Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2020 Jun 23;20:179. doi: 10.1186/s12866-020-01857-w

Development of a droplet digital PCR method for detection of Streptococcus agalactiae

Yi-Fan Zeng 1,2,3,4,#, Chu-Mao Chen 1,2,#, Xiao-Yan Li 5,#, Jun-Jiang Chen 1,2,3, Yan-Ge Wang 1,2,3, Shi Ouyang 6, Tian-Xing Ji 7, Yong Xia 1,2,3, Xu-Guang Guo 1,2,3,8,9,10,✉
PMCID: PMC7310480  PMID: 32576134

Abstract

Background

Streptococcus agalactiae (GBS) is the causative pathogen of puerperal sepsis in pregnant women and pneumonia, sepsis and meningitis in infants. Infection of GBS is responsible for the increased morbidity in pregnant women and the elderly, and bring challenges to clinical diagnosis and treatment. However, culture-based approaches to detect S.agalactiae is time-consuming with limited sensitivity. Besides, real-time quantitative PCR demands expensive instruments with tedious steps. Thus, we aim to establish a new detection method for more accurate and rapid detection of S.agalactiae.

Results

The ddPCR primer targeted the CpsE gene showed better amplified efficiency in the reaction. The limit of detection for GBS DNA with ddPCR was able to reach 5 pg/μL. Moreover, no positive amplified signals could be detected in the reactions which served 11 non-GBS strains DNA as templates. Furthermore, the coefficient of variation of this method was 4.5%, indicating excellent repeatability of ddPCR assay.

Conclusions

In our study, ddPCR was performed as a rapid detection of S.agalactiae with high sensitivity and specificity. This technique can promote the accuracy of the diagnosis of GBS infection and provide a scientific basis for clinical treatment.

Keywords: Droplet digital PCR, Streptococcus agalactiae, Quantitation

Background

Streptococcus agalactiae (Group B Streptococcus, GBS) is a facultative anaerobic gram-positive opportunistic pathogen, which colonizes the gastrointestinal and genitourinary tract of approximately 30% of the healthy adults [1]. Moreover, infection with GBS is the main cause of pneumonia, septicemia and meningitis in neonates, and is especially responsible for the high morbidity rate of pregnant women [2–4]. So far, detection of Streptococcus agalactiae varies from culture-based methods to novel molecular tools [5, 6]. Traditional culture is laborious and time-consuming with limited sensitivity. Although real-time qPCR and other rapid techniques, such as MALDI-TOF-MS, are now commercialized, the cost and expertise limit their use in most laboratories [7]. Therefore, early diagnosis of infection requires a novel method with rapid and specificity in the detection of GBS.

Recently, droplet digital PCR (ddPCR) has been utilized in quantifying nucleic acid and detecting pathogens [8–10]. This method dilutes and divides the mixtures into many microdroplets with oil. Each microdroplet is amplified as an independent reaction system with or without target genes. The amplified condition of ddPCR is similar to that of real-time PCR with the probe for signal detection. Eventually, the absolute concentration will be calculated precisely according to the Poisson distribution without a standard curve [11–14].

Droplet digital PCR is an ultraprecise, reliable and economical method in the diagnosis of infectious disease. However, detection of GBS based on ddPCR has not been reported yet. Thus, we aim to evaluate the ddPCR for the detection of GBS and test whether ddPCR can be an alternative assay for the rapid diagnosis of GBS infection.

Results

Primer screening test

Two sets of primers showed different amplification to GBS ATCC13813 monitored by the SLAN-96P real-time system (Fig. 1). The amplified signal was firstly detected 15 cycles after the reaction and the peak emerged at approximately 45 cycles with CpsE primer. No other amplification was seen in the Sip primer and negative control. Therefore, the CpsE primer was selected for the subsequent tests.

Fig. 1.

Fig. 1

The primer of the qPCR screening experiment in the present study

Sensitivity and specificity of ddPCR for GBS

The limit of ddPCR for detecting GBS DNA was able to reach 5 pg/μL. As shown in Fig. 2, the horizontal axis represented the event number of four concentrations templates, and the vertical represented the sample amplitude. The positive and negative microdroplets were shown in blue and gray, respectively. The number of events was 0 in the concentration of 0.5 pg/μL, suggesting no amplification in this reaction. (Fig. 3). No positive microdroplets could be detected in the reactions using non-GBS strains DNA as templates (data not shown). Therefore, the ddPCR with CpsE primer has a satisfactory sensitivity and specificity for GBS detection.

Fig. 2.

Fig. 2

Sensitivity assay for ddPCR using continuous 10-fold dilutions of DNA templates from GBS ATCC13813

Fig. 3.

Fig. 3

The number of events in each amplification concentration

Repeatability test of ddPCR

GBS reference strain was run in triplicate (Fig. 4). The positive events number was 1661, 1560 and 1704, respectively, with a CV of 4.5%, indicating that ddPCR has an excellent repeatability.

Fig. 4.

Fig. 4

The repeatability test of ddPCR using DNA from the GBS ATCC13813 strain

Discussion

Streptococcus agalactiae is the leading cause of neonatal pneumonia, infantile septicemia, bacterial meningitis, as well as perinatal infection of pregnant women [15, 16]. Recently, a novel technique, ddPCR, was for DNA quantifications absolutely without depending on the standard curve [17]. Droplet digital PCR is the third generation PCR with higher diagnostic efficiency compared to conventional methods.

Currently, bacterial culture is the gold standard for the identification of GBS infection, but it is time-consuming with limited sensitivity and vulnerable to interference [18]. Also, real-time qPCR requires expensive equipment and only quantifies nucleic acid relatively. In our study, we showed that ddPCR could detect S.agalactiae precisely as low as 5 pg/μL. Moreover, amplification was observed in GBS but not in non-GBS strains, which indicated the high specificity of ddPCR primers. Furthermore, ddPCR had an excellent repeatability with a CV of 4.5%. Given these advantages, it can be used to determine the expression and copy number variation analysis of the target gene [19, 20].

In the present study, the fluorescent dye EvaGreen which binds to dsDNA was used to monitor GBS, but it could cause false-positive results if there existed dimer formations. Thus, the melting curve was analyzed and no double-peak was found, indicating no primer dimer formation. Furthermore, we discovered that the CpsE primer amplified the target gene of GBS more effectively than the Sip gene.

Some limitations to our study should not be ignored. Firstly, ddPCR is an assay mainly with fluorescent probes. Application with EvaGreen dye may significantly interfere with the experimental results when the primer dimers were forming. Therefore, the demand for primers specificity is very high. Secondly, bubbles in the process will produce less than 12,000 microdroplets. Thus the experiment does not meet the Poisson distribution, leading to inaccurate results. Thirdly, it was reported that the fbs-B gene was targeted with LAMP to identify GBS [5]. Which gene is more effective in detection needs to be further studied. Moreover, we just established a ddPCR method to identify GBS in the present study. However, given the small size of clinical samples that were collected difficultly, further validation should be considered with a larger sample in the next stage of our study. Meanwhile, since the purity of DNA templates are easily affected and varied from different samples, DNA extraction should be optimized to extend the ddPCR testing from the laboratory to further clinical detection.

Conclusions

In conclusion, our study suggested that ddPCR is a specific, economical and reliable method. However, further validation of larger clinical sample sets are necessary to confirm its value in diagnostic and prove that it is an alternative tool in the clinical detection of GBS.

Methods

Bacterial strains

GBS standard strain ATCC13813 was purchased from Shanghai cell bank of the Chinese Academy of Sciences. Eleven non-GBS strains were isolated from the Clinical Laboratory of Third Affiliated Hospital of Guangzhou Medical University and were initially identified by Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry. Non-GBS strains stored at − 70 °C, were used for specificity experiments, including Candida tropicalis, Candida albicans, Klebsiella pneumoniae, Streptococcus pyogenes, Acinetobacter baumannii, Escherichia coli, Staphylococcus haemolyticus, Candida parapsilosis, Streptococcus anginosus, Enterobacter aerogenes, Pseudomonas aeruginosa.

DNA extraction

The ATCC13813 and other non-GBS strains were inoculated onto sheep blood agar and cultured in 37 °C constant thermostatic incubator for 18-24 h. The bacterial colonies picked on the agar plates were inoculated into sterile physiological saline to prepare 1 ml bacterial suspensions [21, 22]. Then the bacterial DNA was extracted and purified according to the instruction manuals of the TIANGEN DNA kit (TIANGEN BIOTECT, Beijing) and was stored at − 20 °C.

Primer design and synthesis

The sequences of Streptococcus agalactiae CpsE and Sip gene were obtained from GenBanK [23, 24]. Special primers were designed by Primer Premier 5.0(Premier Laboratories, Canada) and synthesized by Thermo Scientific of Shanghai Trade Co. Ltd. (Table 1). The EvaGreen® dsDNA fluorescent dye (EvaGreen®) was used in this detection.

Table 1.

Sequences of primers of the Sip and CpsE gene

Target Sequences (5′-3′)
Sip upstream CTGCCAACCACTATGACC
Sip downstream CTGCTACAGTTCTTACCG
CpsE upstream GCAAAAGAACAGATGGAACAAAGTG
CpsE downstream CGCCGTAAGTAGCAACAGAT

Droplet digital PCR reaction

The ddPCR reaction was performed in a QX200 Droplet Digital PCR System (Bio-Rad Laboratories, CA) according to the manufacturer’s instruction [11]. Each test was prepared in a 20 μl volume of the reaction mixture, which comprised 10 μL of 2× QX200™ ddPCR™ EvaGreen® Supermix (no dUTP; Bio-Rad), forward and reverse primers and 4 μL of DNA templates. For microdroplets generation, 20ul mixture and 70 ul droplet generation oil were added to the DG8™ cartridge (Bio-Rad), then loaded into a QX200 Droplet Generator (Bio-Rad). Next, microdroplets were transferred into 96-well PCR plate and heat-sealed with foil to prevent aerosol pollution. Then the PCR was performed on a Bulk PCR Thermal Cycler using the following conditions: Pre-denature for 1 cycle at 95 °C for 10 min; denature for 45 cycles at 95 °C for 15 s; anneal and extend for 45 cycles at 60 °C for 1 min. Finally, the fluorescence signal in each plate was analyzed by a QX200 Droplet Reader and QuantaSoft™ Version 1.7.4 [10, 25]. Each reaction adopted negative control and was performed in duplicate.

Primer screening analysis

Two sets of primers were dissolved into a working solution, and the DNA of the ATCC13813 strain was served as the template. Then the qPCR assay was performed to amplify CpsE or Sip gene in a SLAN-96P real-time system (HONGSHI. Shanghai). Briefly, we prepared a total volume of 25 μL mixture according to the kit instructions, which contained DNA template, primers, SYBR GREEN dye and PCR Master Mix etc. The reaction procedure was set up identically as the ddPPCR amplification condition mentioned above. Finally, the amplification efficiency was compared to select a better primer for the subsequent assay.

The sensitivity of ddPCR reaction

DNA obtained from GBS reference strain ATCC13813 was used to determine the limitation of ddPCR assay towards the selected gene. The initial concentration of DNA was adjusted to 5 ng/μL and then diluted four times with sterile saline, i.e. 5000 pg/μL, 500 pg/μL, 50 pg/μL, 5 pg/μL and 0.5 pg/μL. The ddPCR reaction was performed as described above with four concentrations of the DNA template to determine the sensitivity of ddPCR in the GBS test.

Specificity and repeatability of ddPCR reaction

The DNAs of the GBS ATCC13813 strain and other 11 non-GBS strains were used to assess the specificity of the primers under identical ddPCR conditions. For further repeatability analysis of ddPCR, the reaction was carried out by testing one positive strain and one negative strain three times under identical conditions. Finally, the fluorescence signal was evaluated.

Acknowledgments

We thank all members of our research team for their contributions to this work.

Abbreviations

GBS

Group B Streptococcus (Streptococcus agalactiae)

ddPCR

droplet digital PCR

MALDI-TOF-MS

Matrix-Assisted Laser Desorption/Ionization Time-Of-Flight Mass Spectrometry

LAMP

Loop-mediated isothermal Amplification

CV

Coefficient of Variation

Authors’ contributions

YFZ, JJC, XYL and XGG conceived and designed the study. YFZ, JJC and YGW cultured bacteria and carried out the ddPCR. CMC, SO and TXJ extracted DNA and performed the qPCR. YFZ, JJC, XYL and CMC conducted data analysis to make figures and tables. YX and XGG participated and gave guidance throughout the process. All members participated in the writing, review, discussion and revision of the manuscript and adopted the final version unanimously. The authors read and approved the final manuscript.

Funding

This study was supported by the “Climbing Plan” Guangdong University Student Science and Technology Innovation Cultivation Special Fund Projects (grant number pdjh2017b0421), the Science and Technology Innovation Project of Guangzhou Medical University (grant number 2016A046), the Natural Science Foundation of Guangdong Province (grant number 2015A030313684), the National Natural Science Foundation of China (grant number 81700004). The funding funders mentioned above had role in study design, experimental development, data collection, analysis and interpretation, and manuscript writing.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that there are no competing interests associated with the manuscript.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yi-Fan Zeng, Chu-Mao Chen and Xiao-Yan Li contributed equally to this work.

References

  • 1.van der Mee-Marquet N, Fourny L, Arnault L, Domelier AS, Salloum M, Lartigue MF, et al. Molecular characterization of human-colonizing Streptococcus agalactiae strains isolated from throat, skin, anal margin, and genital body sites. J Clin Microbiol. 2008;46:2906–2911. doi: 10.1128/jcm.00421-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Valkenburg-van den Berg AW, Houtman-Roelofsen RL, Oostvogel PM, Dekker FW, Dörr PJ, Sprij AJ. Timing of group B streptococcus screening in pregnancy: a systematic review. Gynecol Obstetric Investig. 2010;69:174–183. doi: 10.1159/000265942. [DOI] [PubMed] [Google Scholar]
  • 3.Huber CA, McOdimba F, Pflueger V, Daubenberger CA, Revathi G. Characterization of invasive and colonizing isolates of Streptococcus agalactiae in east African adults. J Clin Microbiol. 2011;49:3652–3655. doi: 10.1128/jcm.01288-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Birlutiu V, Luca CM, Birlutiu RM. Streptococcus agalactiae meningoencephalitis associated with gastroesophageal reflux disease and chronic proton pump inhibitors use, in a 9 month-old infant: a case report. BMC Pediatr. 2018;18:21. doi: 10.1186/s12887-018-0995-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Guo XG, Zhuang YR, Wen JZ, Xie TA, Liu YL, Zhu GD, et al. Evaluation of the real-time fluorescence loop-mediated isothermal amplification assay for the detection of Streptococcus agalactiae. Biosci Rep. 2019;39. 10.1042/bsr20190383. [DOI] [PMC free article] [PubMed]
  • 6.Furfaro LL, Chang BJ, Payne MS. Detection of group B streptococcus during antenatal screening in Western Australia: a comparison of culture and molecular methods. J Appl Microbiol. 2019;127:598–604. doi: 10.1111/jam.14331. [DOI] [PubMed] [Google Scholar]
  • 7.Rosa-Fraile M, Spellerberg B. Reliable detection of group B streptococcus in the clinical laboratory. J Clin Microbiol. 2017;55:2590–2598. doi: 10.1128/jcm.00582-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yan Y, Wang F, Zhang C, Jin X, Zhang Q, Feng X, et al. Evaluation of droplet digital PCR for non-invasive prenatal diagnosis of phenylketonuria. Anal Bioanalytical Chemistry. 2019. 10.1007/s00216-019-02087-4. [DOI] [PubMed]
  • 9.Li Z, Pan L, Lyu L, Li J, Jia H, Du B, et al. Diagnostic accuracy of droplet digital PCR analysis of cerebrospinal fluid for tuberculous meningitis in adult patients. Clin Microbiol Infect. 2019. 10.1016/j.cmi.2019.07.015. [DOI] [PubMed]
  • 10.Cheng X, Sun L, Zhao Q, Mi Z, Yu G, Wang Z, et al. Development and evaluation of a droplet digital PCR assay for the diagnosis of paucibacillary leprosy in skin biopsy specimens. PLoS Negl Trop Dis. 2019;13:e0007284. doi: 10.1371/journal.pntd.0007284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hindson BJ, Ness KD, Masquelier DA, Belgrader P, Heredia NJ, Makarewicz AJ, et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal Chem. 2011;83:8604–8610. doi: 10.1021/ac202028g. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hindson CM, Chevillet JR, Briggs HA, Gallichotte EN, Ruf IK, Hindson BJ, et al. Absolute quantification by droplet digital PCR versus analog real-time PCR. Nat Methods. 2013;10:1003–1005. doi: 10.1038/nmeth.2633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cao L, Cui X, Hu J, Li Z, Choi JR, Yang Q, et al. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications. Biosens Bioelectron. 2017;90:459–474. doi: 10.1016/j.bios.2016.09.082. [DOI] [PubMed] [Google Scholar]
  • 14.Gutiérrez-Aguirre I, Rački N, Dreo T, Ravnikar M. Droplet digital PCR for absolute quantification of pathogens. Methods Mol Biol (Clifton, N.J.). 2015, 1302:331–47. 10.1007/978-1-4939-2620-6_24. [DOI] [PubMed]
  • 15.Takayama Y, Matsui H, Adachi Y, Nihonyanagi S, Wada T, Mochizuki J, et al. Detection of Streptococcus agalactiae by immunochromatography with group B streptococcus-specific surface immunogenic protein in pregnant women. J Infect Chemother. 2017;23:678–682. doi: 10.1016/j.jiac.2017.07.001. [DOI] [PubMed] [Google Scholar]
  • 16.Ku LC, Boggess KA, Cohen-Wolkowiez M. Bacterial meningitis in infants. Clin Perinatol. 2015;42:29–45. doi: 10.1016/j.clp.2014.10.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Clementi M, Bagnarelli P. Are three generations of quantitative molecular methods sufficient in medical virology? Brief review. New Microbiologica. 2015;38:437–441. [PubMed] [Google Scholar]
  • 18.Ferreira MB, de-Paris F, Paiva RM, Nunes LS. Assessment of conventional PCR and real-time PCR compared to the gold standard method for screening Streptococcus agalactiae in pregnant women. Brazilian J Infect Dis. 2018;22:449–454. doi: 10.1016/j.bjid.2018.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Herring E, Kanaoka S, Tremblay E, Beaulieu JF. Droplet digital PCR for quantification of ITGA6 in a stool mRNA assay for the detection of colorectal cancers. World J Gastroenterol. 2017;23:2891–2898. doi: 10.3748/wjg.v23.i16.2891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhao Y, Xia Q, Yin Y, Wang Z. Comparison of Droplet Digital PCR and Quantitative PCR Assays for Quantitative Detection of Xanthomonas citri Subsp. citri. PloS one. 2016;11:e0159004. doi: 10.1371/journal.pone.0159004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Guo XG, Zhou YZ, Li Q, Wang W, Wen JZ, Zheng L, et al. Rapid and reliable diagnostic method to detect Zika virus by real-time fluorescence reverse transcription loop-mediated isothermal amplification. AMB Express. 2018;8:60. doi: 10.1186/s13568-018-0591-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Vieira LL, Perez AV, Machado MM, Kayser ML, Vettori DV, Alegretti AP, et al. Group B streptococcus detection in pregnant women: comparison of qPCR assay, culture, and the Xpert GBS rapid test. BMC Pregnancy Childbirth. 2019;19:532. doi: 10.1186/s12884-019-2681-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Carrillo-Ávila JA, Gutiérrez-Fernández J, González-Espín AI, García-Triviño E, Giménez-Lirola LG. Comparison of qPCR and culture methods for group B streptococcus colonization detection in pregnant women: evaluation of a new qPCR assay. BMC Infect Dis. 2018;18:305. doi: 10.1186/s12879-018-3208-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Breeding KM, Ragipani B, Lee KD, Malik M, Randis TM, Ratner AJ. Real-time PCR-based serotyping of streptococcus agalactiae. Sci Rep. 2016;6:38523. doi: 10.1038/srep38523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Frias M, Rivero-Juarez A, Tellez F, Palacios R, Jimenez-Arranz A, Pineda JA, et al. Evaluation of hepatitis C viral RNA persistence in HIV-infected patients with long-term sustained virological response by droplet digital PCR. Sci Rep. 2019;9:12507. doi: 10.1038/s41598-019-48966-9. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.


Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES