center of Nantong University. All of the experimental procedures involving animals were conducted in accordance with institutional animal care guidelines and approved ethically by the Administration Committee of Experimental Animals, Jiangsu Province, China.

Sciatic nerve crush and sample preparation

Twenty-eight SD rats were randomly divided into seven groups, and a 2-cm incision was made in the skin at the left thigh perpendicular to the femur following the intraperitoneal injection of compound anesthetic (10 mg/kg body weight). The muscle tissue was bluntly dissected to expose sciatic nerves. Then the sciatic nerves were crushed at 1 cm proximal to the bifurcation of tibial and fibular nerves using the fine forceps three times at 54 newtons of force. The incision was sutured after surgery. The L4-L5 DRGs were collected at 0 h, 1 h, 3 h, 12 h, 1 day, 4 days, and 7 days following sciatic nerve injury.

RNA extraction and RNA-Seq analysis

Total RNAs were extracted by TRIzol regent (Invitrogen) following the manufacturer's instructions, and RNA-Seq analysis was performed by Shanghai Biotechnology Corp. The differential expression profiles of lncRNAs and mRNAs were determined by bioinformatics analysis as reported previously (42). In hierarchical clustering, the Z score was calculated from the expression of lncRNAs, and the Euclidean distance measure was used to compute the distance (dissimilarity) in lncRNA and the time. The gene co-expression network was built according to the normalized signal intensity of specific expression lncRNAs and mRNAs. GO and KEGG pathway enrichment analyses were performed to elucidate biological processes and signaling pathways associated with the correlated target genes of specific lncRNAs.

qRT-PCR

The cDNA samples were prepared by the Prime-Script RT reagent kit (TaKaRa, Dalian, China) according to the manufacturer's instructions, and qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa) on an ABI system (Applied Biosystems, Foster City, CA) according to standard protocols. The primers in Table 1 and Table S2 were used to validate candidate lncRNAs and genes, and the primers for target gene detection are presented in Table 2. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The primers in Table 2 are for Arrl1 distribution analysis. The relative expression of miR-185-5p, miR-761, miR-25-3p and miR-1956-5p was quantified by a commercial qRT-PCR primer set designed by RiboBio (Guangzhou, China) and normalized with the U6 expression level.

Table 1.

Primers for qRT-PCR validation of candidate lncRNAs

No. lncRNA Forward (5′–3′) Reverse (5′–3′) Size
bp
1 NONRATT032155.1 CTGCCAAGGTCAGAAGAGGG TCTGTAGCCAGTTTAATTCCACTTT 114
2 NONRATT032941.1 AACAACGAGCATCGAAGAGTTG ATTTCTCCGTGAGCTGCCTC 116
3 NONRATT033029.1 CCATCTCCGACTTCCTCGTG CAGCTCGAGTGACTGACAGG 185
4 NONRATT031542.1 CATAAGCACCCCAGCTCGAT AGTCCCTTGAGCCTTCTCCA 95
5 NONRATT031464.1 GAGCGCGTGCAGGTAAAGTA GAGCTGAGAGCCAGAAACCC 123
6 NONRATT032795.1 CCCGTGGGATGGAGCTAAAG CTGTTTGCTGGTCCCACTCT 147
7 NONRATT031482.1 GTCGATCTGCCTTCCCTGAA GGCATGTCTGAGCAGTGTAGT 91
8 NONRATT033484.1 TAGAACGGAGGAGGTACGGG CTCTCCCATTGAGCCCCTTG 187
9 NONRATT032644.1 AAAGAGCAGTGGTCGGGATT AGTTGTCCCAGCAAAGAGGT 85
10 NONRATT031980.1 GTGCCTCTTTGCCTTGGTTG AAACTCTTCCCAGCATCCCG 209
11 NONRATT032735.1 ATGGCCCCAAAAAGCCAAGT GGCCGGATGGTTAGCACTTT 163
12 NONRATT032301.1 CGCGGTGCAAATAGCTTACC ACCCAGCTTGAGCAAACAGT 97
13 ENSRNOT00000087471 AGGAAGGGCGATGTCTGAAG GGATAGCTGGCAACAAGGCA 223
14 ENSRNOT00000076322 TCTCCCTGGAACTTGCTGTG GTCAGACGTGGTGGCTTCTA 208
15 ENSRNOT00000077098 CTTCCAGGGCGATGTCTGAA CTCCACCTTAGTCTGGGTCCT 86
16 ENSRNOT00000080401 TGGAGCCCTGTGCTTTACCA GCCCGAGAAAATACCCATCCT 137
17 ENSRNOT00000076902 AGCCACATTCAGATCCGTCA CCCCACGGTGTGCTTTTTATG 249

Table 2.

Primers for qRT-PCR validation of Arrl1 distribution and target genes

Gene Forward (5′–3′) Reverse (5′–3′) Size
bp
GAPDH CCTTCATTGACCTCAACTACATG CTTCTCCATGGTGGTGAAGAC 215
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 94
β-Actin GTCACCAACTGGGACGAT GAGGCATACAGGGACAACA 209
Arrl1 CGCGGTGCAAATAGCTTACC ACCCAGCTTGAGCAAACAGT 97
Cda TGTCCTCTCGTGAAGCCAAG TCTACGTTGCACCCAGAGAAG 109
Kcnh4 TGCAGGCTGAACCAAGAGATT CAAGTGGAGTCAGGTGGGTG 128
Cdkn2b GACAGGTGGAGACGGTGC GCCCATCATCATGACCTGGA 98

Adult rat DRG neuron culture

DRG neurons were separated and maintained in vitro as reported previously (43). In detail, DRGs were dissociated sterilely and incubated with 0.25% trypsin (Invitrogen) for 10 min with intervals of trituration followed by 0.3% collagenase type I (Sigma) for 90 min at 37 °C. The supernatant was purified through 15% BSA and planted on the cell culture plate coated with poly-d-lysine and laminin (Sigma) in Neurobasal medium (Invitrogen) with B27 supplement.

AAV infection, siRNA and miRNA mimics, or inhibitor transfection

DRG neurons were replanted on the poly-d-lysine– and laminin–pretreated coverslips and incubated for 18 h after infection with AAV containing control or Arrl1-specific shRNAs for 5 days or transfection with the Cdkn2b siRNA and miR-761 mimic or inhibitor for 48 h. The targeting site of Arrl1-specific shRNAs and Cdkn2b siRNAs was present in Table 3.

Table 3.

Interference sequences designed for target genes

Target gene Interference sequence Target sequence (5′–3′)
Arrl1 shRNA-1 CCGTGTGCACGTAAGTGTCCTCTCT
Arrl1 shRNA-2 CGTGTGCACGTAAGTGTCCTCTCTG
NC shRNA GCCTAAGGTTAAGTCGCCCTCG
Cdkn2b siRNA-1 CGGTAGACTTAGCTGAAGA
Cdkn2b siRNA-2 CGATCCAGGTCATGATGAT
NC siRNA GGCTCTAGAAAAGCCTATGC

Neurite outgrowth assay

Cells were fixed and immunostained with anti-β-tubulin III antibody (R&D Systems (Minneapolis, MN), AB_2313773), Tuj1, also defined as a class III β-tubulin. Neurite length was measured and quantified by ImageJ.

Sciatic nerve regeneration assay

Sciatic nerves were crushed as mentioned above following intrathecal injection with the indicated AAV for 14 days. The sciatic nerves and L4-L5 DRGs were collected at 3 days post-SNI. The sciatic nerves were fixed and immunostained with anti-SCG10 antibody (1:100; Abcam (Cambridge, UK), catalog no. ab66155). Regenerated axon was measured and quantified by ImageJ.

FISH

DRG sections or DRG neurons were fixed by 4% paraformaldehyde (Sigma) and hybridized with 1 μg/ml digoxigenin-labeled anti-Arrl1 probe (RiboBio) at 42 °C overnight and then incubated with anti-digoxigenin antibody (RiboBio) and secondary antibody (RiboBio). The slides were observed and photographed using fluorescent microscopy.

lncRNA distribution assay

Cytoplasmic and nuclear RNAs from DRG neurons were isolated by the PARISTM kit (Life Technologies, Inc.) following the manufacturer's protocols. The expression levels of Arrl1 in the cytoplasm and nucleus were measured by qRT-PCR. To perform quantitative PCR, SYBR Green Mix was used (Takara) with validated primers, which are listed in Table 2.

Luciferase reporter assay

The full-length sequence of Arrl1, the 3′-UTR sequence of Cdkn2b, and the mutations of Arrl1 and Cdkn2b were constructed into the pmirGlo vector. The indicated mutations were generated by direct DNA synthesis (GenScript, Nanjing, China). The luciferase reporter assay was performed at 48 h after the reporter vectors co-transfected with the indicated miRNAs into HEK293T cells. Renilla luciferase reporter was used as an internal control, and the relative luciferase activity was normalized to Renilla luciferase activity measured by a Dual-Luciferase reporter assay system (Promega, Madison, WI). To predict the binding sites for rat miRNAs, miRanda software (RRID:SCR_017496) was used.

DRG injection

The lumbar (L)4/L5 intra-DRG injection was performed in male SD rats (180–220 g) at 12 days after infection with Arrl1-knockdown AAV. In brief, the left L4 and L5 DRGs were exposed by removing the lamina of vertebra and opening the epineurium lying covered on the DRG. In the process of DRG injection, the glass needle was inserted into the ganglion, and the miR-761 antagomir (2 nmol in 4 μl) was injected over a period of 5 min into the L4/L5 DRGs through the indwelling catheter attached to a 10-μl Hamilton syringe. After a delay of 2 min, the needle was removed. After 2 days, the left sciatic nerve was crushed and obtained for analysis 3 days later.

Western blotting

Protein extracts were prepared from primary cultured DRG neurons. Equal amounts of protein were electrophoresed on 12% SDS-PAGE and then transferred onto a nitrocellulose membrane (Bio-Rad). Blots were probed with antibody against Cdkn2b (OriGene, catalog no. TA312926; 1:1000). ImageJ was used to quantify the results of Western blotting.

Behavioral assessment

The behavioral assessment was performed as reported previously (44). For the hotplate test, rats were placed on the glass surface for an acclimation period in 5 min. A focused heat light source linked to a timer (model 33 Analgesia Meter; IITC/Life Science Instruments, Woodland Hills, CA) was used to radiate the plantar surface of hind paw, and quick hind paw raising action was considered to be a positive response. Each paw was tested five individual times, and the mean value was calculated.

For the von Frey test, all experimental animals were adapted to the environment for 30 min before the test, and the plantar surfaces of the left hind paws were vertically stimulated by a series of von Frey filaments (Stoelting, Wood Dale, IL). The filament was bent for 5 s with a sufficient force on the central plantar surface, and paw flinching or brisk withdrawal was considered a positive response. Every test was repeated two times in each rat, and the mean value was calculated.

Statistical analysis

The experimental data statistics were analyzed by unpaired, two-tailed Student's t test or analysis of variance with Tukey's post hoc test, and p < 0.05 was considered statistically significant. All quantitative data are expressed as mean ± S.D.

Data availability

All of the data are contained within the article.

Supplementary Material

Supporting Information

This article contains supporting information.

Author contributions—D. W., Y. C., M. L., and S. Z. data curation; D. W. formal analysis; D. W., Y. C., M. L., and S. Z. investigation; D. W. and Q. W. methodology; D. W. and S. M. writing-original draft; D. W., Q. C., and Z. L. writing-review and editing; Y. W. and B. Y. funding acquisition; X. G. supervision; B. Y. conceptualization; B. Y. project administration.

Funding and additional information—This work was supported by National Major Project of Research and Development Grant 2017YFA0104701, National Natural Science Foundation of China Grants 81771326 and 81901257, Natural Science Foundation of Jiangsu Province Grant BK20180951, Natural Science Fund for Colleges and Universities in Jiangsu Province Grants 19KJB180025 and 18KJB180022, and the Jiangsu Provincial Key Medical Center and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Conflict of interest—The authors declare that they have no conflicts of interest with the contents of this article.

Abbreviations—The abbreviations used are:
PNI
peripheral nerve injury
RAG
regeneration-associated gene
DRG
dorsal root ganglion
GO
gene ontology
KEGG
Kyoto Encyclopedia of Genes and Genomes
Cdkn2b
cyclin-dependent kinase inhibitor 2B
Arrl1
axon regeneration–related lncRNA 1
ceRNA
competing endogenous RNA
CNS
central nervous system
PNS
peripheral nervous system
lncRNA
long non-coding RNA
KD
knockdown
NC
negative control
SNI
sciatic nerve injury
qRT-PCR
quantitative RT-PCR
AAV
adeno-associated virus
miR
microRNA
miR-A
miR-761 antagomir
SD
Sprague–Dawley
GAPDH
glyceraldehyde-3-phosphate dehydrogenase.

References

  • 1. Abe N., and Cavalli V. (2008) Nerve injury signaling. Curr. Opin. Neurobiol. 18, 276–283 10.1016/j.conb.2008.06.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Afshari F. T., Kappagantula S., and Fawcett J. W. (2009) Extrinsic and intrinsic factors controlling axonal regeneration after spinal cord injury. Expert Rev. Mol. Med. 11, e37 10.1017/S1462399409001288 [DOI] [PubMed] [Google Scholar]
  • 3. Yiu G., and He Z. (2006) Glial inhibition of CNS axon regeneration. Nat. Rev. Neurosci. 7, 617–627 10.1038/nrn1956 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Mahar M., and Cavalli V. (2018) Intrinsic mechanisms of neuronal axon regeneration. Nat. Rev. Neurosci. 19, 323–337 10.1038/s41583-018-0001-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Ponting C. P., Oliver P. L., and Reik W. (2009) Evolution and functions of long noncoding RNAs. Cell 136, 629–641 10.1016/j.cell.2009.02.006 [DOI] [PubMed] [Google Scholar]
  • 6. Kopp F., and Mendell J. T. (2018) Functional classification and experimental dissection of long noncoding RNAs. Cell 172, 393–407 10.1016/j.cell.2018.01.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Kleaveland B., Shi C. Y., Stefano J., and Bartel D. P. (2018) A network of noncoding regulatory RNAs acts in the mammalian brain. Cell 174, 350–362.e17 10.1016/j.cell.2018.05.022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Batista P. J., and Chang H. Y. (2013) Long noncoding RNAs: cellular address codes in development and disease. Cell 152, 1298–1307 10.1016/j.cell.2013.02.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Sauvageau M., Goff L. A., Lodato S., Bonev B., Groff A. F., Gerhardinger C., Sanchez-Gomez D. B., Hacisuleyman E., Li E., Spence M., Liapis S. C., Mallard W., Morse M., Swerdel M. R., D'Ecclessis M. F., et al. (2013) Multiple knockout mouse models reveal lincRNAs are required for life and brain development. eLife 2, e01749 10.7554/eLife.01749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Luo Q., and Chen Y. (2016) Long noncoding RNAs and Alzheimer's disease. Clin. Interv. Aging 11, 867–872 10.2147/CIA.S107037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Zhao X., Tang Z., Zhang H., Atianjoh F. E., Zhao J. Y., Liang L., Wang W., Guan X., Kao S. C., Tiwari V., Gao Y. J., Hoffman P. N., Cui H., Li M., Dong X., and Tao Y. X. (2013) A long noncoding RNA contributes to neuropathic pain by silencing Kcna2 in primary afferent neurons. Nat. Neurosci. 16, 1024–1031 10.1038/nn.3438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Wu S., Marie Lutz B., Miao X., Liang L., Mo K., Chang Y. J., Du P., Soteropoulos P., Tian B., Kaufman A. G., Bekker A., Hu Y., and Tao Y. X. (2016) Dorsal root ganglion transcriptome analysis following peripheral nerve injury in mice. Mol. Pain 12, 1744806916629048 10.1177/1744806916629048 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Gong L., Wu J., Zhou S., Wang Y., Qin J., Yu B., Gu X., and Yao C. (2016) Global analysis of transcriptome in dorsal root ganglia following peripheral nerve injury in rats. Biochem. Biophys. Res. Commun. 478, 206–212 10.1016/j.bbrc.2016.07.067 [DOI] [PubMed] [Google Scholar]
  • 14. Yao C., Wang J., Zhang H., Zhou S., Qian T., Ding F., Gu X., and Yu B. (2015) Long non-coding RNA uc.217 regulates neurite outgrowth in dorsal root ganglion neurons following peripheral nerve injury. Eur. J. Neurosci. 42, 1718–1725 10.1111/ejn.12966 [DOI] [PubMed] [Google Scholar]
  • 15. Yao C., Wang Y., Zhang H., Feng W., Wang Q., Shen D., Qian T., Liu F., Mao S., Gu X., and Yu B. (2018) lncRNA TNXA-PS1 modulates Schwann cells by functioning as a competing endogenous RNA following nerve injury. J. Neurosci. 38, 6574–6585 10.1523/JNEUROSCI.3790-16.2018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Perry R. B., Hezroni H., Goldrich M. J., and Ulitsky I. (2018) Regulation of neuroregeneration by long noncoding RNAs. Mol. Cell 72, 553–567.e5 10.1016/j.molcel.2018.09.021 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Fagoe N. D., Attwell C. L., Kouwenhoven D., Verhaagen J., and Mason M. R. (2015) Overexpression of ATF3 or the combination of ATF3, c-Jun, STAT3 and Smad1 promotes regeneration of the central axon branch of sensory neurons but without synergistic effects. Hum. Mol. Genet. 24, 6788–6800 10.1093/hmg/ddv383 [DOI] [PubMed] [Google Scholar]
  • 18. Aigner L., Arber S., Kapfhammer J. P., Laux T., Schneider C., Botteri F., Brenner H. R., and Caroni P. (1995) Overexpression of the neural growth-associated protein GAP-43 induces nerve sprouting in the adult nervous system of transgenic mice. Cell 83, 269–278 10.1016/0092-8674(95)90168-X [DOI] [PubMed] [Google Scholar]
  • 19. Jankowski M. P., McIlwrath S. L., Jing X., Cornuet P. K., Salerno K. M., Koerber H. R., and Albers K. M. (2009) Sox11 transcription factor modulates peripheral nerve regeneration in adult mice. Brain Res. 1256, 43–54 10.1016/j.brainres.2008.12.032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Weng Y. L., Wang X., An R., Cassin J., Vissers C., Liu Y., Liu Y., Xu T., Wang X., Wong S. Z. H., Joseph J., Dore L. C., Dong Q., Zheng W., Jin P., et al. (2018) Epitranscriptomic m(6)A regulation of axon regeneration in the adult mammalian nervous system. Neuron 97, 313–325.e6 10.1016/j.neuron.2017.12.036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Bareyre F. M., Garzorz N., Lang C., Misgeld T., Büning H., and Kerschensteiner M. (2011) In vivo imaging reveals a phase-specific role of STAT3 during central and peripheral nervous system axon regeneration. Proc. Natl. Acad. Sci. U.S.A. 108, 6282–6287 10.1073/pnas.1015239108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Kurimoto T., Yin Y., Omura K., Gilbert H. Y., Kim D., Cen L. P., Moko L., Kügler S., and Benowitz L. I. (2010) Long-distance axon regeneration in the mature optic nerve: contributions of oncomodulin, cAMP, and pten gene deletion. J. Neurosci. 30, 15654–15663 10.1523/JNEUROSCI.4340-10.2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Chierzi S., Ratto G. M., Verma P., and Fawcett J. W. (2005) The ability of axons to regenerate their growth cones depends on axonal type and age, and is regulated by calcium, cAMP and ERK. Eur. J. Neurosci. 21, 2051–2062 10.1111/j.1460-9568.2005.04066.x [DOI] [PubMed] [Google Scholar]
  • 24. Nix P., Hisamoto N., Matsumoto K., and Bastiani M. (2011) Axon regeneration requires coordinate activation of p38 and JNK MAPK pathways. Proc. Natl. Acad. Sci. U.S.A. 108, 10738–10743 10.1073/pnas.1104830108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Wang K. C., and Chang H. Y. (2011) Molecular mechanisms of long noncoding RNAs. Mol. Cell 43, 904–914 10.1016/j.molcel.2011.08.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Bunch H. (2018) Gene regulation of mammalian long non-coding RNA. Mol. Genet. Genomics 293, 1–15 10.1007/s00438-017-1370-9 [DOI] [PubMed] [Google Scholar]
  • 27. Salmena L., Poliseno L., Tay Y., Kats L., and Pandolfi P. P. (2011) A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146, 353–358 10.1016/j.cell.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Tay Y., Kats L., Salmena L., Weiss D., Tan S. M., Ala U., Karreth F., Poliseno L., Provero P., Di Cunto F., Lieberman J., Rigoutsos I., and Pandolfi P. P. (2011) Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Cell 147, 344–357 10.1016/j.cell.2011.09.029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Liu K., Tedeschi A., Park K. K., and He Z. (2011) Neuronal intrinsic mechanisms of axon regeneration. Annu. Rev. Neurosci. 34, 131–152 10.1146/annurev-neuro-061010-113723 [DOI] [PubMed] [Google Scholar]
  • 30. Mar F. M., Bonni A., and Sousa M. M. (2014) Cell intrinsic control of axon regeneration. EMBO Rep. 15, 254–263 10.1002/embr.201337723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. He Z., and Jin Y. (2016) Intrinsic control of axon regeneration. Neuron 90, 437–451 10.1016/j.neuron.2016.04.022 [DOI] [PubMed] [Google Scholar]
  • 32. Seijffers R., Mills C. D., and Woolf C. J. (2007) ATF3 increases the intrinsic growth state of DRG neurons to enhance peripheral nerve regeneration. J. Neurosci. 27, 7911–7920 10.1523/JNEUROSCI.5313-06.2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Moore D. L., Blackmore M. G., Hu Y., Kaestner K. H., Bixby J. L., Lemmon V. P., and Goldberg J. L. (2009) KLF family members regulate intrinsic axon regeneration ability. Science 326, 298–301 10.1126/science.1175737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Quinn J. J., and Chang H. Y. (2016) Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 17, 47–62 10.1038/nrg.2015.10 [DOI] [PubMed] [Google Scholar]
  • 35. Ulitsky I., and Bartel D. P. (2013) lincRNAs: genomics, evolution, and mechanisms. Cell 154, 26–46 10.1016/j.cell.2013.06.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Engreitz J. M., Haines J. E., Perez E. M., Munson G., Chen J., Kane M., McDonel P. E., Guttman M., and Lander E. S. (2016) Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature 539, 452–455 10.1038/nature20149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Rashid F., Shah A., and Shan G. (2016) Long non-coding RNAs in the cytoplasm. Genomics Proteomics Bioinformatics 14, 73–80 10.1016/j.gpb.2016.03.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Teotia P., Van Hook M. J., Wichman C. S., Allingham R. R., Hauser M. A., and Ahmad I. (2017) Modeling glaucoma: retinal ganglion cells generated from induced pluripotent stem cells of patients with SIX6 risk allele show developmental abnormalities. Stem Cells 35, 2239–2252 10.1002/stem.2675 [DOI] [PubMed] [Google Scholar]
  • 39. Long B., Wang K., Li N., Murtaza I., Xiao J. Y., Fan Y. Y., Liu C. Y., Li W. H., Cheng Z., and Li P. (2013) miR-761 regulates the mitochondrial network by targeting mitochondrial fission factor. Free Radic. Biol. Med. 65, 371–379 10.1016/j.freeradbiomed.2013.07.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Chen Z., Zuo X., Pu L., Zhang Y., Han G., Zhang L., Wu J., and Wang X. (2019) circLARP4 induces cellular senescence through regulating miR-761/RUNX3/p53/p21 signaling in hepatocellular carcinoma. Cancer Sci. 110, 568–581 10.1111/cas.13901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Cohen J. E., Lee P. R., and Fields R. D. (2014) Systematic identification of 3′-UTR regulatory elements in activity-dependent mRNA stability in hippocampal neurons. Philos. Trans. R. Soc. Lond. B Biol. Sci. 369, 20130509 10.1098/rstb.2013.0509 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Yu B., Qian T., Wang Y., Zhou S., Ding G., Ding F., and Gu X. (2012) miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury. Nucleic Acids Res. 40, 10356–10365 10.1093/nar/gks750 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Cheng C., Webber C. A., Wang J., Xu Y., Martinez J. A., Liu W. Q., McDonald D., Guo G. F., Nguyen M. D., and Zochodne D. W. (2008) Activated RHOA and peripheral axon regeneration. Exp. Neurol. 212, 358–369 10.1016/j.expneurol.2008.04.023 [DOI] [PubMed] [Google Scholar]
  • 44. Reitz M. C., Hrncic D., Treede R. D., and Caspani O. (2016) A comparative behavioural study of mechanical hypersensitivity in 2 pain models in rats and humans. Pain 157, 1248–1258 10.1097/j.pain.0000000000000515 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Data Availability Statement

All of the data are contained within the article.


Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES