Skip to main content
IMA Fungus logoLink to IMA Fungus
. 2020 Mar 23;11:7. doi: 10.1186/s43008-020-00030-2

Correction to: Proposal of a new nomenclature for introns in protein-coding genes in fungal mitogenomes

Shu Zhang 1, Yong-Jie Zhang 2,
PMCID: PMC7325152

Correction to: IMA Fungus (2019) 10:15

https://doi.org/10.1186/s43008-019-0015-5

The published article (Zhang and Zhang 2019) includes an incorrect sequence. The erroneously indicated nad4L sequence NC_001715 (GenBank accession number) should be replaced by NC_036382 (GenBank accession number) in additional file 1.

  • Incorrect sequence:

">NAD4L_NC_001715

ATGCTTTTAGAAATAATAACAGCTTATAAAATAGGAACAATCTTATTTTTAATTGGAATTTTAGGTTTCATTATCAATAGACAAAATATTCTTTTACTTATTATCTCTATTGAAATGACTTTATTAGCTATTAGTTTTATTATTATTTGTTCTGCTCTTTTCCTTGATGATTCTGCAGCAGCTTGTTTTTCACTTTATATTTTAGCTCTTGCTGGTTCAGAAGCTGCAATTGGTCTTTCACTTTTAGTTTTATTCCATAGATTTAGAGGATCAGTATTAATTTCAGCTTCTCGACAATAG"

  • Correct sequence:

">nad4L_NC_036382

ATGAGTTTAACTTTAGTACTTTTTTTAATAGGAATCTTAGGATTCGTATTTAATAGAAAAAATATAATATTAATGCTTATTTCTATAGAAATAATGCTATTATCTATAACATTTTTAATATTGGTAAGTTCTATTAATCTTGACGATATAATAGGACAAACATATGCTATATACATTATAGTAGTTGCTGGTGCAGAATCTGCTATCGGTTTAGCTATTTTAGTAGCTTTTTATAGACTAAGAGGAAGTATCGCAATAGAATATAAATAA"

To be in concordance with this change, “P263” in the nad4L column should be changed to “P239” in Table 3.

The authors would like to apologise for any inconvenience caused.

Reference

  1. Zhang, Zhang Proposal of a new nomenclature for introns in protein-coding genes in fungal mitogenomes. IMA Fungus. 2019;10:15. doi: 10.1186/s43008-019-0015-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from IMA Fungus are provided here courtesy of The International Mycological Association

RESOURCES