Abstract
Spiophanes bombyx (Claparède, 1870) from the Gulf of Naples, Tyrrhenian Sea, Italy, was the first described Spiophanes with fronto-lateral horns on the prostomium. It was also considered the only horned species occurring in European waters. Our sequence data of five gene fragments suggest the presence of two horned sibling Spiophanes species in northern Europe: S. cf. bombyx in the North and the Norwegian seas, and S. cf. convexus in Brittany, northern France, and Bay of Biscay, northern Spain. Spiophanes cf. bombyx worms are genetically close to a single examined specimen of S. bombyx from Venice Lagoon, Italy but their conspecificity should be verified by further study. Our sequence data show that horned Spiophanes from the North Pacific are genetically distant from horned European species, and that S. uschakowi Zachs, 1933, originally described from the Sea of Japan (East Sea) is a valid species. The data also suggest the presence of two horned sibling Spiophanes species in the North East Pacific: S. hakaiensis Radashevsky & Pankova, n. sp. distributed from Alaska south to about Point Conception, and S. norrisi Meißner & Blank, 2009, distributed from San Francisco Bay south to Baja California Sur, Mexico. Spiophanes from South America, morphologically similar to S. norrisi, are suggested to belong to a new species. Molecular data also suggest the presence of two sibling species among the worms from northern Europe identified by morphology as S. kroyeri Grube, 1860. Worms from the Barents Sea and northern part of the North Sea are tentatively referred to as S. cf. kroyeri; worms from the northern and central parts of the North Sea and from the Bay of Biscay, northern Spain, are tentatively referred to as S. cf. cirrata M. Sars in G.O. Sars, 1872. Sequence data also show that S. duplex from California is genetically different from morphologically similar worms from South America. The South American worms are referred to resurrected S. soederstroemi Hartman, 1953 which was originally described from off Rio Grande do Sul, Brazil, and then considered as a junior synonym of S. duplex. Analysis of divergence times of Spiophanes lineages suggested that the origin of the most recent common ancestor of horned Spiophanes with metameric nuchal organs was around 11.1 mya (95% HPD: 5.1–19.0 mya) and that the divergence of the North Atlantic and North Pacific lineages was around 7.9 mya (95% HPD: 4.1–13.3 mya). The North Atlantic lineage was estimated to have diverged 4.8 mya (95% HPD: 2.2–8.6 mya), resulting in the origin of S. cf. bombyx and S. cf. convexus. The North Pacific lineage was estimated to have diverged first by the isolation and speciation of S. norrisi 1.7 mya (95% HPD: 2.3–1.0 mya), and then by the isolation and speciation of S. uschakowi and S. hakaiensis n. sp. 1.3 mya (95% HPD: 2.0–0.7 mya). The estimates place the divergences soon after maximum glacial period in the North Pacific (2.4–3.0 mya).
Introduction
For a long time, polychaetes were believed to have high morphological variability and ecological plasticity and many species were considered as widely distributed or cosmopolitan. New approaches and techniques show, however, that many of these “cosmopolitans” comprise groups of similar cryptic or sibling species with much more limited variability, plasticity and geographic distribution than was previously suggested (see Read’s comments on Polychaeta in Appeltans et al. [1]; [2–4]).
Wide or cosmopolitan distribution has often been reported for members of one of the largest polychaete families, Spionidae Grube, 1850. Examples included Aonides oxycephala (Sars, 1862), Boccardia polybranchia (Haswell, 1885), Dipolydora armata (Langerhans, 1880), Dipolydora coeca (Örsted, 1843), Dipolydora flava (Claparède, 1870), Dipolydora socialis (Schmarda, 1861), Laonice cirrata (M. Sars, 1851), Paraprionospio pinnata (Ehlers, 1901), Polydora ciliata (Johnston, 1838), Prionospio cirrifera Wirén, 1883, Prionospio steenstrupi Malmgren, 1867, Pygospio elegans Claparède, 1863, Scolelepis squamata (Müller, 1806), Spio filicornis (Müller, 1776), and Spiophanes bombyx (Claparède, 1870). Common to all these species is that they were originally briefly described in the nineteenth century or even earlier. For example, the original description of S. squamata contains only three sentences in Latin [5]. Those original descriptions usually provided not specific but general characters shared also by other species from remote locations. Misidentification of those worms from remote locations incorectly “extended” the distribution of the stem species and created so-called “cosmopolitans due to incorrect identification”. It seems to be a destiny of old polychaete species to become cosmopolitans. Since most of the old species were originally described from Europe, consequently most of the cosmopolitan records are also European. Recent taxonomic revisions of Laonice Malmgren, 1867, Paraprionospio Caullery, 1914 and Spiophanes Grube, 1860 by Sikorski [6], Yokoyama [7] and Meissner [8], respectively, clarified some cases but uncertainties still remain.
One of the old Spiophanes species, S. bombyx was originally described from the Gulf of Naples, Italy, by Claparède [9, 10] (as Spio bombyx). The main diagnostic feature of the species was a pair of long horns extending from the fronto-lateral parts of the prostomium ([9]: Fig 2; [10]: Fig 2). Since then, Spiophanes with similar horns were reported as S. bombyx from northern Europe and Iceland [11–34, 8, 35], Atlantic coast of North and Central America [36–46], Atlantic coast of South America [47–52], Pacific coast of North America [53–66], Pacific coast of South America [67, 64, 68–73], Hawaii [74, 75], Pacific coast of Asia [76–95], Indian Ocean [96, 97], Atlantic coast of Africa [98–103], Australia and New Zealand [104–107], and Antarctica [108, 109]. Recent studies, however, suggested that these reports may include a series of cryptic species. Morphological examination of worldwide material and a molecular analysis (partial sequences of the nuclear 18S rDNA and mitochondrial COI) confirmed the distribution of S. bombyx in the North and Mediterranean Seas and suggested that this species should not be considered as cosmopolitan [110, 8, 111].
Zachs [112] described Spiophanes with long fronto-lateral horns on the prostomium from Peter the Great Bay, Sea of Japan (East Sea), Russia, as S. uschakowi Zachs, 1933. The original description of the species was very brief and the type material is in poor condition [111]. Annenkova [113] suggested S. uschakowi to be a synonym of S. bombyx but Uschakov [77, 78] consistently treated the two species as different. Later authors reported from the Sea of Japan (East Sea) and adjacent areas only S. bombyx without comment on the taxonomy of S. uschakowi [76, 114, 83, 87, 88, 115]. Meißner & Blank [111] examined some earlier reports of S. bombyx from the American and Asian Pacific. They were uncertain about worms from the Asian Pacific because of the poor material available but, despite this, assigned specimens from the American Pacific to a new species, S. norrisi Meißner & Blank, 2009.
During systematic surveys on spionid polychaetes worldwide, we collected Spiophanes from the Atlantic and the Pacific Oceans, and the Mediterranean Sea. The main purpose of the present study was to clarify the specific identity of the horned Spiophanes from the North Pacific. Herein, we describe and illustrate adult morphology of S. uschakowi from the type locality in Peter the Great Bay, Russia, and use molecular analysis to provide new insight on the phylogenetic relationships among Spiophanes species.
Materials and methods
Collections, material and morphological study
Collections were made in shallow waters in the Sea of Japan (East Sea), Russia; around the Korean Peninsula; British Columbia, Canada; California, USA; Norwegian Sea, Norway; North Sea, Northumberland, UK; English Channel, Brittany, France; Venice Lagoon, Adriatic Sea, Italy; Chile, and Paranaguá Bay, Paraná, Brazil (Tables 1 and S1). Collected sediments were washed in the field on a 500 μm mesh sieve and Spiophanes worms retained in the residue were removed and examined alive under light microscopes in the laboratory. For molecular analysis, specimens were preserved in 95% ethanol. Voucher specimens were fixed in 10% formalin solution, rinsed in fresh water and then transferred to 70% ethanol. After examination, formalin preserved specimens were deposited in the polychaete collections of the Museum of the Institute of Marine Biology, National Scientific Center of Marine Biology (MIMB), Vladivostok, Russia; the White Sea Branch of the Zoological Museum of the Lomonosov Moscow State University, the White Sea Biological Station (WS), Poyakonda, Russia; Muséum National d’Histoire Naturelle (MNHNP), Paris, France; Senckenberg Museum (SMF), Frankfurt am Main, Germany; Natural History Museum of Los Angeles County (LACM-AHF), Los Angeles, CA, USA, and the United States National Museum of Natural History, Smithsonian Institution (USNM), Washington, D.C., USA. We additionally examined Spiophanes specimens deposited in the polychaete collections of the above mentioned museums and also in the Zoological Institute (ZISP), St Petersburg, Russia; Natural History Museum (NHMO), Oslo, Norway; Icelandic Institute of Natural History (IINH), Reykjavík, Iceland, and the California Academy of Sciences, Department of Invertebrate Zoology (CASIZ), San Francisco, CA, USA. Additional material of Spiophanes from the North Sea, Germany, was kindly provided by Dagmar Lackschewitz; from the Adriatic Sea, Croatia, by Barbara Mikac; and from Argentina by María Martha (Pitu) Mendez. Additional material of S. norrisi from California, USA, and S. kroyeri from Norway, originally preserved in ethanol, was kindly provided by Dorothy Norris and the University Museum of Bergen, Norway (ZMBN), respectively. Norwegian material was collected by the MAREANO Project. Material from British Columbia, Canada, was collected by the MarineGEO Hakai-Smithsonian BioBlitz-2017. Information about samples used for molecular analysis is given in Table 1. Complete available information about type specimens is given in the Results preceding the descriptions or comments on the species; information about all newly collected material and museum samples examined during this study is given in S1 Table. A complete list of the museums and other collections (and their acronyms) holding the examined or reported samples is given in S2 Table. S1 Table also includes material from the Norwegian, North, Mediterranean and Aegean seas and North Pacific reported by Meißner & Blank [111] and from the North Sea identified by Dieter Fiege, Markus Böggemann and Karin Meißner which is deposited in the SMF and other polychaete collections and was only partially re-examined by the first author (VIR). It also includes records of S. bombyx (= S. uschakowi) from Japan provided by Imajima [88, 116–118], for which no museum numbers were reported, records of S. bombyx (= S. cf. norrisi) from Chile, Argentina and the Falkland Islands provided by Carrasco [119] and Blake [48], and records of S. bombyx (here referred either to S. bombyx or S. cf. convexus) from Spain provided by Meißner [8]. To link some sequences used in the molecular analysis in the present study with the corresponding data, unique numbers from the first author’s database (VIR) are given to samples in the S1 Table (at the end of each record). These numbers without letters precede specific names on the phylogenetic trees (Figs 1–3).
Table 1. Sampling location data, museum registration numbers and GenBank accession numbers of sequences.
| Species | Location | Coordinates | Date | Vouchera | GenBank/BOLD accession numbersb | ||||
|---|---|---|---|---|---|---|---|---|---|
| Reference | COI | 16S | 18S | 28S | Histone 3 | ||||
| 1. Trochochaeta multisetosa | North Sea, Norway | 58.24767°N, 6.53107°E | 3 Feb 2016 | ZMBN 126365 | MN193552, 53 | MN193539–41 | MN193939–41 | ||
| 2. T. multisetosa | Askeröfjord, Sweden | 58.1179°N, 11.828°E | 11 May 2017 | SIO BIC A6333 | MN313649c | MN296517c | |||
| 3. T. multisetosa | Drake's Bay, California, USA | [120] | 1 Apr 2003 | VIR 23025 | DQ790097 | DQ790070 | |||
| 4. Spiophanes berkeleyorum | offshore Long Beach, California, USA | 33.66834°N, 118.29762°W | 17 Jul 2017 | MIMB 39031 (VIR 20548) | MN186816 | MN193542 | MN193942 | ||
| 5. S. berkeleyorum | offshore San Francisco, California, USA | [111] | HH99, 100, 112 | GQ202713, 14 | GQ202718 | ||||
| 6. S. bombyx | Adriatic Sea, Venice Lagoon, S. Andrea, Italy | 45.4389°N, 12.39359°E | 29 Jul 2014 | MIMB 28156 (VIR 18675) | MG878899 | MG878928 | |||
| 7. S. cf. bombyx | North Sea (north, central and south-east parts) | [111] | HH61, 62, 83, 84, 90–92 | GQ202702–08 | GQ202717 | ||||
| 8. S. cf. bombyx | North Sea, Northumberland, England, UK | 55.113°N, 1.413°W | 19 Nov 2008 | WS 2365 (VIR 13492) | KM998751 | MG878898 | KM998759 | MG878927 | MG874412 |
| 9. S. cf. bombyx | Norwegian Sea, Kvaløya Is., Norway | 69.69104°N, 18.8737°E | 11 Sep 2015 | MIMB 28157 (VIR 19618) | MG874445 | MG878900 | MG913227 | MG878929 | MG874413 |
| 10. S. duplex | offshore Long Beach, California, USA | 33.66834°N, 118.29762°W | 17 Jul 2017 | MIMB 39030 (VIR 23217) | MN186817 | MN193543 | MN193943, 44 | ||
| 11. S. cf. convexus | Bay of Biscay, Spain | [121] | VIR 23007 | KT307700 | |||||
| 12. S. cf. convexus | Bay of Morlaix, Brittany, France | 48.6502°N, 3.8651°W | 27 May 2014 | MIMB 28155 (VIR 18567) | MN193554 | MN193544–46 | MN193945 | ||
| 13. S. cf. convexus | Bay of Morlaix, Brittany, France | 48.70572°N, 3.93395°W | 6 Sep 2016 | MIMB 36704 (VIR 20103) | MG874446−48 | MG878901−03 | MG913228−30 | MG878930−32 | MG874414−16 |
| 14. S. cf. kroyeri | Barents Sea, Norway | 72.3075°N, 32.342667°E | 4 Aug 2013 | ZMBN 108407 (VIR 19667) | MG874451−53 | MG913233−35 | MG878935−37 | MG874419−21 | |
| 15. S. cf. kroyeri | Barents Sea, Norway | 71.776833°N, 33.540333°E | 7 Aug 2013 | ZMBN 108408 (VIR 19669) | MG874454−56 | MG878906, 07 | MG913236−38 | MG878938−40 | MG874422−24 |
| 16. S. cf. kroyeri | North Sea | [111] as S. kroyeri | HH64, 94 | GQ202709, 10 | GQ202719 | ||||
| 17. S. cf. cirrata | North Sea | [111] as S. kroyeri | HH18, 19, 63 | GQ202696, GQ202711, 12 | GQ202720 | ||||
| 18. S. cf. cirrata | Bay of Biscay, Spain | [121] as S. kroyeri | KT307701 | ||||||
| 19. S. aff. kroyeri | Crozet Islands, Southern Ocean, abyss | [122] | CP160, 291 | EU340080, 82 | EU340094, 96 | ||||
| 20. S. norrisi | offshore San Francisco, California, USA | [111] | HH97, 98, 103, 105–109, 111 | GQ202697–701 | GQ202716 | ||||
| 21. S. norrisi | offshore San Francisco, California, USA | 37.8377°N, 122.62°W | 11 Sep 2017 | LACM:DISCO: 7567 (VIR 23045) | DISA959–19 | ||||
| 22. S. norrisi | Baja California Norte, Mexico | 32.494°N, 117.163°W | 26 Jan 2005 | MBI-SCCWRP-556 (VIR 23044) | CMBIA 423–427 | ||||
| 23. S. hakaiensis n. sp. | Cook Inlet, Alaska, USA | 59.468°N, 151.553°W | 23 May 2011 | 11BIOAK-1443 | MF121352 | ||||
| 24. S. hakaiensis n. sp. | British Columbia, Canada | 51.6656°N, 128.0797°W | 22 Jul 2017 | LACM-AHF Poly (VIR 20560) | MN193555 | MN186818 | MN193547 | MN193946 | |
| 25. S. hakaiensis n. sp. | Calvert Is., British Columbia, Canada | 51.644°N, 128.1195°W | 24 Jul 2017 | MIMB 36707 (VIR 20583) | MN520841 | MN193556 | MN186819 | MN193548 | MN193947 |
| 26. S. hakaiensis n. sp. | Calvert Is., British Columbia, Canada | 51.6763°N, 128.1222°W | 4 Aug 2017 | Holotype CMNA 2019–0105 (VIR 20666) | MN414081 | MN193557 | MN186820 | MN193549 | MN193948 |
| 27. S. hakaiensis n. sp. | offshore San Francisco, California, USA | 37.7125°N, 122.5648°W | 13 Sep 2010 | MIMB 39022 (VIR 17935) | MG874464 | MG878914 | MG913241 | MG878948 | MG874432 |
| 28. S. hakaiensis n. sp. | offshore San Francisco, California, USA | 37.6588°N, 122.5615°W | 15 Sep 2010 | MIMB 39021 (VIR 17934) | MG874457−63 | MG878908−13 | MG913239, 40 | MG878941−47 | MG874425−31 |
| 29. S. hakaiensis n. sp. | offshore San Francisco, California, USA | 37.6588°N, 122.5615°W | 13 Sep 2010 | MBI-SCCWRP-430 (VIR 22931) | CMBIA 494–503 | ||||
| 30. S. pisinnus | New South Wales, Australia | [111] | HH95 | GQ202715 | GQ202721 | ||||
| 31. S. uschakowi | Peter the Great Bay, Russia | 42.89236°N, 132.73486°E | 19 Oct 2011 | MIMB 28164; WS 2345–2349 (VIR 17242) | KM998746−50 | MG878915−19 | KM998760−63 | MG878949−53 | MG874433−37 |
| 32. S. uschakowi | Peter the Great Bay, Russia | 42.89236°N, 132.73486°E | 15 Jul 2013 | MIMB 28165 (VIR 18040) | MN193558, 59 | MN193550, 51 | MN193949, 50 | ||
| 33. S. viriosus | Queensland, Australia | [123] | AM W.44566 | KP636518 | KP636519 | ||||
| 34. S. soederstroemi | Paranaguá Bay, Paraná, Brazil | 25.552°S, 48.415°W | 9 Jul 2015 | MIMB 28151 (VIR 19356) | MG874449, 50 | MG878904, 05 | MG913231, 32 | MG878933, 34 | MG874417, 18 |
| 35. Spiophanes sp. A | East China Sea, South Korea | 33.5°N, 124.00°E | 11 Nov 2015 | MIMB 39027 (VIR 19944) | MG878920 | MG913242 | MG878954 | MG874438 | |
| 36. Spiophanes sp. A | East China Sea, South Korea | 32.00°N, 125.00°E | 2015 | MIMB 39028 (VIR 19955) | MG874465 | MG913243 | MG878955 | MG874439 | |
| 37. Spiophanes sp. A | East China Sea, South Korea | 33.00°N, 124.00°E | 2015 | MIMB 39029 (VIR 19961) | MG874466 | MG913244 | MG878956 | MG874440 | |
Sequences obtained in the present study are given in plain; sequences provided by other authors are given in bold.
aVouchers by Meißner & Blank ([111]: Table 1) were cited as in their paper without explanation about HH abbreviation.
bTwo last digits are shown for the second and other numbers in a successive series.
cCollected by Fredrick Pleijel, sequenced in Greg Rouse’ laboratory
Fig 1. Phylogenetic results and haplotypes network.
(A) Haplotype network of the COI (267 bp) sequences in Spiophanes spp. from North Pacific, calculated in TCS. Haplotypes are indicated by colored circles and their frequency is indicated by the size of the circles. Multiple colors indicate haplotypes shared by more than one sampling locality, with sections scaled by frequency. (B) Majority rule consensus tree of the Bayesian inference analysis-1 of COI (267 bp) sequences obtained in the present study and also taken from GenBank and BOLD. Posterior probabilities are shown on the branches. Species names are followed by the names of the collecting locations. Information about numbers with letters following specific names are given in Table 1. The numbers without letters following specific names are unique numbers from the VIR database linking the individuals on the tree with the sampling data in the S1 Table.
Fig 3. The maximum clade credibility chronogram of horned Spiophanes inferred by the BEAST analysis of COI sequences.
Posterior probabilities are shown on the branches below the divergence time estimations. Bars at nodes indicate highest posterior density (95% HPD) intervals for the divergence times. Species names are followed by the names of the collecting locations. Information about numbers with letters following specific names are given in Table 1. The numbers without letters following specific names are unique numbers from the VIR database linking the individuals on the tree with the sampling data in the S1 Table. Abbreviations: BS–opening of the Bering Strait 5.4–5.5 mya; MG–maximum glacial period in North Pacific 2.4–3.0 mya.
When no coordinates were provided for sampling sites in old studies, they were collected from the Google Earth map according to the original descriptions of the locations. Sampling locations of Spiophanes spp. noted in S1 Table are plotted on maps using the QGIS 3.8.0 software and the geodata provided by the OpenStreetMap Project (https://osmdata.openstreetmap.de).
Formalin-fixed specimens of S. uschakowi were critical-point dried in carbon dioxide, coated with gold palladium, and viewed with a LEO 440 scanning electron microscope (SEM) equipped with a digital camera at the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA.
Formalin-fixed specimens of Spiophanes spp. were stained with an alcohol solution of methyl green (MG), examined complete or dissected to observe internal structures, and photographed using microscopes equipped with digital cameras. Final plates were prepared using CorelDRAW®2017 software.
DNA extraction, amplification and sequencing
We used the DNA Wizard Genomic DNA Purification Kit and the ReliaPrep gDNA Tissue Miniprep System (Promega Corporation, Madison, WI, USA) for DNA extraction and purification, with the standard protocol for animal tissue. Polymerase chain reaction (PCR) amplification of nuclear 18S rDNA, D1 region of 28S rDNA and Histone 3, and mitochondrial 16S rDNA gene fragments was accomplished with the primers and conditions described by Radashevsky et al. [124, 125]. We used primers 5' GGTCAACAAATCATAAAGATATTGG 3' and 5' TAAACTTCAGGGTGACCAAAAAATCA 3' to amplify the mitochondrial gene fragment of cytochrome C oxidase subunit 1 (COI) [126]. Cycling parameters were as follows: initial denaturation at 94°C for 2 min, 35 cycles of 94°C for 30 s, 50°C for 40 s, 72°C for 60 s, with a final extension of 72°C for 5 min.
Purified PCR products were bidirectionally sequenced on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems) using the BigDye Terminator v 3.1 Cycle Sequencing Kit (Applied Biosystems) and the same primers as for PCR. The consensus sequence of each gene region of each specimen was assembled from the two complementary sequences using SeqScape v 2.5 (Applied Biosystems). GenBank accession numbers of the obtained sequences are given in Table 1.
Phylogenetic analysis
We aligned DNA sequences using the MAFFT v7.2 software with the default settings (automatically chosen algorithms) [127, 128]. Ambiguous positions and gaps were excluded from subsequent analysis using GBlocks [129]. The nucleotide datasets were combined using the supermatrix approach. The number of variable and parsimony informative sites in the datasets, the uncorrected values of sequence divergence (pairwise distances, p) both within and between groups were calculated in MEGA 5.1.
We used MrBayes 3.2.6 via the CIPRES web portal [130] for the Bayesian analysis of 10,000,000 generations, four parallel chains and sample frequencies set to 500, in two separate runs. Based on the convergence of likelihood scores, 25% sampled trees were discarded as burn-in. The analysis of the combined data set was partitioned and the models of substitution were determined using Akaike Information Criterion (AIC) in Modeltest 3.7 [131]: GTR+I+G for 16S, 28S and Histone 3, TVM+G for 18S, and HKY+I+G for COI.
We also included in the analysis sequences of Spiophanes spp. obtained by Meißner & Blank [111], Mincks et al. [122], Meißner & Götting [123], Aylagas et al. [121], and some sequences from GenBank and BOLD (Table 1). We performed two analyses: the COI analysis to compare our data with those reported by previous authors, and a concatenated analysis using five genes to get better resolution of relationships among Spiophanes species. The five-genes analysis was based on sequence data of the mitochondrial COI, 16S rDNA, nuclear 18S, 28S rDNA, and Histone 3 most of which were obtained in the present study. In this analysis, we included COI sequences obtained by other authors if they comprised more than 500 bp, and 18S sequences if they comprised more than 1600 bp. Of 46 individual concatenated sequences obtained in the present study, 30 sequences comprised fragments of four to five genes, and 39 sequences comprised fragments of three genes. The analyses were rooted using the sequences of Trochochaeta multisetosa (Örsted, 1843). In the Bayesian analysis of 18S sequences of various spionids by Mincks et al. ([122]: Fig 8), Trochochaeta Levinsen, 1883 appeared sister to Spiophanes.
The haplotype network was constructed based on a statistical parsimony approach using TCS [132].
Divergence time estimation
Divergence time estimation of the horned Spiophanes lineages was performed with BEAST 1.8.0 [133] running in the CIPRES Science Gateway [130]. For the analysis, we used COI sequences comprising more than 500 bp. The in-group included horned Spiophanes with metameric nuchal organs, all members of a monophyletic group according to the five-genes analysis. The analysis was rooted using the sequences of S. soederstroemi that in five-genes analysis appeared most closely related to the clade of the horned Spiophanes.
The Tamura-Nei model (TrN) of nucleotide substitution with gamma-distributed rate variation (+G) was applied to COI data set with base frequencies estimated during the analysis [134]. We used the path sampling maximum likelihood estimator implemented in BEAST 1.8.0 [135, 136] to determine the appropriate molecular clock models for data set (uncorrelated lognormal relaxed clock, random local clock or strict clock). After model selection, a relaxed molecular clock using the uncorrelated log-normal model [137] was applied with a Birth-Death process speciation prior for branching rates [138]. We applied substitution rate of 4.1%/MY with a SD of 3.5–4.7%/MY, suggested for northern polychaetes by Loeza-Quintana et al. [139], to convert genetic branch lengths to absolute times. The final analysis consisted of two independent MCMC analyses; each chain was run for 40,000,000 generations with parameters sampled every 4000 steps to ensure effective sample size (ESS) values above 200 for all parameters. The first 10% of trees in each independent run were discarded as burn‐in and the remaining trees were combined to produce an ultra‐metric consensus tree using LogCombiner and TreeAnnotator 1.8.0 (BEAST package).
Nomenclatural acts
The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix “http://zoobank.org/”. The LSID for this publication is: urn:lsid:zoobank.org:pub:B69BEC0A-2B46-4F46-99E4-73FD7D502A38. The electronic edition of this work was published in a journal with an ISSN, and has been archived and is available from the following digital repositories: PubMed Central, LOCKSS, ResearchGate.
Results
Molecular analysis
COI analysis and haplotype network
The alignment of COI sequences obtained in the present study and those from GenBank and BOLD comprised 267 bp with 106 (39.7%) variable sites, of which 93 (34.8%) sites were parsimony informative. The Bayesian analysis resulted in a partially resolved consensus tree (Fig 1B).
The analysis revealed two sister groups among specimens from northern Europe identified by morphology as S. bombyx: one from the North and the Norwegian seas (referred to as S. cf. bombyx), and another from Brittany, northern France, and the Bay of Biscay, northern Spain (referred to as S. cf. convexus). The p-distances among individuals of these groups ranged from 12.73% to 14.98%. The ingroup p-distance values ranged from 0.00% to 1.5% and from 0.75% to 1.87%, respectively.
Horned Spiophanes from the North Pacific formed a well supported clade (PP = 1) closely related to the clade of horned Spiophanes (S. cf. bombyx—S. cf. convexus) from northern Europe. The relationships within the North Pacific clade were partially resolved, with one clade well supported (PP = 0.97), comprising one group of specimens from California, USA, and Baja California Norte, Mexico (referred to as S. norrisi according to the type locality of the species in Baja California Sur, Mexico), and another group S. uschakowi from the Sea of Japan (East Sea). The p-distances between individuals of these groups ranged from 6.74% to 8.99%. The rest of the specimens within the North Pacific clade did not form a monophyletic group, but, according to the results of the five-genes analysis (see below), they are referred to S. hakaiensis n. sp. The three groups of North Pacific Spiophanes did not share any haplotype (Fig 1A).
Two sister groups were revealed among specimens from northern Europe identified by morphology as S. kroyeri: one from the Barents Sea and northern part of the North Sea (tentatively referred to as S. cf. kroyeri), and another from the northern and central parts of the North Sea and from Bay of Biscay, northern Spain (tentatively referred to as S. cf. cirrata). The p-distances between individuals of these groups ranged from 6.37% to 8.61%. The ingroup p-distance values ranged from 0.00% to 1.12% and from 0.75% to 1.5%, respectively.
Five-genes analysis (COI, 16S, 18S, 28S, and Histone 3)
The five-genes analysis did not include sequences provided by Meißner & Blank [111] because they were too short and did not fit the accepted criteria (COI > 500 bp, 18S > 1600 bp). The combined alignment, with gaps excluded, comprised in total 3018 bp, including 244 bp (93.5%) for 16S rDNA, 1656 bp (99%) for 18S rDNA, and 287 bp (98.6%) for 28S rDNA, 297 bp (100%) for Histone 3 and 534 bp (100%) for COI. It contained 677 (22.4%) variable sites, of which 615 (20.4%) sites were informative. The average p-distances for the individual gene fragments between taxa are given in S3–S7 Tables. The Bayesian analysis resulted in a fully resolved tree with high support of all branches (Fig 2B).
Fig 2. Phylogenetic results.
(A) One branch from the Bayesian inference analysis of 18S (406 bp) sequences obtained in the present study and provided by Meißner & Blank [111]. (B) Majority rule consensus tree of the Bayesian inference analysis of the combined COI (534 bp), 16S (244 bp), 18S (1656 bp), 28S (287 bp), and Histone 3 (297 bp) sequences (3018 bp in total) of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. Posterior probabilities are shown on the branches. Species names are followed by the names of the collecting locations. Information about numbers with letters following specific names are given in Table 1. The numbers without letters following specific names are unique numbers from the VIR database linking the individuals on the tree with the sampling data in the S1 Table.
The analysis revealed two sister groups among specimens from northern Europe identified by morphology as S. bombyx. Specimens from the North and the Norwegian seas (referred to as S. cf. bombyx) were genetically close to single examined specimen of S. bombyx from Venice Lagoon, Adriatic Sea, Italy (p-distances ranging from 00% for 28S to 2.46% for 16S). Specimens from Brittany, northern France, and the Bay of Biscay, northern Spain, are referred to as S. cf. convexus. The p-distances between individuals of S. cf. bombyx and S. cf. convexus ranged from minimal 0.3% for 18S rDNA to maximal 14.07% for COI. The maximum ingroup p-distance values were for COI sequences: 0.94% and 1.69%, respectively.
Horned Spiophanes from the North Pacific formed three distinct groups within a clade sister to the European horned Spiophanes. The groups comprised S. uschakowi from the Sea of Japan (East Sea), worms from Alaska to San Francisco Bay, California, described below as S. hakaiensis n. sp., and worms from San Francisco Bay, California, and Baja California Norte, Mexico, referred to S. norrisi. Spiophanes uschakowi and S. hakaiensis n. sp. formed a clade sister to S. norrisi. The p-distances between individuals of S. uschakowi and S. hakaiensis n. sp. ranged from minimal 0.91% for 18S rDNA to maximal 7.68% for COI. The maximum ingroup p-distance values were for COI sequences: 0.94% and 1.12%, respectively.
Three groups were distinguished among specimens identified by morphology as S. kroyeri: one from the Barents Sea and northern part of the North Sea (referred to as S. cf. kroyeri), second from the northern and central parts of the North Sea and from the Bay of Biscay, northern Spain (referred to as S. cf. cirrata), and a third from the Southern Ocean (referred to as S. aff. kroyeri). The S. cf. kroyeri group appeared sister to S. cf. cirrata. The average p-distances for the individual gene fragments between these groups are given in S3–S7 Tables. Spiophanes aff. kroyeri appeared distant from the clade S. kroyeri—S. cf. cirrata.
Two sister groups were revealed among specimens identified by morphology as S. duplex: one from California, USA (referred to as S. duplex), and another from Paraná, Brazil (referred to as S. soederstroemi). The p-distances between individuals of these groups ranged from 0.18% for 18S to 5.05% for Histone 3.
Horned Spiophanes with metameric nuchal organs formed a clade sister to the clade of Spiophanes with bell-shaped prostomium and nuchal organs as a pair of long parallel ciliary bands extending over about 15 anterior chaetigers (Fig 2B).
The analysis showed identity (p-distance = 0.00%) of 18S and 28S rDNA sequences of Trochochaeta multisetosa from Norway, Sweden and California, USA.
An additional analysis showed identity (p-distance = 0.00%) of our sequence of S. berkeleyorum from Southern California and short fragments of 18S rDNA (490 bp) of S. berkeleyorum from Northern California obtained by Meissner & Blank [111] (Fig 2A).
Divergence time estimation
The alignment of COI sequences obtained in the present study and those from GenBank and BOLD comprised 534 bp with 170 (31.8%) variable sites, of which 160 (94.1%) sites were parsimony informative. The BEAST analysis resulted in a fully resolved consensus tree (Fig 3) with the same topology as the tree from the five-genes Bayesian analysis (Fig 2B). The analysis suggested that the origin of the most recent common ancestor of horned Spiophanes with metameric nuchal organs was around 11.1 mya (95% HPD: 5.1–19.0 mya) and that the divergence of the North Atlantic and North Pacific lineages was around 7.9 mya (95% HPD: 4.1–13.3 mya). The North Atlantic lineage was estimated to have diverged 4.8 mya (95% HPD: 2.2–8.6 mya), resulting in the origin of S. cf. bombyx and S. cf. convexus. The North Pacific lineage was estimated to have diverged first by the isolation and speciation of S. norrisi 1.7 mya (95% HPD: 2.3–1.0 mya), then by the isolation and speciation of S. uschakowi and S. hakaiensis n. sp. 1.3 mya (95% HPD: 2.0–0.7 mya).
Morphology and biology
Spiophanes bombyx (Claparède, 1870)
Spio bombyx Claparède, 1870a [9]: 485–487, pl XII, Figs 2, 2A–2H; [10]: 121–123, pl XII, Figs 2, 2A–2H. Fide Mesnil [11].
Spiophanes bombyx: Fauvel [140] (Part.): 41. Rullier [141]: 209. Bhaud [142]: 235; [143]: 290–291, 306 (larval phenology). Katzmann [144]: 133. Cognetti-Varriale & Zunarelli-Vandini [145]: 42. Gambi & Giangrande [146]: 851. Sardá [147]: 346. Somaschini [148]: 223. Martin et al. [149]: 5. Simboura & Nicolaidou [150]: 87. Aleffi et al. [151]: 221. Ayari & Afli [152]: 89; [153]: 73. Dagli et al. [154]: 155. Castelli et al. 20[155]08: 357. Meißner [8] (Part.): 54–58. Meißner & Blank [111] (Part.): 7–11, Figs 3 and 4C. Mutlu et al. [156]: 32. Lorenti et al. [157]: 331. Serrano et al. [158]: 339. Çinar et al. [159]: 2114; [160]: 1462. Mikac [161]: 123. Delgado-Blas et al. [162] (Part.): 340.
Type material. ITALY, Tyrrhenian Sea, Gulf of Naples, presumably 40.8287°N, 14.2474°E, types lost.
Synopsis. Up to 38 mm long, 1 mm wide for 120 chaetigers. Prostomium with long fronto-lateral horns, posteriorly pressed into chaetiger 1 but not extending over it as caruncle. Occipital antenna absent. Nuchal organs metameric, on a series of anterior chaetigers; first pair of metamers as oblique ciliary bands from prostomium to end of chaetiger 2; succeeding metamers shorter. Sabre chaetae in neuropodia from chaetiger 15. Hooks in neuropodia from chaetiger 15, usually quadridentate, with small subterminal hood. Pygidium with small ventral fleshy pad and one pair of lateral cirri. Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9, gradually increasing in size from chaetiger 10 to chaetigers 12–13, slightly smaller again in chaetiger 14. Internal fibres long and coiled in glandular organs in chaetigers 5–8, straight, shorter and thinner in chaetigers 9–14. Organs on chaetigers 5, 7 and 8 each opening to exterior via semicircular to suboval slit around large fiber spreader, on chaetiger 6 via small round hole, on chaetigers 9–14 via large vertical slit. Frontal edge of each fiber spreader on chaetigers 5, 7 and 8 entire, rounded to blunt, or with variously developed middle depression vaguely separating two rounded lobes. Digestive tract with gizzard-like structure. Main dorsal blood vessel with heart body. Nephridia from chaetiger 15 onwards. Gonochoristic. Oocytes lentiform, each with honeycombed envelope and 18–20 cortical alveoli regularly arranged in a peripheral circle. Spermatids interconnected in tetrads. Spermatozoa short-headed aqua-sperm with plate-like acrosomes. Fertilization in sea water. Larval development holopelagic, planktotrophic. Larvae with two pairs of red eyes on prostomium and a midventral ciliated pit on chaetiger 2.
Remarks. In the original description of S. bombyx, Claparède ([9]: 485, as Spio bombyx) noted that “It does not seem rare in Naples. At least, it lives in numerous societies. I received hundreds of them one day, lodged side by side in tubes of black mud.” He reported worms up to 38 mm long, 1 mm wide. The type material of S. bombyx does not exist any longer, probably because Claparède did not deposit the examined specimens at any museum. After Claparède, the species has rarely been reported from Italy and seems not to be very common in the Gulf of Naples at present. We were unable to find a sequence of S. bombyx from the Mediterranean in the literature. We collected one individual of S. bombyx from Venice Lagoon, Italy, and sequenced it for 16S and 28S gene fragments (see Table 1).
Morphological examination and molecular analysis of horned Spiophanes performed in the present study discovered two sibling species in northern European waters which we refer to as S. cf. bombyx and S. cf. convexus. Their morphology, taxonomy and the distribution are discussed below. It seems plausible that S. bombyx does not occur in northern European waters and that its distribution is limited to the Mediterranean only. To avoid confusion in identification of specimens based on morphological characters only, especially in areas of possible overlap of the species, and until more molecular data has been obtained from specimens from the Gulf of Naples, we suggest that northern European horned Spiophanes are referred to as S. bombyx aggregate (S. bombyx agg.), rather than to a particular species.
Distribution. Mediterranean Sea (Fig 4A).
Fig 4. Maps showing records of Spiophanes spp. in North Atlantic Ocean and Mediterranean Sea.
(A) Spiophanes bombyx (Claparède, 1870) (red and green symbols): red star–type locality: Gulf of Naples, Tyrrhenian Sea, Italy; red triangle–single specimen sequenced in the present study; green circles–adults identified based on the morphology only. Spiophanes cf. bombyx (yellow and pink symbols): pink triangles–specimens sequenced in the present study; pink squares–specimens sequenced by Meißner & Blank [111]; yellow circles–adults identified based on the morphology only. Spiophanes convexus (turquoise symbols): turquoise star–type locality of S. convexus: Meira, Pontevedra, Galicia, Spain; turquoise rhomb–S. cf. convexus sequenced by Aylagas et al. ([121], as S. bombyx); turquoise triangles–S. cf. convexus sequenced in the present study; turquoise circles–adults identified based on the morphology only. (B) Spiophanes kroyeri Grube, 1860 (red, green and yellow symbols): red star–type locality: Greenland Sea, off Iceland; yellow circles–adults identified based on the morphology only; green triangles–S. cf. kroyeri sequenced in the present study; green square–S. cf. kroyeri sequenced by Meißner & Blank ([111], as S. kroyeri). Spiophanes cirrata M. Sars in G.O. Sars, 1872 (turquoise symbols): turquoise star–type locality: Drøbak, Oslofjord, Norway; turquoise squares–S. cf. cirrata sequenced by Meißner & Blank ([111], as S. kroyeri); turquoise rhombs–S. cf. cirrata sequenced by Aylagas et al. ([121], as S. kroyeri). Spiophanes reyssi Laubier, 1964: pink star–type locality: NE Lacaze-Duthiers, Gulf of Lion, Mediterranean France.
Spiophanes cf. bombyx (Claparède, 1870). Figs 5–8.
Fig 5. Adult morphology of Spiophanes cf. bombyx (Norway, MIMB 36701).
(A), Chaetigers 4–20, dorsal view, showing light brownish lateral sides of chaetigers 9–14. (B) Chaetigers 5–16, ventral view, showing arrangement of glandular organs in chaetigers 5–14 and light brownish lateral sides of chaetigers 10–14. (C) Anterior end, ventral view. (D) Posterior end, left lateral view. Abbreviations: ch5–ch15 –chaetigers 5–15; fh–fronto-lateral horn; lp–lateral peristomial lip; py–pygidial cirrus; sp–notopodial spine with recurved distal end. Scale bars: A– 300 μm; B– 200 μm; C, D– 50 μm.
Fig 8. Gametes of Spiophanes cf. bombyx (Norway, MIMB 36701).
Formalin-fixed specimens stained with an alcohol solution of methyl green. (A) Oocytes in chaetigers 21–25; right-side coeloms in left lateral view. (B) Coelomic oocytes in chaetigers 20 and 21. (C–E) Coelomic oocytes of different shape. (F) Coelomic spermatozoa. Abbreviations: ca, cortical alveoli; en, oocyte envelope; n, nucleus; nu, nucleolus. Scale bars: A– 300 μm; B–E– 20 μm; F– 10 μm.
Spiophanes bombyx: McIntosh [15]: 182–186; [16]: pl XCIII, Fig 1, pl XCVI, Fig 14, pl XCVII, Fig 6, pl XCVIII, Fig 10, pl CV, Fig 9, pl CVI, Fig 9, pl CVII, Fig 16. Söderström [21]: 243–244, Fig 135. Fauvel [140]: 41, Figs 14a–i. Thorson [25]: 91–92, Fig 44 (larval morphology). Hannerz [163]: 33–36, Fig 9 (larval morphology). Hartmann-Schröder [164]: 327–329, Fig 112; [165]: 341–342, Fig 156. Böggemann [32]: 121. Meißner [8] (Part.): 54–58, Fig 35. Meißner & Blank [111] (Part.): 7–11, Figs 2, 4A, B, D. Delgado-Blas et al. [162] (Part.): 340.
Adult morphology (based on specimens from the Norwegian and North Seas, and around the British Isles and Iceland). McIntosh [15] noted that worms from St Andrews, Scotland, UK, were about 3 inches (76 mm) long for about 180 chaetigers; Meißner & Blank [111] examined specimens 0.2–1.5 mm wide.
Worms examined in the present study 0.3–1.5 mm wide, up to 30 mm long for 120 chaetigers. Pigmentation absent on body and palps. In large formalin-fixed specimens, lateral sides of chaetigers 9–14 (until chaetigers 16–17 in large specimens) light brownish-red due to fixed internal content of large, probably glandular, epithelial cells (Fig 5A and 5B).
Prostomium triangular, wide anteriorly, with a pair of long, distally pointed fronto-lateral horns (Fig 5C), posteriorly narrowed, pressed into chaetiger 1 but not extending over as a caruncle. Peristomium with narrow lateral lips closely applied to lateral sides of prostomium (Fig 5C), and a small ventral lip. Two pairs of small dark red eyes usually present; occasionally eyes absent. Occipital antenna absent. Palps as long as 7–15 chaetigers.
Nuchal organs metameric, at least on 20 anterior chaetigers, fewer in small individuals. First pair of metamers long, oblique ciliary bands extending from posterior part of prostomium to end of chaetiger 2, shorter in small individuals; posterior ends of metamers set wider apart. Succeeding metamers shorter, each extending from nototroch over posterior half of chaetiger, oriented parallel to body axis until chaetigers 13–14, oblique on succeeding chaetigers.
Notochaetae capillaries, long on four anterior chaetigers and on posterior chaetigers, shorter on middle chaetigers. Neuropodia of chaetiger 1 each with 1–2 heavy recurved, crook-like spines in addition to capillaries (Fig 6A). Notopodia of 5–10 posterior chaetigers each with 1–3 (usually one) long recurved spines in addition to capillaries (Fig 6E).
Fig 6. Chaetal morphology of Spiophanes cf. bombyx (Norway, MIMB 36701).
(A) Crook-like spine in neuropodium of chaetiger 1. (B) Hooded hooks and a fragment of sabre chaeta from neuropodium of a middle chaetiger, lateral view. (C) Hooded hooks from neuropodium of a middle chaetiger, frontal view. (D) Hooded hooks, hair-like alimbate capillary chaeta, and a sabre chaeta from neuropodium of a posterior chaetiger, lateral view. (E) Simple capillary chaeta and two spines with recurved distal ends from posterior notopodia. Abbreviations: ca–capillary chaeta; hh–hooded hook; ho–subdistal hood below main fang of hook; sa–ventral inferior sabre chaeta. Scale bars: A, E– 20 μm; B–D– 10 μm.
Sabre chaetae in neuropodia from chaetiger 15, one or rarely two in a tuft, with narrow limbation and fine granulation on distal part (Fig 6B–6D).
Hooks in neuropodia from chaetiger 15, up to 10 in a series, accompanied by inferior sabre chaetae throughout body and 1–2 short hair-like alimbate capillaries in 5–10 posterior chaetigers; hair-like capillaries in posterior neuropodia usually situated in upper and/or lower parts of hook row (Fig 6D). Hooks usually quadridentate, with three small upper teeth above main fang and small subterminal hood below main fang (Fig 6B–6D); median upper tooth occasionally weakly developed or double.
Pygidium with small fleshy ventral pad and one pair of thin long lateral cirri (Fig 5D).
Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9 and gradually increasing in size from chaetiger 10 to chaetigers 12–13, slightly smaller again in chaetiger 14 (Figs 5B and 7A–7F); large organs occupying most of chaetiger space. Internal fibres long and coiled in glandular organs in chaetigers 5–8 (Fig 7B and 7C), straight, shorter and thinner in chaetigers 9–14; in fixed specimens, long straight fibers usually protruding from openings of glandular organs on chaetiger 6. Each organ on chaetigers 5, 7 and 8 opening to exterior via semicircular to suboval slit around large fiber spreader, on chaetiger 6 via small round hole, and on chaetigers 9–14 via large vertical slit. Frontal edge of fiber each spreader on chaetigers 5, 7 and 8 entire, rounded to blunt, or with variously developed middle depression vaguely separating two rounded lobes.
Fig 7. Glandular organs of Spiophanes cf. bombyx (Norway, MIMB 36701).
Right-side organs in left lateral view; formalin-fixed specimen stained with an alcohol solution of methyl green. (A) arrangement of glandular organs in chaetigers 5–14; organs withdrawn from chaetigers 10 and 12. (B) Chaetiger 5. (C) Chaetiger 7. (D) Chaetiger 9. (E) Chaetiger 13. (F) Chaetiger 14. Abbreviations: ch5–ch13 –chaetigers 5–13; fi–fibers produced by glandular organs. Scale bars: A– 100 μm; B–F– 50 μm.
Digestive tract with gizzard-like structure beginning from chaetigers 15–20 and extending through 2–3 chaetigers.
Main dorsal blood vessel with heart body 10–20 μm in diameter.
Nephridia from chaetiger 15 onwards.
Methyl green staining. Intensely stained lateral sides of chaetiger 6; weakly stained lateral sides of chaetiger 5. This pattern was observed in small and large specimens from the North and Norwegian seas. In large specimens, the dorsal side of the prostomium and lateral sides of the peristomium were usually also intensely stained.
Reproduction. Spiophanes cf. bombyx is gonochoristic. The gametes proliferate in paired gonads attached to the genital blood vessels from chaetigers 18–19 to chaetigers 100–110. In females, oogenesis is intraovarian: vitellogenesis occurs when the oocytes grow in ovaries. The developed oocytes are accumulated in the coelomic cavity prior to spawning (Fig 8A). The largest intraovarian oocytes examined in fixed specimens from Norway were of irregular shape, up to 105 μm in diameter, each with a honey-combed envelope 3–4 μm thick, 45–55 cortical alveoli regularly arranged in a peripheral circle, a nucleus about 55 μm in diameter, and a single nucleolus about 20 μm in diameter. The cortical alveoli were pear-shaped, up to 8 μm long and 5 μm in diameter, with narrow necks oriented perpendicular to the oocyte surface (Fig 8B–8E).
In males, spermatogonia proliferate in testes and the rest of spermatogenesis occurs in the coelomic cavity. Spermatids are interconnected in tetrads. The spermatozoa are ect-aquasperm with a short plate-like acrosome, subspherical nucleus about 3 μm in diameter, very short midpiece, and a long flagellum (Fig 8F).
Females and males release their gametes into the water where fertilization and holopelagic, planktotrophic larval development occur. Larvae have two pairs of red eyes on the prostomium and a midventral ciliated pit on chaetiger 2 (see Hannerz [163]: Fig 9a, 9b).
Remarks. Horned Spiophanes from the North and Norwegian seas morphologically appear similar to the individual from the Adriatic Sea and almost fit the original and later descriptions of S. bombyx from the Mediterranean. All the adults have sabre chaetae and hooks in neuropodia from chaetiger 15 onwards. They differ, however, in the number of cortical alveoli which are regularly arranged in the peripheral circle in mature oocytes. Claparède ([9]: 486, pl 12, Fig 2E, 2F) noted that in worms from the Gulf of Naples the developed oocytes were lentiform (sphéroïdes aplatis), up to 130 μm in diameter, with thick papillary envelope, a large spherical germinal vesicle and a spherical nucleolus; 18 to 20 colorless cortical alveoli (“vésicules inclores” in his terminology), each about 11 μm in diameter, were arranged in a large circle. We observed 45–55 alveoli per oocyte in worms from the Norwegian Sea (Fig 8B–8E). Sequences of the North European and single Italian specimen obtained in the present study were similar (p-distances ranging from 00% for 28S to 2.46% for 16S). Nevertheless, because of the difference in the number of cortical alveoli in oocytes (which is supposed to be species specific and variable within a small range), and the interrupted distribution of the North European and the Mediterranean populations (see below S. cf. convexus), we suggest that the conspecificity of these populations should be verified in additional molecular analysis based on sequences of more genes and more individuals. Pending molecular data, we refer to the specimens from the North and Norwegian seas, and also from around Iceland and British Isles as S. cf. bombyx.
The larvae and juveniles of S. cf. bombyx were described from Frederikshavn, NW Kattegat, Denmark, by Thorson [25] and from Gullmar Fjord, Sweden, by Hannerz [163]. Hannerz [163] noted that in Gullmar Fjord 18-chaetiger juvenile about 1.3 mm long had characteristic recurved spines in neuropodia of chaetiger 1, and hooks in neuropodia from chaetiger 13.
Distribution. Northern Europe (southern limits uncertain) (Fig 4A).
Spiophanes cf. convexus Delgado-Blas et al., 2019. Figs 9 and 10A.
Fig 9. Adult morphology of Spiophanes cf. convexus (Brittany, France, MIMB 28155).
(A, B) Formalin-fixed specimens stained with an alcohol solution of methyl green; palps missing. (A) Anterior end, left lateral view. (B) Chaetigers 5–13, left lateral view, showing specific pattern of methyl green staining. (C, D) Anterior ends, dorsal view, showing various shape of prostomium; palps missing. (E) Long thick fibers produced by glandular organ of chaetiger 6, protruding from hole-like opening of the organ. (F) Crook-like spines in neuropodium of chaetiger 1. (G) Hooded hooks from neuropodium of a middle chaetiger. (H) Posterior end, dorsal view. I, same, ventral view. Abbreviations: ch6, ch8 –chaetigers 6 and 8; fh–fronto-lateral horn; hh–hooded hook; lp–lateral peristomial lip; sa–ventral inferior sabre chaeta. Scale bars: A– 500 μm; B–D– 300 μm; E, F– 50 μm; G– 20 μm; H, I– 100 μm.
Fig 10. Methyl green staining patterns in formalin-fixed specimens of Spiophanes spp.
(A) S. cf. convexus (MIMB 36704, Brittany, France), chaetigers 2–8, left lateral view. (B) S. uschakowi (MIMB 36677, Sakhalin Is., Sea of Okhotsk), chaetigers 4–7, left lateral view. (C) S. cf. norrisi (MIMB 3986, Chile), chaetigers 5–11, left lateral view. (D) S. hakaiensis n. sp. (MIMB 36709, British Columbia, Canada), chaetigers 3–7, left lateral view. (E) S. norrisi (MIMB 28153, San Diego, California, USA), chaetigers 4–8, left lateral view. Abbreviations: ch6 –chaetiger 6. Scale bars: A, B– 200 μm; C–E– 100 μm.
?Spiophanes convexus Delgado-Blas et al. 2019 [162]: 344–347, Figs 5, 6.
Spiophanes bombyx:? Cazaux [166]: 207–210, pl 68, Figs 1–6. Meißner [8] (Part.): 54–58, Figs 33, 34. Meißner & Blank [111] (Part.): 7–11. Aylagas et al. [121]: S1 Table. Not Claparède [9, 10].
Type material. SPAIN, Galicia, Pontevedra: N° 9 Meira, 42.2833°N, 8.7167°W, Jun 76, MNCN 16.01/18442 (holotype); N° 10 Meira, 42.2833°N, 8.7167°W, Jun 76, MNCN /16.01/18444 (2 paratypes). Andalusia, Huelva, mouth of River Piedras, M.2, 37.2°N, 7.1167°W, 1988, MNCN 16.01/18443 (11 paratypes).
Adult morphology (based on our material from Brittany, France). Up to 30 mm long, 1 mm wide for 120 chaetigers. Pigmentation absent on body and palps. In formalin-fixed specimens, lateral sides of chaetigers 9–14 (until chaetigers 16–17 in large specimens) light brownish due to fixed internal content of large, probably glandular, epithelial cells.
Prostomium triangular, wide anteriorly, with a pair of distally pointed fronto-lateral horns, posteriorly narrowed, pressed into chaetiger 1 but not extending over as a caruncle. Fronto-lateral horns long (Fig 9C) or moderately developed (Fig 9D). Peristomium with narrow lateral lips closely applied to lateral sides of prostomium, and a small ventral lip. Two pairs of small dark red eyes present or eyes absent. Occipital antenna absent. Palps as long as 7–15 chaetigers.
Nuchal organs metameric, at least on 40 anterior chaetigers, fewer in small individuals. First pair of metamers long oblique ciliary bands extending from posterior part of prostomium to end of chaetiger 2; posterior ends of metamers set wider apart. Succeeding metamers shorter, each extending from nototroch over posterior half of chaetiger, oriented parallel to body axis until chaetigers 10–11, slightly oblique on succeeding chaetigers. Epithelial cells around nuchal patches with dark yellow pigment in life.
Notochaetae capillaries, long on four anterior chaetigers and on posterior chaetigers, shorter on middle chaetigers. Neuropodia of chaetiger 1 each with 1–2 heavy recurved, crook-like spines in addition to capillaries (Fig 9F). Notopodia of 5–10 posterior chaetigers each with 1–2 (usually one) long recurved spines in addition to capillaries (Fig 9H).
Sabre chaetae in neuropodia from chaetiger 15, one or rarely two in a tuft, with narrow limbation and fine granulation on distal part.
Hooks in neuropodia from chaetiger 15, up to 10 in a series, accompanied by inferior sabre chaetae throughout body and 1–2 short hair-like alimbate capillaries in 5–10 posterior chaetigers; hair-like capillaries in posterior neuropodia usually situated in upper and/or lower parts of hook row. Hooks usually quadridentate, with three small upper teeth above main fang and small subterminal hood below main fang (Fig 9G).
Nototrochs from chaetiger 1 to end of body; on each of chaetigers 1 and 2 as two short, oblique ciliary bands situated between notopodial postchaetal lamellae and nuchal ciliary bands; from chaetiger 3 through most succeeding chaetigers as complete transverse bands of dense cilia running between notopodial postchaetal lamellae. Each nototroch composed of two parallel rows of large transversally elongated cells, each bearing numerous long cilia; nototroch ciliation stronger on ridge-bearing chaetigers. Single transverse rows of smaller cells with shorter cilia present on each chaetiger beginning from chaetiger 3.
Dorsal transverse ridges present from chaetigers 14–15 to chaetigers 40–50, fewer in small individuals. Ridges thick, fleshy, one per chaetiger, not connected to notopodial lamellae. Wide blood vessel extending along each ridge internally; double nototroch with numerous long cilia arranged on top of each ridge. Intersegmental lateral pouches absent.
Pygidium with small fleshy ventral pad and one pair of thin long lateral cirri (Fig 9H and 9I).
Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9 and gradually increasing in size from chaetiger 10 to chaetigers 12–13, slightly smaller again in chaetiger 14; large organs occupying most of chaetiger space. Internal fibres long and coiled in glandular organs in chaetigers 5–8, straight, shorter and thinner in chaetigers 9–14; in fixed specimens, long straight fibers usually protruding from openings of glandular organs on chaetiger 6 (Fig 9E). Each organ on chaetigers 5, 7 and 8 opening to exterior via semicircular to suboval slit around large fiber spreader, on chaetiger 6 via small round hole, and on chaetigers 9–14 via large vertical slit (Fig 9A, 9B and 9E). Frontal edge of each fiber spreader on chaetigers 5, 7 and 8 entire, rounded to blunt, or with variously developed middle depression vaguely separating two rounded lobes.
Digestive tract with gizzard-like structure beginning from chaetigers 15–20 and extending through 2–3 chaetigers.
Main dorsal blood vessel with heart body 10–20 μm in diameter.
Nephridia from chaetiger 15 onwards.
Methyl green staining. Intensely stained lateral sides of chaetiger 6; weakly stained lateral sides of chaetigers 8–14; no staining on head or chaetigers 1–5, 7 (Figs 9A, 9B and 10A).
Remarks. Horned Spiophanes from Brittany, northern France, morphologically appear very similar or almost identical to S. bombyx from the Mediterranean and S. cf. bombyx from the North and Norwegian seas, but unambiguously differ from them in genetic characteristics (Figs 1B and 2B). They weakly differ from North European specimens also by the pattern of MG staining: no staining on head and five anterior chaetigers in S. cf. convexus, and staining on chaetiger 5 and often on the prostomium and peristomium in S. cf. bombyx. However, these patterns are variable and can only be seen in well preserved specimens.
Delgado-Blas et al. [162] described S. convexus based on the morphology of a few anterior fragments from Atlantic Spain (Galicia and Andalusia), and also from Mediterranean Spain (Catalonia). The diagnostic characters used to distinguished S. convexus from S. bombyx were ambiguous and fit into the range of morphological variability of S. bombyx, which was not examined by Delgado-Blas et al. [162]. Based on the proximity of the type locality of S. convexus (Meira, Pontevedra, Galicia) and sampling sites of specimens examined through molecular analysis in the present study, we assume that our specimens from Brittany, France, and specimens from Bay of Biscay sequenced by Aylagas et al. [121] belong to S. convexus. In the absence of sequence data of S. convexus, however, we refer our specimens to as S. cf. convexus. The identity of the horned Spiophanes from Catalonia, Spain, referred by Delgado-Blas et al. [162] to as S. convexus, should be verified in molecular analysis. So far, based on available data, we consider S. bombyx as the only horned species occurring in the Mediterranean.
To avoid confusion in identification of specimens based on morphological characters only, especially in areas of possible overlap of S. bombyx and S. convexus, and until more molecular data has been obtained from specimens from the Gulf of Naples, we suggest that North European horned Spiophanes are referred to as S. bombyx aggregate (S. bombyx agg.), rather than to a particular species.
Mesnil [11] described in detail adults and larvae of S. bombyx from Wimereux, Hauts-de-France, northern France. He noted that the adults were up to 6 cm long, 1.5 mm wide for about 180 chaetigers. They had hooks beginning invariably from chaetiger 15, whereas in larvae hooks started from chaetigers 11–14. Wimereux is located midway between the sites where S. cf. bombyx and S. cf. convexus were collected for molecular analysis. Because Mesnil’s [11] description fits both species, the identity of the worms described by him from Wimereux remains uncertain.
Cazaux [166] described in detail the larval development of a horned Spiophanes from Arcachon, France, which he identified as S. bombyx. He noted that in an early benthic 15-chaetiger juvenile, hooks were not yet developed, and in a 19-chaetiger juvenile they were present in chaetigers 13–19. Arcachon is located between sites where specimens of S. cf. convexus were collected for molecular analysis. It is plausible, therefore, that Cazaux [166] dealt with S. convexus but not S. bombyx.
Distribution. Western Europe (northern and southern limits uncertain) (Fig 4A).
Spiophanes uschakowi Zachs, 1933. Figs 10B and 11–14
Fig 11. Adult morphology of Spiophanes uschakowi (Peter the Great Bay, Russia, USNM 183505).
(A) Anterior end, frontal view. (B) Same, left lateral view. (C) Same, dorsal view, palps missing. (D) Same, ventral view. (E) Posterior end, left lateral view. (F) Chaetigers 7–11, dorsal view, showing longitudinal nuchal metamers, nototrochs and intersegmental transverse bands of cilia. (G) Chaetigers 12–15, dorsal view, showing oblique nuchal metamers, nototrochs and intersegmental transverse bands of cilia. (H) Palp, fronto-lateral view, showing frontal longitudinal ciliated groove. Abbreviations: ch5, ch7, ch15 –chaetigers 5, 7, 15; cr–crook-like spine in neuropodium of chaetiger 1; fh–fronto-lateral horn; lp–lateral peristomial lip; nt–nototroch; nu–nuchal organ; pa–palp scar; pr–prostomium; py–pygidial cirrus; sp–notopodial spine with recurved distal end; tc–intersegmental transverse cilia; vp–ventral peristomial lip. Scale bars: A– 50 μm; B–H– 100 μm.
Fig 14. Glandular organs of Spiophanes uschakowi (Sakhalin Is., Sea of Okhotsk, MIMB 36677).
(A) Schematic composition of parapodia and shape of openings of glandular organs on neuropodia of chaetigers 5–9: suboval openings with one-lobe chaetal spreader on chaetigers 5, 7 and 8; small hole on chaetiger 6; and a vertical slit on chaetiger 9. (B–G) Morphology of glandular organs in chaetigers 5–12, right-side organs in left lateral view, formalin-fixed specimen stained with an alcohol solution of methyl green. (B) Chaetigers 5–12. (C) Chaetiger 5. (D) Chaetiger 7. (E) Chaetiger 8. (F) Chaetiger 9. (G) Chaetiger 10. Abbreviations: ch5–ch12 –chaetigers 5–12; fi–fibers produced by glandular organs; lo–lateral sensory ciliated organ; ne–neuropodial postchaetal lamella; no–notopodial postchaetal lamella. Scale bars: B– 200 μm; C–G– 100 μm.
Spiophanes uschakowi Zachs, 1933 [112]: 130. Meißner [8]: 61. Meißner & Blank [111]: 15–17, Fig 7. Buzhinskaja [84]: 61. Radashevsky et al. [167]: 33–39, Figs 1–6 (gamete ultrastructure).
Spiophanes uschakovi [sic]: Annenkova [168]: 140; [113]: 172–173. Uschakov [78]: 267.
Spiophanes bombyx: Okuda [76]: 222–223, Figs 3, 4. Annenkova [113]: 172. Uschakov [77]: 200; [78]: 267; [169]: 205. Pasternak [170]: 267. Imajima & Hartman [80]: 289–290. Buzhinskaja [114]: 103; [83]: 135; [84]: 61. Koblikov [171]: 39. Ozolinsh [172]: 82–83. Imajima [88]: 128–132, Figs 8, 9; [116]: 129; [117]: 80; [118]: 379. Buzhinskaja & Britayev [115]: 85. Ozolinsh & Bagaveeva [173]: 139. Not Claparède [9, 10].
Spiophanes sp.: Radashevsky [174]: Figs 1F, 5D, 7B, 10D.
Type material. RUSSIA, Primorsky Region, Sea of Japan (East Sea), Peter the Great Bay, 42.835°N, 131.74°E, dredge, 26–30 m, fine sand, coll. K.M. Derjugin, 11 Oct 1925, ZISP 1/25826 (2 syntypes).
Adult morphology. Up to 47 mm long, 1.5 mm wide for 140 chaetigers. Pigmentation absent on body and palps. A pair of narrow transverse whitish bands, concentrations of epithelial glandular cells, visible on ventral side of chaetiger 1 in live individuals. In large formalin-fixed specimens, lateral sides of chaetigers 9–14 (until chaetigers 16–17 in large specimens) light brownish-red due to fixed internal content of large, probably glandular, epithelial cells.
Prostomium triangular, wide anteriorly, with a pair of long, distally pointed fronto-lateral horns (Fig 11A–11D), posteriorly narrowed, pressed into chaetiger 1 but not extending over it as a caruncle. Peristomium with narrow lateral lips closely applied to lateral sides of prostomium, and a small ventral lip (Fig 11B–11D). Two pairs of small dark red eyes arranged trapezoidally, comprising one pair of median eyes and one pair of lateral eyes situated anteriorly and set wider apart; occasionally eyes absent. Occipital antenna absent. Palps as long as 7–15 chaetigers, with deep frontal longitudinal groove lined with fine cilia, fronto-lateral motile compound cilia bordering frontal groove, short transverse rows of short motile compound cilia regularly arranged on inner lateral side and beating towards frontal groove, short compound non-motile cilia arising directly from palp surface and scattered on lateral and abfrontal palp surfaces (Fig 11H).
Nuchal organs metameric, at least on 25 anterior chaetigers, fewer in small individuals. First pair of metamers long oblique ciliary bands extending from posterior part of prostomium to end of chaetiger 2, shorter in small individuals; posterior ends of metamers set wider apart (Fig 11C). Succeeding metamers shorter, each extending from nototroch over posterior half of chaetiger, oriented parallel to body axis until chaetigers 9–10 (Fig 11F), oblique on succeeding chaetigers (Fig 11G).
Notochaetae capillaries, long on four anterior chaetigers and on posterior chaetigers, shorter on middle chaetigers. Neuropodia of chaetiger 1 each with 1–2 heavy recurved, crook-like spines in addition to capillaries (Figs 11A–11C and 12A). Notopodia of 5–10 posterior chaetigers each with 1–3 (usually one) long spines with recurved distal end in addition to capillaries (Fig 11E). Noto- and neuropodial postchaetal lamellae on four anterior chaetigers subtriangular, with pointed tips (Figs 11A–11D and 12A); notopodial lamellae on succeeding middle chaetigers short, subulate (Fig 11F and 11G), on posterior chaetigers long, cirriform (Fig 11E). Neuropodial postchaetal lamellae on chaetigers 5–14 large but low, rounded and fleshy, with openings of internal glandular organs (Figs 11B and 12A–12F).
Fig 12. Glandular organs of Spiophanes uschakowi (Peter the Great Bay, Russia, USNM 183505).
(A) Anterior end, left lateral view. (B) Chaetigers 6–9, left lateral view, showing openings of glandular organs: small hole on chaetiger 6, suboval slits on chaetigers 7 and 8, and vertical slit on chaetiger 9. (C) Chaetigers 10–16, left lateral view, showing slit-like openings of glandular organs on chaetigers 10–14. (D) Chaetigers 4 and 5, left lateral view, showing suboval fiber spreader on neuropodium of chaetiger 5. (E) Chaetiger 6, left lateral view, showing hole-like opening of glandular organ in neuropodium. (F) Chaetigers 14 and 15, left lateral view, showing slit-like opening of glandular organ in neuropodium of chaetiger 14 and hooks in neuropodia of chaetiger 15. Abbreviations: ch5–ch16 –chaetigers 5–16; fs–fiber spreader; go–opening of glandular organ; hh–hooded hook; lo–lateral sensory ciliated organ; ne–neuropodial postchaetal lamella; no–notopodial postchaetal lamella; nt–nototroch; sa–ventral inferior sabre chaeta; se–hardened secretion protruding from opening of glandular organ; tc–intersegmental transverse cilia. Scale bars: A– 200 μm; B, C– 100 μm; D–F– 50 μm.
Sabre chaetae in neuropodia from chaetiger 10, usually one, occasionally two per neuropodium, with fine granulation on distal part; chaetae on chaetiger 10 comparatively small, with narrow limbation, slightly reducing in size until chaetiger 14, but from chaetiger 15 onwards thicker, alimbate (Fig 12C).
Hooks in neuropodia from chaetiger 15, up to 15 in a series, accompanied by inferior sabre chaetae throughout body and 1–2 hair-like alimbate capillaries in 7–10 posterior chaetigers; hair-like capillaries in posterior neuropodia usually situated in upper and/or lower parts of hook row. Hooks usually quadridentate, with three small upper teeth above main fang and small subterminal hood below main fang (Fig 13B); median upper tooth occasionally weakly developed or doubled (Fig 13A and 13B).
Fig 13. Adult morphology of Spiophanes uschakowi (Peter the Great Bay, Russia, USNM 183505).
(A) Hooks in neuropodium of chaetiger 15, view from above, showing variation in number of superior teeth. (B) Same, lateral view, showing small subterminal hood below main fang. Abbreviations: fa–main fang of hook; ho–subdistal hood below main fang of hook; su–superior teeth of hook; up–upper tooth of hook. Scale bars: A, B– 2 μm.
Nototrochs from chaetiger 1 to end of body; on each of chaetigers 1 and 2 as two short, oblique ciliary bands situated between notopodial postchaetal lamellae and nuchal ciliary bands; from chaetiger 3 onwards as complete transverse bands of dense cilia running between notopodial postchaetal lamellae (Figs 11C, 11F, 11G and 12C). Each nototroch composed of two parallel rows of large transversally elongated cells, each bearing numerous long cilia; nototroch ciliation stronger on ridge-bearing chaetigers. Single transverse rows of smaller cells with shorter cilia present on each chaetiger beginning from chaetiger 3. These rows situated posterior to nototrochs and referred to as intersegmental transverse ciliation (Fig 11F and 11G).
Dorsal transverse ridges present from chaetiger 15 to chaetigers 30–55, fewer in small individuals. Ridges thick, fleshy, one per chaetiger, not connected to notopodial lamellae. Wide blood vessel extending along each ridge internally; double nototroch with numerous long cilia arranged on top of each ridge. Intersegmental lateral pouches absent.
Pygidium with small fleshy ventral pad and one pair of thin long lateral cirri (Fig 11E); one to two additional cirri present above lateral cirri in some individuals.
Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9 and gradually increasing in size from chaetiger 10 to chaetigers 12–13 (Fig 14B–14G), slightly smaller again in chaetiger 14; large organs occupying most of chaetiger space. Internal fibres long and coiled in glandular organs in chaetigers 5–8 (Fig 14B–14E), straight, shorter and thinner in chaetigers 9–14; in fixed specimens, long straight fibers usually protruding from openings of glandular organs on chaetiger 6. Each organ on chaetigers 5, 7 and 8 opening to exterior via semicircular to suboval slit around large fiber spreader (Figs 11B, 12A, 12B, 12D and 14A), on chaetiger 6 via small round hole (Figs 12E and 14A), and on chaetigers 9–14 via large vertical slit (Figs 12A–12C, 12F and 14A). Frontal edge of each fiber spreader on chaetigers 5, 7 and 8 entire, rounded to blunt, or with variously developed middle depression vaguely separating two rounded lobes (Fig 12A, 12B and 12D).
Foregut wide, eversible, within 3–6 anterior chaetigers, with black pigment in thick wall; oesophagus in succeeding chaetigers narrow, with thin unpigmented wall. Gizzard-like structure in end of oesophagus beginning from chaetigers 14–21 and extending through 2–3 chaetigers.
Main dorsal blood vessel with heart body extending from chaetigers 14–16 to chaetigers 20–21. Heart body soft, brownish-green, 30–40 μm in diameter. Main dorsal blood vessel transforming into gut sinus 1–3 chaetigers after gizzard-like structure. Circumoesophageal vessels joined midventrally in chaetiger 3 forming main ventral blood vessel. Blood red, without elements.
Nephridia from chaetiger 15 onwards, opening to exterior on antero-lateral edges of chaetigers in both sexes.
Habitat. Adults of S. uschakowi live in tubes in sandy to muddy-sand sediments in shallow waters. Population densities reach several thousand individuals per square meter. The tubes are sandy, firm, with thin but strong inner lining, up to 10 cm long and 2 mm in diameter, oriented vertically in sediment, with upper part 2–5 mm long protruding above the surface.
Methyl green staining. Intensely stained small area on lateral sides of chaetiger 5 (in front of openings of glandular organs; not stained in some individuals), larger area on chaetiger 6 (Fig 10B) and small fleshy pygidium (pygidial cirri not stained); weakly stained lateral sides of chaetigers 9–14.
Reproduction. Spiophanes uschakowi is gonochoristic. The gametes proliferate in paired gonads attached to the genital blood vessels from chaetigers 20–24 to chaetigers 88–120. In females, oogenesis is intraovarian: vitellogenesis occurs when the oocytes grow in ovaries. The developed oocytes are accumulated in the coelomic cavity prior to spawning. The newly released oocytes are lentiform, each 185–200 μm in diameter, with honeycombed envelope 5–7 μm thick, 41–49 cortical alveoli regularly arranged in a peripheral circle, a nucleus 80–83 μm in diameter, and a single nucleolus about 30 μm in diameter. The cortical alveoli are pear-shaped, 7–9 μm in diameter, with narrow necks oriented perpendicular to the oocyte surface (see Radashevsky et al. [167]: Fig 2).
In males, spermatogonia proliferate in testes and the rest of spermatogenesis occurs in the coelomic cavity. Spermatids are interconnected in tetrads. The spermatozoa are ect-aquasperm with a plate-like acrosome 0.58 ± 0.06 μm thick and 2.14 ± 0.13 μm in diameter, barrel-shaped nucleus 2.23 ± 0.13 μm long and 3.18 ± 0.13 μm in diameter, short midpiece 0.93 ± 0.09 μm long with five spherical mitochondria, two centrioles and one small lipid droplet, and a flagellum 62–63 μm long with 9 × 2 + 2 organization of microtubules (see Radashevsky et al. [167]: Fig 5).
Females and males release their gametes into the water where fertilization and holopelagic, planktotrophic larval development occur. Larvae have two pairs of red eyes on the prostomium and a midventral ciliated pit on chaetiger 2. Newly settled 20–21-chaetiger juveniles about 2 mm long had heavy recurved crook-like spines in neuropodia of chaetiger 1, sabre chaetae in neuropodia from chaetiger 10, hooded hooks in neuropodia from chaetiger 14, and long spines with recurved distal end in notopodia from chaetigers 17–19.
Remarks. In the original description of S. uschakowi Zachs ([112]: 130) noticed characteristic feature of worms as notopodial lamellae (“cirri dorsales”) being leaf-like on eight anterior chaetigers and cirriform on the following chaetigers. He noted that hooks appeared rather similar to those in S. bombyx and incorrectly reported that the first chaetiger had no heavy spines. Annenkova [168, 113] and Uschakov [78] likely had not seen Zachs’ material and distinguished S. bombyx and S. uschakowi only according to Zachs’ description. We have examined the two syntypes of S. uschakowi (two anterior fragments, each about 25–35 chaetigers) deposited in the polychaete collection of the Zoological Institute, Saint Petersburg, Russia (ZISP 1/25826), and observed the heavy recurved spines in first neuropodia, and other characters as they described above.
The ultrastructure of the oocytes and spermatozoa was described in details by Radashevsky et al. [167]. The larvae of the species were found in plankton collected in Peter the Great Bay, Sea of Japan (East Sea), Russia, in September-October. Their morphology will be described elsewhere.
Spiophanes uschakowi has been recorded from the Shantar Islands, northern part of Sakhalin Is. and from the South Kurile Islands south to the Korean Peninsula. Numerous records of S. bombyx from around Japanese Islands by Minoru Imajima are herein referred to S. uschakowi but the conspecificity of mainland and Japanese specimens should be verified in a further study. Remarkably, S. uschakowi has never been reported from the Chukchi Peninsula, Kamchatka Peninsula, Bering Islands, Kurile Islands, and northern part of the Sea of Okhotsk, although numerous samples from this region were provided by the expeditions of the Institute of Marine Biology, Vladivostok, FEB RAS, the Zoological Institute, St. Petersburg, RAS, some other institutions, and also during this study.
Distribution. North West Pacific: from the Sea of Okhotsk south to the Yellow Sea and East China Sea (Fig 15A).
Fig 15. Maps showing records of Spiophanes spp. in North Pacific Ocean.
(A) Spiophanes uschakowi Zachs, 1933: red star–type locality: Peter the Great Bay, Sea of Japan (East Sea), Russia; green triangle–specimens sequenced in the present study; yellow circles–adults identified in the present study based on the morphology only; turquoise circles–adults identified as S. bombyx by Imajima [88, 116–118]. (B) Spiophanes norrisi Meißner & Blank, 2009 (yellow symbols): yellow star–type locality: Magdalena Bay, Baja California Sur, Mexico; yellow square–specimens sequenced by Meißner & Blank [111]; yellow rhombs–specimens sequenced by the LACM DISCO Project (Los Angeles, California, USA), and the Marine Biology Laboratory (City of San Diego, California, USA); yellow circles–adults identified based on the morphology only. Spiophanes hakaiensis n. sp. (green symbols): green star–type locality: Calvert Is., British Columbia, Canada; green squares–specimens sequenced in the present study; green triangles–specimens sequenced by the Canadian Centre for DNA Barcoding (Guelph, Canada), and the Marine Biology Laboratory (City of San Francisco, California, USA); green circles–adults identified based on the morphology only.
Spiophanes norrisi Meißner & Blank, 2009. Fig 10E
Spiophanes norrisi Meißner & Blank, 2009 [111] (Part.): 11–15, Figs 5, 6A, 6B, 6D–6F.
Spiophanes bombyx: Hernández-Alcántara et al. [63]: 570. Hernández-Alcántara & Solís-Weiss [175]: 29. Méndez [176]: 142. Díaz-Castañeda & Valenzuela-Solano [177]: 513. Not Claparède [9, 10].
Type material. MEXICO, Baja California Sur, Magdalena Bay, Entrada Point, R/V Velero IV, st. 1962–50, 24.545°N, 112.06805°W, rocky intertidal with surfgrass & tide pools, coll. Allan Hancock Foundation, 3 May 1950, LACM-AHF Poly 2251 (holotype), 2254 (16 paratypes).
Synopsis. Up to 15 mm long, 0.6 mm wide for 100 chaetigers. Prostomium with long fronto-lateral horns, posteriorly pressed into chaetiger 1 but not extending over it as caruncle. Occipital antenna absent. Nuchal organs metameric, at least on 25 anterior chaetigers; first pair of metamers as oblique ciliary bands from prostomium to end of chaetiger 2; succeeding metamers shorter, parallel to body axis until chaetigers 10–11, oblique on succeeding chaetigers. Sabre chaetae in neuropodia from chaetiger 10. Hooks in neuropodia from chaetiger 15, usually quadridentate, with small subterminal hood. Pygidium with small ventral fleshy pad and one pair of lateral cirri. Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9, gradually increasing in size from chaetiger 10 to chaetigers 12–13, slightly smaller again in chaetiger 14. Internal fibres long and coiled in glandular organs in chaetigers 5–8, straight, shorter and thinner in chaetigers 9–14. Organs on chaetigers 5, 7 and 8 each opening to exterior via semicircular to suboval slit around large fiber spreader, on chaetiger 6 via small round hole, on chaetigers 9–14 via large vertical slit. Frontal edge of each fiber spreader on chaetigers 5, 7 and 8 entire, rounded to blunt, or with variously developed middle depression vaguely separating two rounded lobes. Digestive tract with gizzard-like structure. Main dorsal blood vessel with heart body. Nephridia from chaetiger 15 onwards. Gonochoristic. Oocytes lentiform, each with thick honey-combed envelope and cortical alveoli regularly arranged in a peripheral circle. Spermatids interconnected in tetrads. Spermatozoa short-headed aqua-sperm with plate-like acrosomes. Fertilization in sea water. Larval development holopelagic, planktotrophic. Larvae with two pairs of red eyes on prostomium and a midventral ciliated pit on chaetiger 2.
Remarks. Meißner & Blank [111] designated 17 specimens from one sample collected from Magdalena Bay, Baja California Sur, Pacific Mexico, as the type material of S. norrisi (Fig 15B). They referred to numerous specimens of horned Spiophanes collected along the Pacific American coast from Alaska south to Chile as non-type material of the same species. For molecular analysis (short fragments of COI), the authors used specimens collected from offshore San Francisco (SF), northern California.
Molecular analysis performed in the present study suggested the presence of two sibling vicariant species distributed along the Pacific coast of North America and overlapping in California (Figs 2B and 3). Herein, we refer northern specimens to a new species: Spiophanes hakaiensis n. sp. (see below). The COI sequences provided by Meißner & Blank [111] were grouped together with sequences from specimens from off San Francisco and Baja California Norte, Mexico, provided in other studies (see Table 1, Fig 2B). Consequently, these specimens are referred to as S. norrisi. South American populations of horned Spiophanes have not been examined in genetic analysis. Pending molecular data, we suggest that Chilean and Argentinean specimens are referred to as S. cf. norrisi (see below).
Meißner & Blank [111] noticed that S. norrisi differed from morphologically similar species mainly in the orientation of segmental nuchal metamers (“dorsal ciliated patches”, “metameric ciliated patches” or “dorsal ciliated organs” in their terminology), and that it was the only known species with oblique orientation of the metamers from as early as between chaetigers 9–10. After describing horned American Spiophanes as a new species, S. norrisi, Meißner & Blank ([111]: 6) noted that S. uschakowi “turned out” to be very similar to S. norrisi, but “a definite assignment [of S. uschakowi] based on morphological characters was not possible as long as the nature of the dorsal ciliated organs posterior to chaetiger 2 was unknown.” We observed segmental nuchal metamers oriented parallel to body axis until chaetigers 9–10 in S. uschakowi and until chaetigers 10–11 in S. norrisi; thus the two species cannot be distinguished based on the morphology of their nuchal organs. We did not observe sabre chaetae beginning earlier than chaetiger 10 in S. norrisi and interpret their rare start from chaetiger 9 reported by Meißner & Blank [111] as an abnormality, as with the occasional bifurcation of one or both pygidial cirri rarely occurring both in S. uschakowi and S. norrisi. Individuals of both species demonstrate the same variability in the shape of the chaetal spreaders on chaetigers 5, 7 and 8, and all other morphological characters examined so far. Specimens of the two species differ slightly in the patterns of the MG staining. In S. uschakowi, the lateral sides of chaetiger 5 (in front of openings of glandular organs) are usually weakly stained (Fig 10B), whereas in S. norrisi such staining has not been observed (Fig 10E). The staining pattern in S. uschakowi, however, is variable and in some individuals (worms from Peter the Great Bay were mostly examined on this account) staining was not revealed on chaetiger 5, making this character also unreliable for distinguishing the two species.
Blake [178] described 13- and 14-chaetiger horned larvae of a Spiophanes collected in Tomales Bay, California, in November 1971. The 14-chaetiger larva was 1025 μm long and had hooded hooks in neuropodia from chaetiger 11. Blake [178] noticed subtle morphological differences between the Californian and Swedish larvae (described by Hannerz [163]) and referred the former to as S. cf. bombyx. However, two other horned Spiophanes, S. anoculata Hartman, 1960 and S. hakaiensis n. sp., also occur in Californian waters. As with S. bombyx and S. norrisi, adults of S. anoculata have hooded hooks in neuropodia from chaetiger 15. So far, S. anoculata has only been found in deep water, from 922 m to 2800 m depth (see Meißner [8]), but because Blake [178] collected very few (only two) larvae of same kind in shallow-water plankton, these larvae may belong to a deep-water species. Thus, their identity remains uncertain.
Distribution. North East Pacific, California: from San Francisco Bay, USA, south to Baja California Sur, Mexico (Fig 15B).
Spiophanes hakaiensis Radashevsky & Pankova, n. sp.. urn:lsid:zoobank.org:act:20552AB1-C5D1-4310-A8B2-5BCE4370ECFA
Fig 16. Juvenile and adult morphology of Spiophanes hakaiensis n. sp.
(A–E)–live 24-chaetiger juvenile. (A) Complete individual. (B) Anterior end and pygidium, dorsal view. (C) Right palp, frontal view. (D) Posterior chaetigers, left lateral view. (E) Gizzard-like structure, dorsal view. (F) Anterior end of a live adult individual, dorsal view. (G) Left neuropodium of chaetiger 6 of a formalin-fixed 40-chaetigers juvenile, ventral view, showing short neurochaetae and long thin straight fibers protruding from hole-like opening of a glandular organ. Abbreviations: ch5–ch10 –chaetiger 5–10; ci–transverse rows of short motile compound cilia on inner lateral side of palp; dv–main dorsal blood vessel; fg–foregut; fh–fronto-lateral horn; fi–fibers produced by glandular organs; gi–gizzard-like structure; go–glandular organs; mg–midgut; ne–capillary neurochaetae; oe–oesophagus; pg–posterior gut; py–pygidial cirri; sp–notopodial spines with recurved distal end. Scale bars: A, B– 100 μm; C–E, G– 50 μm; F– 300 μm. A–E–British Columbia, Canada, MIMB 36708, F–British Columbia, Canada, CMNA 2019–0105 (holotype). G–Oregon, USA, MIMB 36711.
Spiophanes norrisi: Meißner & Blank, 2009 [111] (Part.): 11–15.
Spiophanes bombyx: Berkeley [53]: 416; [179]: 560. Berkeley & Berkeley [57]: 22–24, Figs 40–43. Hobson & Banse [62]: 45, Fig 6l. Carey [180]: 438. Macdonald et al. [181]: 40. Carr [46]: Supplement. Not Claparède [9, 10].
Type material. CANADA, British Columbia, 2017 Hakai-MarineGEO BioBlitz, Queen Charlotte Sound, Calvert Is.: Choked Pass, North Pigu Is., st. IHAK-46B, 51.6763°N, 128.1222°W, 6 m, sea grass, coll. D. VanMaanen, 4 Aug 2017, CMNA 2019–0105 (holotype); Choked Pass, st. IHAK-42B, 51.6806°N, 128.1163°W, 5 m, outer sandspit sediment, coll. G. Paulay, 3 Aug 2017, MIMB 36708 (paratype); Pruth Bay, st. SHAK-10, 51.6441°N, 128.1195°W, low intertidal, muddy sand, eel grass, coll. S. Dudas, 24 Jul 2017, MIMB 36707 (paratype). USA, California, offshore San Francisco: st. SWOO-63, 37.6588°N, 122.5615°W, 27.5 m, coll. CCSF/SFPUC Lab, 13 Sep 2010, MIMB 39021 (13 paratypes); st. SWOO-73, 37.7125°N, 122.5648°W, 18.5 m, muddy sand, 13 Sep 2010, MIMB 39022 (2 paratypes).
Adult morphology (based on the type material–specimens identified by means of molecular analysis in the present study). Up to 25 mm long, 1.3 mm wide for 110 chaetigers. Pigmentation absent on body. Few examined live complete individuals with fine black pigment scattered on palps (Fig 16F). In large formalin-fixed specimens, lateral sides of chaetigers 9–14 (until chaetigers 16–17 in largest specimens) light reddish due to fixed internal content of large, probably glandular, epithelial cells.
Prostomium triangular, wide anteriorly, with a pair of long, distally pointed fronto-lateral horns (Fig 16A, 16B and 16F), posteriorly narrowed, pressed into chaetiger 1 but not extending over as a caruncle. Peristomium with narrow lateral lips closely applied to lateral sides of prostomium, and a small ventral lip. Two pairs of small dark red eyes arranged trapezoidally, comprising one pair of median eyes and one pair of lateral eyes situated anteriorly and set wider apart; occasionally eyes absent. Occipital antenna absent. Palps as long as 7–15 chaetigers, with deep frontal longitudinal groove lined with fine cilia, fronto-lateral motile compound cilia bordering frontal groove, short transverse rows of short motile compound cilia regularly arranged on inner lateral side and beating towards frontal groove (Fig 16C and 16F), short compound non-motile cilia arising directly from palp surface and scattered on lateral and abfrontal palp surfaces.
Nuchal organs metameric, at least on 25 anterior chaetigers, fewer in small individuals. First pair of metamers long oblique ciliary bands extending from posterior part of prostomium to end of chaetiger 2, shorter in small individuals; posterior ends of metamers set wider apart. Succeeding metamers shorter, each extending from nototroch over posterior half of chaetiger, oriented parallel to body axis until chaetigers 10–11, oblique on succeeding chaetigers.
Notochaetae capillaries, long on four anterior chaetigers and on posterior chaetigers, shorter on middle chaetigers. Neuropodia of chaetiger 1 each with 1–2 heavy recurved, crook-like spines in addition to capillaries. Notopodia of 5–10 posterior chaetigers each with 1–3 (usually one) long spines with recurved distal end in addition to capillaries (Fig 16D). Noto- and neuropodial postchaetal lamellae on four anterior chaetigers subtriangular, with pointed tips; notopodial lamellae on succeeding middle chaetigers short, subulate, on posterior chaetigers long, cirriform. Neuropodial postchaetal lamellae on chaetigers 5–14 large but low, rounded and fleshy, with openings of internal glandular organs.
Sabre chaetae in neuropodia from chaetiger 10, usually one, occasionally two per neuropodium, with fine granulation on distal part; chaetae on chaetiger 10 comparatively small, with narrow limbation, slightly reducing in size until chaetiger 14, but from chaetiger 15 onwards thicker, alimbate.
Hooks in neuropodia from chaetiger 15, up to 10 in a series, accompanied by inferior sabre chaetae throughout body and 1–2 hair-like alimbate capillaries in 5–10 posterior chaetigers. Hooks usually quadridentate, with three small upper teeth above main fang and small subterminal hood below main fang.
Nototrochs from chaetiger 1 to end of body, each composed of two parallel rows of large transversally elongated cells, each bearing numerous long cilia; nototroch ciliation stronger on ridge-bearing chaetigers. Intersegmental transverse ciliation from chaetiger 3 onwards.
Dorsal transverse ridges from chaetigers 14–15 to chaetigers 30–55, fewer in small individuals. Intersegmental lateral pouches absent.
Pygidium with small fleshy ventral pad and one pair of thin long lateral cirri.
Glandular organs in chaetigers 5–14, largest in chaetigers 7 and 8, smallest in chaetiger 9 and gradually increasing in size from chaetiger 10 to chaetigers 12–13, slightly smaller again in chaetiger 14; large organs occupying most of chaetiger space. Internal fibres long and coiled in glandular organs in chaetigers 5–8, straight, shorter and thinner in chaetigers 9–14; in fixed specimens, long straight fibers usually protruding from openings of glandular organs on chaetiger 6 (Fig 16G). Each organ on chaetigers 5, 7 and 8 opening to exterior via semicircular to suboval slit around large fiber spreader, on chaetiger 6 via small round hole, and on chaetigers 9–14 via large vertical slit. Frontal edge of each fiber spreader on chaetigers 5, 7 and 8 blunt or with variously developed middle depression vaguely separating two rounded lobes.
Foregut wide, eversible, within 3–4 anterior chaetigers, with greenish-black pigment in thick wall; oesophagus in succeeding chaetigers narrow, with thin unpigmented wall (Fig 16F). Gizzard-like structure in end of oesophagus beginning from chaetigers 10–20 and extending through 2–3 chaetigers (Fig 16B–16E). Posterior gut with transparent wall.
Main dorsal blood vessel with heart body extending from chaetigers 12–15 to chaetigers 19–20. Blood red, without elements (Fig 16F).
Nephridia from chaetiger 15 onwards, opening to exterior on antero-lateral edges of chaetigers in both sexes.
Juvenile morphology. 23-chaetiger juvenile about 2 mm long, 0.3 mm wide on chaetiger 5, with fronto-lateral horns on prostomium well developed (Fig 16A). First pair of nuchal metamers extending to middle of chaetiger 2. Succeeding metamers on chaetigers 6–11. Transverse rows of short motile compound cilia regularly arranged on distal half of each palp (Fig 16C). Double-row nototrochs from chaetiger 3 onwards. Sabre chaetae in neuropodia from chaetiger 11, very small on the first chaetiger, better discernible from chaetiger 12. Hooks in neuropodial from chaetiger 14. Long spines with recurved distal end in notopodia of chaetigers 19–23 (Fig 16D). Pygidium with ventral semispherical yellow pad and one pair of thin transparent dorsal cirri (Fig 16A and 16B). Gizzard-like structure in chaetigers 10–11. Nephridia from chaetiger 15 onwards.
30–40-chaetiger juveniles about 0.4 mm wide with sabre chaetae in neuropodia from chaetiger 10, 1–2 hooded hooks among 4–6 capillary chaetae and single sabre chaeta in each neuropodium of chaetiger 14, and only hooks and sabre chaetae in neuropodia from chaetiger 15 onwards. Individuals more than 0.4 mm wide with morphological characters as described above in Adult morphology, with sabre chaetae in neuropodia from chaetiger 10 and hooded hooks from chaetiger 15.
Methyl green staining. Intensely stained lateral sides of chaetiger 6 and small fleshy pygidium (pygidial cirri not stained), weakly stained lateral sides of chaetigers 9–14; no staining on chaetigers 1–5 and 7, 8 (Fig 10D).
Reproduction. Spiophanes hakaiensis n. sp. is gonochoristic. Mature females and males collected in British Columbia, Canada, in May 1966 (RBCM 55–47), have gametes from chaetiger 21 through most of the body. The oocytes have honey-combed envelopes with cortical alveoli regularly arranged in a peripheral circle. Spermatids are interconnected in tetrads; the spermatozoa were ect-aquasperm with a short acrosome and short, subspherical nucleus about 3 μm in diameter.
Remarks. Horned Spiophanes from the North East Pacific appear morphologically very similar or almost identical to each other and to S. uschakowi from the North West Pacific. However, molecular analysis performed in the present study showed significant difference between the North East and North West populations and also suggested the presence of two sibling vicariant species distributed along the Pacific coast of North America and overlapping in California (Figs 1B, 2B and 3). Sequences of some Californian specimens (including COI sequences provided by Meißner & Blank [111]) were grouped together with sequences of specimens from Baja California Norte, Mexico (see Table 1, Fig 1B). Because the latter locality is close to the type locality of S. norrisi, those specimens are referred to this species. Other Californian specimens were genetically similar to horned Spiophanes from Alaska, USA, and British Columbia, Canada. Those specimens are herein referred to a new species: Spiophanes hakaiensis n. sp. Comments on the taxonomy and the distribution of these species are provided above in the Remarks for S. norrisi, and below in the Remarks for S. cf. norrisi.
To avoid confusion in the identification of specimens based on the morphology only, in areas of overlap of S. hakaiensis n. sp. and S. norrisi, we suggest that specimens from California between Point Reyes (38°N) and Point Conception (34.45°N) are referred to as S. norrisi aggregate; specimens occurring from Point Reyes north to Alaska are herein referred to as S. hakaiensis n. sp.; whereas those occurring from Point Conception south to Baja California Sur, Mexico, are referred to as S. norrisi.
Distribution. From Alaska south to San Francisco Bay, California, USA (Fig 15A).
Spiophanes cf. norrisi Meißner & Blank, 2009. Fig 10C
Spiophanes bombyx: Hartman [109]: 22, pl V, Figs 14–16. Carrasco [67]: 197–199, Figs 37–41; [119]: 48–53, Figs 19, 20, 22 J–L (larval morphology). Blake [48]: 230. Rozbaczylo & Salgado [71]: 23, Fig 2e. Carrasco [182]: 453, 455. Mendez et al. [183]: 431. Montiel et al. [73]: 310. Not Claparède [9, 10].
Spiophanes chilensis: Hartmann-Schröder [184] (Part.): 215–218.
Spiophanes norrisi: Meißner & Blank [111] (Part.): 11–15, Fig 6C.
Remarks. Hartmann-Schröder [184] described Chilean Spiophanes (distributed from Punta Tortuga, Coquimbo, south to Gulf of Corcovado) with prostomium expanded anteriorly as S. chilensis Hartmann-Schröder, 1965. Meißner [8] and Meißner & Blank [111] re-examined the type material of S. chilensis and distinguished specimens belonging to three species: Spiophanes duplex (Chamberlin, 1919), Spiophanes fimbriata Moore, 1923, and S. norrisi. Meißner [8] referred the holotype of S. chilensis to S. duplex and considered the former species as a junior synonym of the latter (see below). Meißner & Blank ([111]: 14–15) referred 22 paratypes of S. chilensis from Punta Tortuga (29°57.350' S, ZMH P-14946) and additional material from Bahia Quillaipe (41°32.469' S, ZMH P-21118, 2 spec.) to S. norrisi and concluded that the latter species “occurs from shallow waters up to subtidal depths waters along the North and South American coast.”
Meißner & Blank [111] did not mention the records of S. bombyx from Chile by Carrasco [67, 119] and from Argentina and the Falkland Islands by Blake [48], although these two authors noticed that their specimens were identical with S. bombyx from Europe. We also had no chance to examine Carrasco’s or Blake’s material but got new material from Chile and Argentina (see S1 Table). We could not find any difference between this material and corresponding specimens from the Pacific USA and Canada, either in the morphology or in the MG staining (Fig 10C–10E). Nevertheless, pending results of a comparative molecular analysis of North and South American specimens (see above Remarks for S. norrisi), we suggest that Chilean and Argentinean specimens are referred to as S. cf. norrisi. It is quite possible that South American horned Spiophanes, although morphologically appearing similar to North American S. norrisi, differ from them genetically and represent a different species. We see support to this idea in the limited distribution of worms in the southern part of South America only.
Distribution. South America: Chile, Argentina, Falkland Islands (Fig 17).
Fig 17. Map showing type localities and records of Spiophanes spp. in North and South Americas.
Spiophanes duplex (Chamberlin, 1919) (green and yellow symbols): green star–type locality: Laguna Beach, California, USA; green triangle–specimens sequenced in the present study; yellow star–type locality of Spiophanes missionensis Hartman, 1941 (junior synonym of S. duplex): Mission Bay, California, USA. Spiophanes soederstroemi Hartman, 1953 (red and pink symbols): red star–type locality: off Rio Grande do Sul, Brazil; red triangle–specimens sequenced in the present study; pink star–type locality of Spiophanes chilensis Hartmann-Schröder, 1965 (junior synonym of S. soederstroemi): Punta Tortuga near Coquimbo, Chile. Spiophanes cf. norrisi: turquoise circles–reports as S. bombyx by Blake [48], Mendez et al. [183], Meißner & Blank [111], and identified in the present study based on the morphology only.
Spiophanes duplex (Chamberlin, 1919)
Morants duplex Chamberlin, 1919 [185]: 17. Fide Blake [64]: 149.
Spiophanes missionensis Hartman, 1941 [186]: 296–298, pl 46, Figs 17–21; [56]: 46; [187]: 46. Reish & Winter [188]: 113. Barnard & Reish [189]: 88. Reish & Barnard [190]: 5. Reish [191]: 84; [192]: 77. Kauwling & Reish [193]: 58. Hernández-Alcántara et al. [63]: 570. Maurer et al. [194]: 185–203. Méndez [176]: 142. Salazar-Vallejo & Londoño-Mesa [195]: 61. Fide Blake [64]: 149.
Spiophanes duplex: Blake [64]: 149–150, Fig 4.20; [178]: 592–593, Fig 13.11 (larval morphology). Hernández-Alcántara & Solís-Weiss [175]: 29; [196]: 285. Salazar-Vallejo & Londoño-Mesa [195]: 61. Meißner [8] (Part.): 31–36. Blake & Ruff [197]: 377. Díaz-Castañeda & Valenzuela-Solano [177]: 513. Schiff et al. [198]: 41–42.
Type material. USA, California, Orange Co., Laguna Beach, Balboa, 33.5419°N, 117.7892°W, intertidal, MCZ ANNb-2165 (holotype).
Remarks. Spiophanes duplex was originally described from Laguna Beach, Balboa, California, USA, by Chamberlin ([185], as Morants duplex). The original description was brief, with some features misinterpreted, without any illustration. Misinterpreted features greatly distinguished these worms from other spionids, and based on them, Chamberlin [185] established a new genus, Morants Chamberlin, 1919. In the Catalogue of the Polychaetous Annelids of the World, Hartman [1999] noted Morants as a monotypic genus. The genus and the species have been enigma for many years until Blake [64] discovered the holotype of M. duplex in the collections of the Museum of Comparative Zoology at Harvard (MCZ 2165) and redescribed it. He noted that the holotype had all the characters of Spiophanes and referred to Morants as a junior synonym of Spiophanes. Blake [64] also referred to Spiophanes missionensis Hartman, 1941, originally described from Mission Bay, San Diego County, California, USA, as a junior synonym of S. duplex.
Meißner [8] reexamined the type specimens of S. missionensis Hartman, 1941, S. soederstroemi Hartman, 1953, and holotype of S. chilensis Hartmann-Schröder, 1965 and, based on their morphological similarity, considered these species as junior synonyms of S. duplex (Chamberlin, 1919). Consequently, she suggested that S. duplex is widely distributed along both the Pacific and Atlantic coasts of both North and South America.
The results of the present study unambiguously show that specimens from Brazil, being morphologically identical to adults of S. duplex from California, differ from them essentially in genetic characteristics (Fig 2B). Therefore, we considered the two populations as not conspecific and refer the Brazilian population to S. soederstroemi (see below). Pending results of molecular studies in other American regions, we consider S. duplex as distributed in California only.
Distribution. North East Pacific: California (Fig 17).
Spiophanes soederstroemi Hartman, 1953. Spiophanes kroyeri: Söderström [21] (Part.): 243. Not Grube [200]. Fide Hartman [201]: 41.
Spiophanes soederstroemi Hartman, 1953 [201]: 41, Fig 14. Orensanz & Gianuca [202]: 17–18. Blake [48]: 230–232, Fig 13. Rozbaczylo & Castilla [203]: 175. Rozbaczylo & Salgado [71]: 24–25, Fig 2f, g. Carrasco [182]: 453, 455. Cañete et al. [204]: 247. Maciolek [205] (Part.): 543–544. Lancellotti & Stotz [206]: 309. Palma et al. [207]: 240. Montiel et al. [73]: 310.
Spiophanes chilensis Hartmann-Schröder, 1965 [184] (Part.): 215–218, Figs 208–211. Fide Blake [48]: 230.
Spiophanes missionensis: Bolivar & Lana [49]: 132–134, Figs 48–53; [50]: 255. Morgado & Amaral [208]: 549. Paiva [209]: 42; [210]: 74. Muniz & Pires [211]: 520; [51]: 152. Arasaki et al. [212]: 258. Santi & Tavares [213]: 293. Not Hartman [186].
Spiophanes duplex: Meißner [8] (Part.): 31–36, Figs 16–19. Pardo et al. [52]: 220, textfigs A–F. Scarabino [214]: 121. Pagliosa et al. [215]: 46. Radashevsky [174]: Fig 12A. Shimabukuro et al. [216]: 9. Not Chamberlin [185].
Spiophanes sp.: Radashevsky [174]: Figs 4A, 10C, 10D.
Type material. Off Brazil, Rio Grande do Sul, Swedish Antarctic Expedition 1901–1903, st. 1, 33.00°S, 51.1667°W, 80 m, bottom of dark gray mud, 12 Dec 1901, SMNH 5369 (2 syntypes).
Remarks. Spiophanes soederstroemi Hartman, 1953 was established by Hartman [201] based on two specimens from South America collected by the Swedish Antarctic Expedition 1901–1903 onboard the ship Antarctic. The specimens were first reported by Söderström [21] as a new record for S. kroyeri. Remarkably, Söderström ([21]: 243) and all the following authors noted that the specimens were collected on December 12, 1901 at station 1, off Uruguay. However, the coordinates provided for this station by Söderström [21] and also in a copy of the actual station list made during the expedition: 33°00'S, 51°10'W (SMNH, Lena Gustavsson in litt., 11 Sep 2019), and a map of the Expedition route with daily positions of the ship [217] show a sampling site of December 12, 1901 situated off Rio Grande do Sul, Brazil (Fig 17), north of the border between Brazil and Uruguay. Noteworthy, although this border was already well established in the mid 19th century and did not change after that, it was not shown on the Expedition map. Possible uncertainty in its exact position might create confusion about reference on the type locality of S. soederstroemi.
Blake [48] redescribed two syntypes of S. soederstroemi, reviewed a complicated history of this species and clarified some of its morphological features and taxonomic issues. He also reexamined the type specimens of Spiophanes chilensis Hartmann-Schröder, 1965, which was originally described from Punta Tortuga, Chile, by Hartmann-Schröder [184], and referred its holotype (ZMH P-14946) to S. soederstroemi. Consequently, Blake [48] considered S. chilensis as a junior synonym of S. soederstroemi. He also noticed subtle differences between S. soederstroemi and S. missionensis and considered them as two closely related but separate species (the holotype of Morants duplex was not yet discovered at that time).
Meißner [8] reexamined type specimens of S. missionensis Hartman, 1941, S. soederstroemi Hartman, 1953, and holotype of S. chilensis Hartmann-Schröder, 1965 and, based on their morphological similarity, considered these species as junior synonyms of S. duplex (Chamberlin, 1919).
During the present study, we examined live Spiophanes in California, USA, and Paraná, Brazil, which fit all the characteristics of S. duplex. We could not find any reliable morphological difference between them, but the differences between their molecular characteristics suggest the presence of two distinct species (Fig 2B). Consequently, we treat S. duplex and S. soederstroemi as two valid species, and consider S. missionensis as a junior synonym of S. duplex, and S. chilensis as a junior synonym of S. soederstroemi. The type localities of these species and sampling sites for the specimens used in the present molecular analysis are shown on Fig 17.
Spiophanes soederstroemi is likely distributed in South America only. Records of S. soederstroemi from South Africa [100, 101], South Georgia [109], Antarctica [218, 219], China [90], Florida and North Carolina, USA [205], Philippines [220], and the Arabian Gulf [221] possibly represent misidentifications of different species.
Distribution. South America: Brazil, Uruguay, Argentina, Chile (Fig 17).
Spiophanes kroyeri Grube, 1860. Spiophanes kroyeri Grube, 1860 [200]: 88–89, pl V, Fig 1. Sikorski [33] (Part.): 329–331, textfig Meißner [8] (Part.): 7–14, Fig 1A.
Type material. Greenland Sea, off northern Iceland, coll. Grube, E., ZMB Q4746 (lectotype), 11168 (paralectotype).
Remarks. Grube ([200]: 89) noted in the original description of S. kroyeri that the new species was “Aus dem Meere von Grönland.” No more detail about the type locality has ever been published, but the original registry catalogue and labels for the types of S. kroyeri maintained in the polychaete collection of the Zoologisches Museum Berlin (ZMB), Germany, say that the material was from Iceland, i.e. from the southern part of the Greenland Sea ([222]; Birger Neuhaus in litt., 15 Jul 2019). A tentative position of the type locality is shown on the Fig 4B.
Meißner ([8]: 13) considered S. kroyeri as “the most problematic species within the genus.” She reviewed its worldwide reports and suggested that most of them were based on misidentifications. To clarify the identity of S. kroyeri, Meißner [8] designated a lectotype (ZMB Q4746) and provided a series of diagnostic characteristics of the adults. They included a bell-shaped prostomium, well developed occipital antenna, nuchal organs as a pair of longitudinal ciliary bands extending to chaetigers 14–16, suboval chaetal spreaders well developed on chaetigers 5–7, sabre chaetae in neuropodia from chaetiger 4, hooks with subterminal hood in neuropodia from chaetiger 15, lateral pouches first appearing between neuropodia of chaetigers 15 and 16, and pigmentation comprising light brown pigment in postchaetal lamellae of chaetigers 1–7 and brown pigment in neuropodia of chaetigers 7–14, most conspicuous in chaetigers 8–11.
Meißner ([8]: 14) commented on the problems with the original description and type material of S. kroyeri reyssi described from Mediterranean France by Laubier [223]. She raised it to species level, S. reyssi Laubier, 1964, and emphasized that “so far only specimens from the North Atlantic can be assigned to S. kroyeri”.
The analysis of COI sequences of Spiophanes from the North Sea obtained by Meißner & Blank [111], from the Bay of Biscay, Spain, obtained by Aylagas et al. [121], and from the Barents Sea, Norway, obtained in the present study (see Table 1), revealed two distinct groups among specimens identified by morphology as S. kroyeri (Fig 1B). Worms of one group occurred in the Barents Sea, Norway, and in the northern part of the North Sea (vouchers HH64, 94 by Meißner & Blank [111]), whereas worms of another group occurred in the northern (vouchers HH18, 19 by Meißner & Blank [111]) and central parts of the North Sea (voucher HH63 by Meißner & Blank [111]), and in the Bay of Biscay, Spain. According to their distributions, we call these groups northern and southern, respectively. In relation to the type localities of S. kroyeri (Greenland Sea, off northern Iceland) and S. cirrata (Oslofjord, southern Norway, see below), we tentatively refer to the northern-group specimens as S. cf. kroyeri, and to the southern-group specimens as S. cf. cirrata (Fig 4B). Final conclusion about the specific identity of these worms can be inferred after molecular examination of worms from the type localities of the corresponding species in Iceland, Norway, and Mediterranean France. To avoid confusion in the identification of S. kroyeri-like specimens from the northern part of the North Sea (area of overlap of the two species) based on morphological characters only, we suggest that they are referred to as S. kroyeri aggregate (S. kroyeri agg.), rather than to a particular species.
It is noteworthy that deep-water Spiophanes worms from off the Crozet Islands, Southern Ocean, referred to as S. kroyeri by Mincks et al. [122], are genetically different from European specimens (Fig 2B) and are therefore referred to herein as S. aff. kroyeri.
Distribution. Arctic; North Atlantic (Fig 4B).
Spiophanes cirrata M. Sars in G.O. Sars, 1872. Spiophanes cirrata M. Sars in G.O. Sars, 1872 [224]: 410–411. M. Sars [225]: 268–273, pl XVIII, Figs 1–16.
?Spiophanes kroyeri: Hannerz [163]: 36–40, Figs 10, 11 (larval morphology). Eliason [19]: 49–50; [20]: 263. Hartmann-Schröder [164]: 326–327, Fig 111; [165]: 342–343, Fig 157. Böggemann [32]: 121, Fig 98. Jelsing [226]: 244, 247, Fig 1I (nuchal organs). Meißner [8] (Part.): 7–14, Figs 1B–H, 2, 3. Zettler et al. [227]: checklist. Not Grube [200].
Not Spiophanes cirrata: Berkeley [53]: 416; [179]: 560. Berkeley & Berkeley [228]: 475, textfig; [57]: 24–25, Figs 44–46; [229]: 791. Carey [180]: 439.
Type material. NORWAY, North Sea, Skagerrak, Oslofjord, Drøbak, types missing, Oslo, Norway.
Remarks. Michael Sars (in G.O. Sars [224]) briefly described Spiophanes cirrata based on material from Drøbak, Oslofjord, southern Norway (Fig 4B), and Skrova, small island group in the Lofoten Archipelago, northern Norway. Later, Sars [225] illustrated and provided a more complete re-description of this species. Tauber [230] and Söderström [21] considered S. cirrata to be a junior synonym of S. kroyeri. Hartman [199] listed S. cirrata as a valid species. Hartmann-Schröder [164, 165] and Kirkegaard [231] neither noted nor commented on this species. As the first sampling site mentioned in the original description of the species by Michael Sars, Drøbak in Oslofjord is herein for the first time recognized as the type locality of Spiophanes cirrata.
Based on the results of the molecular analysis performed in the present study (see above Remarks for Spiophanes kroyeri), and according to the type localities of S. kroyeri and S. cirrata, we tentatively refer S. kroyeri-like worms from the Barents Sea, Norway, and the northern part of the North Sea to as S. cf. kroyeri, and those from the northern and central parts of the North Sea, and from the Bay of Biscay, Spain, to as S. cf. cirrata (Fig 4B). Final conclusions about the specific identity of these worms can only be inferred after molecular examination of worms from the corresponding type localities of these species.
Distribution. North East Atlantic (Fig 4B).
Spiophanes berkeleyorum Pettibone, 1962. Spiophanes berkeleyorum Pettibone, 1962 [232]: 78–83, Figs 1–4. Light [60]: 78–79, Fig 5a, b; [61]: 63–66, textfigs 63–65. Hobson & Banse [62]: 45, Fig 6k. Blake [64]: 143–145, Fig 4.17. Meißner [8]: 28–31, Figs 13–15. Blake & Ruff [197]: 377. Carr [46]: Supplement.
Spiophanes cirrata: Berkeley [53]: 416; [179]: 560. Berkeley & Berkeley [228]: 475, textfig; [57]: 24–25, Figs 44–46; [229]: 791. Carey [180]: 439. Not M. Sars in G.O. Sars [224]. Fide Pettibone [232].
Type material. CANADA, British Columbia, east coast of Vancouver Island, Departure Bay beach, coll. E. & C. Berkeley, 25 Apr 1936, USNM 30399 (holotype), 30400 (6 paratypes).
Remarks. Spiophanes berkeleyorum was originally described from Vancouver Island, British Columbia, Canada, by Pettibone [232] and later reported from distant regions. Meißner & Hutchings [110] removed Spiophanes japonicum Imajima, 1991 from synonymy with S. berkeleyorum and Meißner [8] suggested that the latter species is distributed along the Pacific coast of North America only. Later reports of the species from Brazil [233, 215], Russia [84], and China [95] probably represent misidentifications and should be verified in additional studies. Molecular data of S. berkeleyorum are limited to sequences provided by Meißner & Blank [111] and those in the present study.
Distribution. North East Pacific: from Alaska south to California.
Trochochaeta multisetosa (Örsted, 1843). Disoma multisetosum Örsted, 1843 [234]: 41–42; [235]: 107–108, pl II, Figs 1–12. Thulin [236]: 9, Figs 7–17. Ditlevsen [237]: 32. Friedrich [23]: 135, Fig 88. Wesenberg-Lund [238]: 31, pl 7, Figs 31–32. Hannerz [163]: 141, Figs 51–52. Fide Pettibone [239]: 310.
Trochochaeta multisetosa: Pettibone [239]: 310–315, Figs 82, 83 a–g.
Trochochaeta multisetosum: Weitbrecht [240]: 401–412, Figs 1–10.
Disoma franciscanum Hartman, 1947 [241]: 160–169, Figs 1–3. Fide Pettibone [239]: 310.
Trochochaeta franciscanum: Blake & Arnofsky [242]: 68, Fig 6. Blake [178]: 598–600, Fig 13.13. Blake & Ruff [197]: 377.
Trochochaeta franciscana: Radashevsky et al. [243]: 574–575.
Type material. SWEDEN, Near Hveen (Ven) Island in the Øresund Strait. Types missing.
Remarks. Although Trochochaeta was not an object of the present study, use of these worms in the analysis (as an outgroup) brought some insight on their taxonomy. Trochochaeta multisetosa was originally described from the Øresund Strait, Sweden, by Örsted ([234], as Disoma multisetosum) and later occasionally reported from the North East Atlantic. Hartman [241] described Trochochaeta franciscana (as Disoma franciscanum) from San Francisco Bay, California, USA, but Pettibone [239] placed it into synonymy with T. multisetosa. In disagreement with Pettibone [239], Blake & Arnofsky ([242]: 68) stated that “the California specimens clearly represent a separate species due to differences in larval ciliary patterns.” In a revision of Trochochaeta, Radashevsky et al. [243] treated T. multisetosa and T. franciscana as two valid species. Molecular analysis performed in the present study, however, showed identity (p-distance = 0.00%) of the fragments of nuclear 18S and 28S rDNA sequenced in worms from Norway and Sweden and from Drake’s Bay, California, adjacent to San Francisco Bay. Consequently, in agreement with Pettibone [239], we tentatively suggest that T. franciscana is a junior synonym of T. multisetosa. As such, it may represent an introduced North Atlantic species in San Francisco Bay (where it was first collected in 1912, Hartman [241]) and nearby embayments, transported by vectors such as commercial oyster culture or shipping. This suggestion should be verified, however, by analyzing mitochondrial genes, such as COI and 28S rDNA, of individuals from the San Francisco Bay area, and by further analysis of additional populations, reported under the names of T. franciscana or T. multisetosa from a variety of habitats, from British Columbia to southern California, to further confirm if only one species of Trochochaeta is present.If confirmed, this may be a second case of the successful invasion of Trochochaeta into a remote region. Radashevsky et al. [243] recently suggested that Trochochaeta japonica Imajima, 1989 might have been introduced from the Asian Pacific to the estuary of Santos, São Paulo, Brazil, as larvae in ballast water of ocean-going vessels.
Discussion
The molecular analyses performed in the present study provided rather unexpected results. In various cases, morphologically similar or even identical specimens from close locations or even from the same area turned out to be genetically distant and are herein referred to as members of sibling species.
Five-genes analysis (COI, 16S, 18S, 28S, and Histone 3)
The five-genes analysis unambiguously suggested that horned Spiophanes with metameric nuchal organs and Spiophanes with bell-shaped prostomia and nuchal organs as entire long parallel ciliary bands belong to two major evolutionary lineages within the genus. More comprehensive analysis including more species is required to confirm this hypothesis. Including species with other types of nuchal organs, such as entire U-shaped ciliary bands (see Radashevsky [174] for review), in a future analysis, will help to better understand the evolutionary history of Spiophanes and the transformation of characters within this group of spionids. Remarkably, adults of Trochochaeta, the so far suggested sister group to Spiophanes, have U-shaped nuchal organs, similar to those of some Spiophanes and many other spionids. It will not be surprising, therefore, if Spiophanes with U-shaped nuchal organs are shown to have a basal position on the phylogenetic tree of the genus. This would suggest that the metameric and nuchal organs as long parallel ciliary bands might have evolved from nuchal organs as U-shaped ciliary bands within Spiophanes. This would also suggest that the metameric and nuchal organs as long parallel ciliary bands shared by other spionids, might be homoplasious characters evolved independently more than once within Spionidae.
The analysis suggested that horned Spiophanes from the North East Atlantic and North Pacific represent two sister evolutionary lineages. The absence of S. bombyx from the Pacific, as previously suggested by Meißner & Blank [111], has been confirmed. Moreover, the present study suggested an even more complicated systematic composition of horned Spiophanes in the North East Atlantic. In contrast to Meißner & Blank [111], who suggested that S. bombyx was distributed in North European waters and in the Mediterranean Sea, we suggest that probably three sibling species: S. bombyx, S. cf. bombyx and S. cf. convexus, have been observed, and that S. bombyx probably occurs in the Mediterranean Sea only. Unfortunately, S. convexus was poorly described based on a few incomplete fragments, without consideration of the morphological variability of S. bombyx and not examined by molecular means. Molecular analysis of horned European Spiophanes, especially S. bombyx from the Gulf of Naples, is needed no clarify the species composition of this group in the region.
The analysis also revealed a complicated systematic composition of worms fitting the morphological characteristics of S. kroyeri. The discovery of two genetically different species in North European waters requires further clarification of their specific identity. Herein, based on the proximity of sampling sites of specimens examined in molecular analyses and the type localities of S. kroyeri and S. cirrata, we suggest that worms from the Barents and the Norwegian seas, and also from the northern part of the North Sea belong to S. kroyeri, whereas worms from the North Sea and the Bay of Biscay belong to S. cirrata. These suggestions should be verified by molecular examination of Spiophanes kroyeri from the Greenland Sea and in a broader-scale study of Spiophanes in North European waters.
The analysis also showed a rich species composition of horned Spiophanes in the North Pacific and all along the Pacific coast of North and South America. First of all, it confirmed that Asian and North American horned Spiophanes, even appearing morphologically identical, are not conspecific. Moreover, it showed that horned Spiophanes occurring along the Pacific coast of North America belong to two sibling species: S. norrisi and S. hakaiensis n. sp. The presence of sibling species among Spiophanes brings doubts about the conspecificity of remote populations in North and South America referred by Meißner & Blank [111] to S. norrisi. It is plausible that South American populations belongs to an undescribed sibling species.
COI analysis, divergence time estimations and biogeographic inferences
The first Bayesian analysis of COI sequences, aiming to compare our data with those obtained in previous studies, resulted in a partially resolved consensus tree (Fig 1B), showing that short COI fragments (<300 bp) are not appropriate for these types of systematic inferences. The BEAST analysis of longer COI sequences (>500 bp) resulted in a fully resolved tree (Fig 3) with the same topology as in the five-genes Bayesian analysis (2B). A smaller set of taxa was used, however, in the BEAST analysis because it aimed to hypothesize on the divergence times of horned Spiophanes with metameric nuchal organs only.
Two hypotheses were addressed in advance to explain the high morphological similarity and disjunct distributions of horned Spiophanes on the Asian and American coasts of the North Pacific. Both hypotheses assumed that a common ancestor of those Spiophanes might have been distributed in the past all along the North Pacific without interruption. They differ however in the cause and the time of isolation of the two lineages, followed by subsequent speciation. The first hypothesis suggests that such isolation and speciation event might have resulted from the first opening of the Bering Strait at 5.5–5.4 mya [244, 245]. The second hypothesis links this isolation and speciation to the maximum glacial period in the Quaternary ice ages in the North Pacific 3.0–2.4 mya [246–250]. The estimate suggested by the BEAST analysis, about 1.3 mya (95% HPD: 2.0–0.7 mya), places the divergence of the North American and Asian lineages of horned Spiophanes after the maximum glacial period in the North Pacific and, thus, supports the second hypothesis. The last glacial maximum was suggested to have had a strong influence on the distribution of many other species (see Hewitt [251] for review).
Both the five-genes Bayesian analysis and the BEAST analysis suggested that the divergence of the North American and Asian lineages was preceded by the isolation and speciation of S. norrisi from a common North Pacific ancestor. The BEAST analysis estimates that this divergence might have happened about 1.7 mya (95% HPD: 2.3–1.0 mya). Remarkably, the boundary between the northern S. hakaiensis n. sp. and southern S. norrisi roughly coincides with the boundary between the Oregonian and Californian coastal biogeographical provinces at Point Conception [252]. Some Californian province species extend their ranges northward in warm-regime years [253–255]. This may also be the case with S. norrisi which occurs offshore from San Francisco, northern California.
The only other estimation of the divergence time of spionid polychaetes based on molecular data was provided by Schulze et al. [256] for North American populations of Streblospio spp. Using an invertebrate molecular clock calibration for COI sequence divergence of 1.8–2.8% per million years suggested by Palumbi [257], they estimated that the Streblospio lineage split in the Gulf of Mexico and adjacent regions 7–11 mya. The suggested estimates corresponded to the sea level minima in the examined region and this was considered as support for the obtained values of the estimates.
Conclusions
The results of molecular analyses performed in the present study unambiguously showed the presence of a series of sibling species within the genus Spiophanes. It means that specific identifications of this complicated group of spionids in many cases should be verified by molecular data. Molecular identities of Spiophanes, especially from European waters, are needed for confident identifications of these polychaetes around the world.
Supporting information
Sampling location data and museum registration numbers of newly collected material of Spiophanes spp.; museum samples examined during this study; material from the Norwegian, North, Mediterranean and Aegean seas and North Pacific reported by Meißner & Blank [111] and from the North Sea identified by Dieter Fiege, Markus Böggemann and Karin Meißner which is deposited in the SMF and other polychaete collections and was only partially re-examined by the first author (VIR); records of S. bombyx (= S. uschakowi) from Japan provided by Imajima [88, 116–118], for which no museum numbers were reported; records of S. bombyx (= S. cf. norrisi) from Chile, Argentina and the Falkland Islands provided by Carrasco [119] and Blake [48]; records of S. bombyx (here referred either to S. bombyx or S. cf. convexus) from Spain provided by Meißner [8].
(XLSX)
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for COI (534 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 16S (244 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 18S (1656 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 28S (287 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for Histone 3 (297 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Acknowledgments
Our sincere thanks are to Peter Garwood for organizing a field trip onboard R/V Bernicia in Northumbria; Jane Delany for providing generous support and working conditions at the Dove Marine Laboratory, Cullercoats, UK; Kristine Hopland Sperre for help in sampling in Norway, and Marco Sigovini for help in sampling in Venice Lagoon; Paulo da Cunha Lana and Alvaro Migotto for generous support in Brazil; Leslie Harris and Christina Piotrowski for help with museum collections. Our sincere gratitude is also to Dorothy Norris, Kristin Politano, Dagmar Lackschewitz, Barbara Mikac, María Martha (Pitu) Mendez, Kevin Kocot and Vinicius Miranda for providing Spiophanes specimens used in this study, to Børge Holte and Katrine Kongshavn for providing Spiophanes specimens collected by the MAREANO Project from offshore Norway, and to Greg Rouse for providing COI and 18S sequences of Trochochaeta multisetosa from Sweden. Spiophanes hakaiensis n. sp. was collected and examined alive by VIR during the MarineGEO Hakai-Smithsonian BioBlitz-2017 on Calvert Island, British Columbia, Canada, initiated by Gustav Paulay and Emmett Duffy and generously supported by the Hakai Institute and Tula Foundation; Eric Peterson and Christina Munck provided fantastic facilities for the BioBlitz at the Hakai Institute; Matt Lemay, Gillian Sadlier-Brown and the Canadian Centre for DNA Barcoding provided COI sequencing of the collected material. Vyacheslav V. Potin provided complete information about the type specimens of S. uschakowi; Birger Neuhaus provided information about the type specimens of S. kroyeri; Lena Gustavsson provided information about the type specimens of S. soederstroemi; Ken Halanych provided information about sequenced specimens T. multisetosa from California, USA; Ruth Barnich provided information about samples collected by UnicoMarine. Walter Brown and Susann Braden helped with SEM at the USNM. Many valuable comments and edits on the manuscript were provided by Tim M. Worsfold, James T. Carlton and two anonymous reviewers. To all these colleagues, we express our sincere gratitude. Sequencing support was provided by the Diversity Initiative for the Southern California Ocean (DISCO, a research initiative of the Natural History Museum of Los Angeles County).
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
Financial support was provided to TVN by the Russian Foundation for Basic Research (https://www.rfbr.ru/rffi/eng Grant 18-05-60158) and the Russian Science Foundation (http://rscf.ru/en/ Grant 16-14-10173), to VVP & VVM by the Far Eastern Branch of the Russian Academy of Sciences (http://www.febras.ru/2012-01-25-06-37-30.html Grant 18-4-040), to VIR by the Research Council of Norway (https://www.forskningsradet.no/en/ Project 280724 “Environmental monitoring of Arctic coastal ecosystems: Sensitivity to petroleum pollution (Arctic EcoSens)”), the BEQUALM/NMBAQC Scheme, UK (http://www.nmbaqcs.org/), and the Canadian Museum of Nature (https://nature.ca/en/home Scientific Training Program, 2019 Visiting Scientist Award), to SY by the Collaborative Genome Program of the Korea Institute of Marine Science and Technology Promotion (KIMST) funded by the Ministry of Oceans and Fisheries (https://www.mof.go.kr/eng/index.do No. 20180430). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Appeltans W, Ahyong ST, Anderson G, Angel MV, Artois T, Bailly N, et al. The magnitude of global marine species diversity. Curr Biol. 2012;22(23): 2189–202. 10.1016/j.cub.2012.09.036 [DOI] [PubMed] [Google Scholar]
- 2.Nygren A. Cryptic polychaete diversity: a review. Zool Scr. 2013;43(2): 172–83. 10.1111/zsc.12044 [DOI] [Google Scholar]
- 3.Hutchings P, Kupriyanova E. Cosmopolitan polychaetes–fact or fiction? Personal and historical perspectives. Invertebr Syst. 2018;32: 1–9. 10.1071/IS17035 [DOI] [Google Scholar]
- 4.Nygren A, Parapar J, Pons J, Meißner K, Bakken T, Kongsrud JA, et al. A mega-cryptic species complex hidden among one of the most common annelids in the North East Atlantic. PLoS ONE. 2018;13(6): e0198356 10.1371/journal.pone.0198356 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Müller OF, Abildgaard PC, Vahl M, Holten JS, Rathke J. Zoologia Danica seu Animalium Daniae et Norvegiae rariorum ac minus notorum. Descriptiones et Historia. Vol. IV Havniae [Copenhagen]: N. Christensen; 1806. 46 + pls 121–60 pp. [Google Scholar]
- 6.Sikorski AV. Review of Laonice (Spionidae, Annelida) with remarks on several species and a description of a new species from South Africa. Ital J Zool. 2011;78(S1): 201–14. [Google Scholar]
- 7.Yokoyama H. A revision of the genus Paraprionospio Caullery (Polychaeta: Spionidae). Zool J Linn Soc. 2007;151(2): 253–84. [Google Scholar]
- 8.Meißner K. Revision of the genus Spiophanes (Polychaeta, Spionidae); with new synonymies, new records and descriptions of new species. Zoosyst Evol. 2005;81(1): 3–65. 10.1002/mmnz.200310001 [DOI] [Google Scholar]
- 9.Claparède E. Les Annélides Chétopodes du Golfe de Naples. Supplément. Mém Soc Phys Hist nat Genève. 1870a;20(2): 365–542. [Google Scholar]
- 10.Claparède E. Les Annélides Chétopodes du Golfe de Naples. Supplément. Genève: Ramboz et Schuchardt; 1870b. 178 pp. [Google Scholar]
- 11.Mesnil F. Études de morphologie externe chez les Annélides. I. Les Spionidiens des côtes de la Manche. Bull Sci Fr Belg. 1896;29(1): 110–287. 10.5962/bhl.part.19052 [DOI] [Google Scholar]
- 12.Michaelsen W. Die Polychaetenfauna der deutschen Meere, einschliesslich der benachbarten und verbindenden Gebiete. Wiss Meeresunters, NF. 1897;2(1): 1–216. [Google Scholar]
- 13.Ad Saint-Joseph. Les Annélides polychètes des cotes de France (Manche et Océan). Ann Sci Nat, VIII Sér, Zool, Paris. 1898;5: 209–464. [Google Scholar]
- 14.McIntosh WC. Notes from the Gatty Marine Laboratory, St. Andrews. No. XXXI. 2. On the British Spionidae. 3. On the Spionidae dredged by H.M.S. 'Porcupine' in 1869 and 1870. Ann Mag Nat Hist, London, Ser 8. 1909;3(14): 156–80.
- 15.McIntosh WC. A monograph of the British marine annelids. Vol. 3 Part 1.—Text. Polychæta. Opheliidæ to Ammocharidæ London: Ray Society; 1915. 368 pp. [Google Scholar]
- 16.McIntosh WC. A monograph of the British marine annelids. Vol. 3 Part 2.—Plates. Polychæta. Opheliidæ to Ammocharidæ. London: Ray Society; 1915. [Google Scholar]
- 17.Southern R. Archiannelida and Polychaeta. Proc Roy Irish Acad. 1914;31(47): 1–160. [Google Scholar]
- 18.Eliason A. Biologisch-faunistische Untersuchungen aus dem Öresund. V. Polychaeta. Lunds Univ Årsskrift, NF, Avd 2. 1920;16(6): 1–103. [Google Scholar]
- 19.Eliason A. Undersökningar över Öresund. 41. Weitere Untersuchungen über die Polychaetenfauna des Öresunds. Lunds Univ Årsskrift, NF, Avd 2. 1962;58(9): 1–98. [Google Scholar]
- 20.Eliason A. Die Polychaeten der Skagerak-Expedition 1933. Zool Bidr Uppsala. 1962;33: 207–93. [Google Scholar]
- 21.Söderström A. Studien über die Polychätenfamilie Spionidae. Inaugural-Dissertation. Uppsala: Almquist & Wicksells; 1920. 286 pp. [Google Scholar]
- 22.Moore HB. Marine fauna of the Isle of Man. Liverpool: University Press of Liverpool; 1937. 293 pp. [Google Scholar]
- 23.Friedrich H. Polychaeta. Tierwelt Nord- und Ostsee. 1938;32(6b): 1–201. [Google Scholar]
- 24.Einarsson H. Survey of the benthonic animal communities of Faxa Bay (Iceland). Medd Komm Danm Fisk- og Havunders, Ser Fiskeri. 1941;11(1): 1–46. [Google Scholar]
- 25.Thorson G. Reproduction and larval development of Danish marine bottom invertebrates, with special reference to the planktonic larvae in the Sound (Øresund). Medd Komm Danm Fisk- og Havunders, Ser Plankton. 1946;4(1): 1–523. [Google Scholar]
- 26.Caspers H. Die Lebensgemeinschaft der Helgoländer Austernbank. Helgol Wissenschaft Meeresunters. 1950;3: 119–69. [Google Scholar]
- 27.Wesenberg-Lund E. Polychaeta. Zool Iceland. 1951;2(19): 1–182.
- 28.Clark RB. The fauna of the Clyde Sea area. Polychaeta. Millport: Scottish Marine Biological Association; 1960. 71 pp. [Google Scholar]
- 29.Southward EC. Polychaeta. In: Bruce JR, Colman JS, Jones NS, editors. Marine Fauna of the Isle of Man. Liverpool: Liverpool University Press; 1963. pp. 84–108. [Google Scholar]
- 30.Amoureux L. Annelides polychetes captures au large de la cote d'Arcachon. Inventaire taxonomique. Bull Soc Linn Bordeaux. 1971;1(7): 147–64. [Google Scholar]
- 31.Mackie ASY, Parmiter C, Tong LKY. Distribution and diversity of Polychaeta in the southern Irish Sea. Bull Mar Sci. 1997;60(2): 467–81. [Google Scholar]
- 32.Böggemann M. Polychaeten aus der Deutschen Bucht. Cour Forschungsinst Senckenberg. 1998;202: 1–315. [Google Scholar]
- 33.Sikorski AV. Spionidae Grube, 1850. In: Zhirkov IA, editor. Polychaeta of the Arctic Ocean. Moscow: Yanus-K; 2001. pp. 271–332.
- 34.Dauvin J-C, Dewarumez J-M, Gentil F. Liste actualisée des espèces d'Annélides Polychètes présentes em Manche. Cah Biol March 2003;44(1): 67–95. [Google Scholar]
- 35.Coolen JWP, Bos OG, Glorius S, Lengkeek W, Cuperus J, van der Weide B, et al. Reefs, sand and reef-like sand: A comparison of the benthic biodiversity of habitats in the Dutch Borkum Reef Grounds. J Sea Res. 2015;103: 84–92. 10.1016/j.seares.2015.06.010 [DOI] [Google Scholar]
- 36.Wells HW, Gray IE. Polychaetous annelids of the Cape Hatteras area. J Elisha Mitchell Sci Soc. 1964;80(2): 70–8. [Google Scholar]
- 37.Hartman O. Deep-water benthic polychaetous annelids off New England to Bermuda and other North Atlantic areas. Allan Hancock Found Publ, Occ Pap. 1965;28: 1–378. [Google Scholar]
- 38.Foster NM. Spionidae (Polychaeta) of the Gulf of Mexico and the Caribbean Sea. Stud fauna Curaçao. 1971;36(129): 1–183. [Google Scholar]
- 39.Day JH. New polychaeta from Beaufort, with a key to all species recorded from North Carolina. NOAA Tech Rep Natn Mar Fish Service. 1973;CIRC-375: 1–140. [Google Scholar]
- 40.Kinner P, Maurer D. Polychaetous annelids of the Delaware Bay Region. Fish Bull. 1978;76(1): 209–24. [Google Scholar]
- 41.Dauer DM, Maybury CA, Ewing RM. Feeding behavior and general ecology of several spionid polychaetes from the Chesapeake Bay. J Exp Mar Biol Ecol. 1981;54(1): 21–38. 10.1016/0022-0981(81)90100-3 [DOI] [Google Scholar]
- 42.Dauer DM, Stokes TL, Barker HR, Ewing RM, Sourbeer JW. Macrobenthic communities of the lower Chesapeake Bay. IV. Bay-wide transects and the inner continental shelf. Benthic studies of the Lower Chesapeake Bay 7. Int Rev Gesamten Hydrobiol. 1984;69(1): 1–22. [Google Scholar]
- 43.Bloom SA. Seasonality and structure of a macrobenthic seagrass community on the Florida Gulf coast. Int Rev Gesamten Hydrobiol. 1983;68(4): 539–64. [Google Scholar]
- 44.Tourtellotte GH, Dauer DM. Macrobenthic communities of the lower Chesapeake Bay. II. Lynnhaven Roads, Lynnahven Bay, Broad Bay, and Linkhorn Bay. Int Rev Gesamten Hydrobiol. 1983;68(1): 59–72. 10.1002/iroh.19830680105 [DOI] [Google Scholar]
- 45.Bartholomew A. Polychaete Key for Chesapeake Bay and Coastal Virginia: Virginia Institute of Marine Science, College of William and Mary; 2001. 83 pp. [Google Scholar]
- 46.Carr CM. Polychaete diversity and distribution patterns in Canadian marine waters. Mar Biodivers. 2012;42(2): 93–107. 10.1007/s12526-011-0095-y [DOI] [Google Scholar]
- 47.Fauvel P. Annélides Polychètes des Iles Falkland recueillies par M. Rupert Vallentin Esq. (1902–1910). Arch Zool Expér Géner. 1916;55(10): 417–82. [Google Scholar]
- 48.Blake JA. Polychaetes of the family Spionidae from South America, Antarctica, and adjacent seas and islands. Biol Antarctic Seas XIV Antarctic Res Ser. 1983;39(3): 205–88. 10.1029/AR039p0205 [DOI] [Google Scholar]
- 49.Bolívar GA, Lana PC. Spionidae (Annelida: Polychaeta) do litoral do Estado do Paraná. Nerítica. 1987;2(1): 107–48. [Google Scholar]
- 50.Bolívar GA, Lana PC. Padrões de distribuição de Spionidae e Magelonidae (Annelida: Polychaeta) do litoral do estado do Paraná. An Sem Reg Ecol. 1988;6: 247–67. [Google Scholar]
- 51.Muniz P, Pires AMS. Polychaete associations in a subtropical environment (São Sebastião Channel, Brazil): A structural analysis. Mar Ecol. 2000;21(2): 145–60. [Google Scholar]
- 52.Pardo EV, Radashevsky VI, Amaral ACZ. Classe Polychaeta—Família Spionidae. In: Amaral ACZ, Rizzo AE, Arruda EP, editors. São Paulo: EDUSP; 2005. pp. 205–20. [Google Scholar]
- 53.Berkeley E. Polychaetous annelids from the Nanaimo district. Part 3. Leodicidae to Spionidae. Contr Can Biol Fish. 1927;3(17): 407–22. [Google Scholar]
- 54.Hartman O. The marine annelids of North Carolina. Bull Duke Univ Mar Stn. 1945;2: 1–54. [Google Scholar]
- 55.Hartman O. The littoral marine annelids of the Gulf of Mexico. Publ Inst Mar Sci, Port Aransas, Texas. 1951;2(1): 7–124. [Google Scholar]
- 56.Hartman O. Quantitive survey of the benthos of San Pedro Basin, southern California. Part III. Systematics: Polychaetes. Allan Hancock Pac Exped. 1955;27(3): 1–86. [Google Scholar]
- 57.Berkeley E, Berkeley C. Annelida. Polychaeta Sedentaria. Canadian Pacific Fauna. J Fish Res Board Can. 1952;9b(2): 1–139. [Google Scholar]
- 58.Berkeley E, Berkeley C. Additions to the Polychaete fauna of Canada, with comments on some older records. J Fish Res Board Can. 1954;11(4): 454–71. [Google Scholar]
- 59.Blake JA. Phylum Annelida: Class Polychaeta. In: Smith RI, Carlton JT, editors. Light's Manual: Intertidal Invertebrates of the Central California Coast. Berkeley: University of California Press; 1975. pp. 151–243. [Google Scholar]
- 60.Light WJ. Spionidae (Annelida: Polychaeta) from San Francisco Bay, California: a revised list with nomenclatural changes, new records, and comments on related species from the northeastern Pacific Ocean. Proc Biol Soc Wash. 1977;90(1): 66–88. [Google Scholar]
- 61.Light WJ. Spionidae (Polychaeta, Annelida). Lee WL, editor. Pacific Grove, California: The Boxwood Press; 1978. 211 pp. [Google Scholar]
- 62.Hobson KD, Banse K. Sedentariate and archiannelid polychaetes of British Columbia and Washington. Can Bull Fish Aquat Sci. 1981;209: 1–144. [Google Scholar]
- 63.Hernández-Alcántara P, González-Ortíz L, Solís-Weiss V. Los espiónidos (Polychaeta: Spionidae) del Golfo de California y Golfo de Tehuantepec, México. Rev Biol Trop. 1994;42(3): 567–77. [Google Scholar]
- 64.Blake JA. Family Spionidae Grube, 1850. Including a review of the genera and species from California and a revision of the genus Polydora Bosc, 1802. In: Blake JA, Hilbig B, Scott PH, editors. Taxonomic Atlas of the Benthic Fauna of the Santa Maria Basin and Western Santa Barbara Channel Volume 6 The Annelida Part 3—Polychaeta: Orbiniidae to Cossuridae. Santa Barbara, California: Santa Barbara Museum of Natural History; 1996. pp. 81–223. [Google Scholar]
- 65.Díaz-Castañeda V. The early establishment and development of a polychaete community settled on artificial substrata at Todos Santos Bay, Baja California, Mexico. Bull Mar Sci. 2000;67(1): 321–35. [Google Scholar]
- 66.Hilbig B, Blake JA. Deep-sea polychaete communities in the Northeast Pacific Ocean off the Gulf of the Farallones, California. Bull Mar Sci. 2006;78(2): 243–69. [Google Scholar]
- 67.Carrasco FD. Spionidae (Polychaeta) provenientes de la Bahía de Concepción y lugares adyacentes. Bol Soc Biol Concepción. 1974;48: 185–201. [Google Scholar]
- 68.Carrasco FD, Gallardo VA. Abundance and distribution of the macrobenthic infauna of the Gulf of Arauco, Chile. Int Rev Gesamten Hydrobiol. 1983;68(6): 825–38. [Google Scholar]
- 69.Carrasco FD, Gallardo VA, Medrano S. Sublittoral macrobenthic infaunal assemblages of two nearby embayments from Central Chile. Int Rev Gesamten Hydrobiol. 1988;73(4): 441–55. [Google Scholar]
- 70.Hartmann-Schröder G. Beitrag zur Polychaetenfauna der Bahia Quillaipe (Süd-Chile). Helgol Meeresunters. 1991;45: 39–58. [Google Scholar]
- 71.Rozbaczylo N, Salgado P. Poliquetos Spionidae de fondos blandos submareales de la Bahía de Valparaíso, Chile (Annelida: Polychaeta). Estud Oceanol. 1993;12: 17–28. [Google Scholar]
- 72.Quiroga E, Soto R, Rozbaczylo N. Los poliquetos espiónidos (Polychaeta: Spionidae) y su importancia en la estructura de una comunidad. Un caso de estudio en Bahía Iquique, norte de Chile (20º11'S, 70º10'W). Gayana. 1999;63(1): 1–16. [Google Scholar]
- 73.Montiel A, Quiroga E, Gerdes D. Diversity and spatial distribution patterns of polychaete assemblages in the Paso Ancho, Straits of Magellan Chile Cont Shelf Res. 2011;31(3–4): 304–14. [Google Scholar]
- 74.Bailey-Brock JH. Habitats of tubicolous polychaetes from the Hawaiian Islands and Johnston Atoll. Pac Sci. 1976;30(1): 69–81. [Google Scholar]
- 75.Ward LA. Spionidae (Polychaeta: Annelida) from Hawaii, with descriptions of five new species. Proc Biol Soc Wash. 1981;94(3): 713–30. [Google Scholar]
- 76.Okuda S. Spioniform polychaetes from Japan. J Fac Sci, Hokkaido Imp Univ Ser VI, Zool. 1937;5(3): 217–54. [Google Scholar]
- 77.Uschakov PV. Polychaetes from the Sea of Okhotsk. Explor Far East Seas USSR. 1950;2: 140–237. [Google Scholar]
- 78.Uschakov PV. Polychaeta of the Far Eastern Seas of the USSR. Keys to the fauna of the USSR. 1955;56: 1–445. [Google Scholar]
- 79.Annenkova NP. Polychaetous worms (Polychaeta) from the Chukotsk Sea and Bering Strait. Moscow-Leningrad: USSR Academy of Sciences Press; 1952. pp. 112–37. [Google Scholar]
- 80.Imajima M, Hartman O. The polychaetous annelids of Japan. Part II. Allan Hancock Found Publ, Occ Pap. 1964;26: 236–452. [Google Scholar]
- 81.Wu BL, Sun RP, Shen SP. A preliminary report on the polychaete larvae in the plankton from the Zhongsha Islands, Guangdond Province, China. In: Zhogguo K, editor. Research report on invertebrates in waters of Xisha and Zhongsha Islands, China Nanhai Institute of Oceanography, Academia Sinica Beijing: Science Press; 1978. pp. 171–200. [Google Scholar]
- 82.Mak PMS. The coral associated polychaetes of Hong Kong, with special reference to the serpulids. In: Morton BS, Tseng CK, editors. The Marine Flora and Fauna of Hong Kong and Southern China Volume 2 Proceedings of the First International Marine Biological Workshop, Hong Kong, 1980. Hong Kong: Hong Kong University Press; 1982. pp. 595–617. [Google Scholar]
- 83.Buzhinskaja GN. Polychaeta of the shelf off south Sakhalin and their ecology. Explor Fauna Seas. 1985;30(38): 72–224. [Google Scholar]
- 84.Buzhinskaja GN. Polychaetes of the Far East Seas of Russia and adjacent waters of the Pacific Ocean: annotated checklist and bibliography. Moscow: KMK Scientific Press; 2013. 131 pp. [Google Scholar]
- 85.Lee J-H. Distributional pattern of polychaetes in the benthic community of the Yellow Sea. Bull Korean Fish Soc. 1987;20(3): 224–9. [Google Scholar]
- 86.Lee J-H, Chin P. Quantitative importance and species composition of polychaetes in the benthic community of the Yellow Sea. Bull Korean Fish Soc. 1989;22(4): 189–95. [Google Scholar]
- 87.Paik E-I. Illustrated encyclopedia of fauna & flora of Korea. Vol. 31 Polychaeta: Seoul; 1989. 764 pp. [Google Scholar]
- 88.Imajima M. Spionidae (Annelida, Polychaeta) from Japan. VII. The genus Spiophanes. Bull Natl Sci Mus, Tokyo, Ser A (Zool). 1991;17(3): 115–37. [Google Scholar]
- 89.Choi J-W, Koh C-H. The distribution and feeding guilds of the polychaete community in the west coast off Kunsan, Korea. J Oceanol Soc Korea. 1992;27(3): 197–209. [Google Scholar]
- 90.Sun DY. Annelida: Polychaeta. In: Zong-guo H, editor. Marine species and their distributions in China's seas. Beijing: China Ocean Press; 1994. pp. 343–77. [Google Scholar]
- 91.Paxton H, Chou LM. Polychaetous annelids from the South China Sea. Raffles Bull Zool. 2000;Supplement 8: 209–32. [Google Scholar]
- 92.Sigvaldadóttir E. Species of the family Spionidae (Polychaeta) from the Andaman Sea. Phuket Mar Biol Cent Spec Publ. 2002;24: 237–46. [Google Scholar]
- 93.Zhou J. Annelida: Polychaeta: Spionidae. In: Liu JY, editor. Checklist of marine biota of China Seas. Beijing: Science Press; 2008. pp. 416–7. [Google Scholar]
- 94.Choi J-W. Chapter 14. Benthic Animals. In: Chang K-I, Zhang C-I, Park C, Kang D-J, Ju S-J, Lee S-H, et al. , editors. Oceanography of the East Sea (Japan Sea): Springer International Publishing; 2015. pp. 347–72. [Google Scholar]
- 95.Glasby CJ, Lee Y-L, Hsueh P-W. Marine Annelida (excluding clitellates and siboglinids) from the South China Sea. Raffles Bull Zool Suppl. 2016;34: 178–234. [Google Scholar]
- 96.Gillet P. Biogeography and polychaete assemblages from subantarctic islands (Indian Ocean): Marion Dufresne MD/08 benthos expedition to Marion, Prince Edward and Crozet Islands. Bull Mar Sci. 1991;48(2): 358–68. [Google Scholar]
- 97.Pati SK, Swain D, Sahu KC, Sharma RM. Chapter: 5. Diversity and distribution of polychaetes (Annelida: Polychaeta) along Maharashtra coast, India. In: Rawat M, Dookia S, Sivaperuman C, editors. Aquatic Ecosystem: Biodiversity, Ecology and Conservation New Delhi: Springer; 2015. pp. 53–65. [Google Scholar]
- 98.Fauvel P. Contribution à la faune des Annélides Polychètes du Maroc. Mém Soc Sci Nat Maroc. 1936;43: 1–143. [Google Scholar]
- 99.Kirkegaard JB. The Polychaeta of West Africa Part I. Sedentary species. Atlantide Rep. 1959;5: 7–117. [Google Scholar]
- 100.Day JH. The Polychaet fauna of South Africa. Part 6. Sedentary species dredged off Cape coasts with a few new records from the shore. J Linn Soc London, Zool. 1961;44(299): 463–560. [Google Scholar]
- 101.Day JH. A monograph on the Polychaeta of Southern Africa. Part 2. Sedentaria. London: The British Museum (Natural History); 1967. i–xvii, 459–878 pp. [Google Scholar]
- 102.Intes A, Le Lœuff P. Les Annélides Polychètes de Côte d'Ivoire. II.—Polychètes sédentaires—compte rendu systématique. Cah ORSTOM, Sér Océanogr. 1977;15(3): 215–49. [Google Scholar]
- 103.Bayed A, Glémarec M. Apports de la mission Biomar à la connaissance des Annélides Polychètes des côtes du Maroc. Bull Inst Sci Rabat. 1987;11: 147–53. [Google Scholar]
- 104.Blake JA, Kudenov JD. The Spionidae (Polychaeta) from southeastern Australia and adjacent areas with a revision of the genera. Mem Natl Mus Vic. 1978;39: 171–280. [Google Scholar]
- 105.Hutchings P, Murray A. Taxonomy of polychaetes from the Hawkesbury River and the southern estuaries of New South Wales, Australia. Rec Aust Mus, Suppl. 1984;3: 1–118. 10.3853/j.0812-7387.3.1984.101 [DOI] [Google Scholar]
- 106.Roper DS, Smith DG, Read GB. Benthos associated with two New Zealand coastal outflats. NZ J Mar Fresh Res. 1989;23(2): 295–309. [Google Scholar]
- 107.Probert PK, Read GB, Grove SL, Rowden AA. Macrobenthic polychaete assemblages of the continental shelf and upper slope off the west coast of the South Island, New Zealand. NZ J Mar Fresh Res. 2001;35(5): 971–84. [Google Scholar]
- 108.Augener H. Antarktische und antiboreale Polychaeten nebst einer Hirudinee. Sci Res Norwegian Antarctic Exped 1927–1928. 1932;9: 1–86. [Google Scholar]
- 109.Hartman O. Polychaeta Myzostomidae and Sedentaria of Antarctica. Antarct Res Ser. 1966;7: 1–158. [Google Scholar]
- 110.Meißner K, Hutchings PA. Spiophanes species (Polychaeta: Spionidae) from Eastern Australia—with description of new species, new records and an emended generic diagnosis. Rec Aust Mus. 2003;55(2): 117–40. 10.3853/j.0067-1975.55.2003.1379 [DOI] [Google Scholar]
- 111.Meißner K, Blank M. Spiophanes norrisi sp. nov. (Polychaeta: Spionidae)—a new species from the NE Pacific coast, separated from the Spiophanes bombyx complex based on both morphological and genetic studies. Zootaxa. 2009;2278: 1–25. 10.5281/zenodo.191147 [DOI] [Google Scholar]
- 112.Zachs IG. Polychaeta of the North Japan Sea. Explor Seas USSR. 1933;19: 125–37. [Google Scholar]
- 113.Annenkova NP. Polychaeta of the North Japan Sea and their horizontal and vertical distribution. Rep Hydrobiol Exped Zool Inst Acad Sci USSR in 1934 to the Sea of Japan. 1938;1: 81–230. [Google Scholar]
- 114.Buzhinskaja GN. On the ecology of the Polychaetous Annelids of the Possjet Bay (the Sea of Japan). Explor Fauna Seas. 1967;5(13): 78–124. [Google Scholar]
- 115.Buzhinskaja GN, Britayev TA. The polychaete fauna of Vostok Bay (the Bay of Peter the Great, the Sea of Japan). In: Buzhinskaja GN, editor. Polychaeta and their ecological significance (Explor Fauna Seas, 43 (51)). St. Petersburg: Zoological Institute, Russian Academy of Sciences; 1992. pp. 82–98. [Google Scholar]
- 116.Imajima M. Polychaetous annelids around Sarufutsu, Northern Hokkaido. Bull Natl Sci Mus, Tokyo, Ser A (Zool). 1992;25: 125–33. [Google Scholar]
- 117.Imajima M. Deep-sea benthic polychaetous annelids of Tosa Bay, southwestern Japan. Natl Sci Mus Monogr. 2001;20: 31–100. [Google Scholar]
- 118.Imajima M. Polychaetous Annelids from Sagami Bay and the Sagami Sea, Central Japan. Mem Natn Sci Mus, Tokyo. 2006;40: 317–408. [Google Scholar]
- 119.Carrasco FD. Larvas de la familia Spionidae (Polychaeta) en el plancton de la Bahía de Concepción, Chile. Gayana, Zool. 1976;38: 1–63. [Google Scholar]
- 120.Struck TH, Schult N, Kusen T, Hickman E, Bleidorn C, McHugh D, et al. Annelid phylogeny and the status of Sipuncula and Echiura. BMC Evol Biol. 2007;7(57): 1–11. 10.1186/1471-2148-7-57 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Aylagas E, Borja Á, Irigoien X, Rodríguez-Ezpeleta N. Benchmarking DNA metabarcoding for biodiversity-based monitoring and assessment. Frontiers in Marine Science. 2016;3: 1–12. 10.3389/fmars.2016.00096 [DOI] [Google Scholar]
- 122.Mincks SL, Dyal PL, Paterson GLJ, Smith CR, Glover AG. A new species of Aurospio (Polychaeta, Spionidae) from the Antarctic shelf, with analysis of its ecology, reproductive biology and evolutionary history. Mar Ecol. 2009;30(2): 181–97. [Google Scholar]
- 123.Meißner K, Götting M. Spionidae (Annelida: ‘Polychaeta’: Canalipalpata) from Lizard Island, Great Barrier Reef, Australia: the genera Malacoceros, Scolelepis, Spio, Microspio, and Spiophanes. Zootaxa. 2015;4019(1): 378–413. 10.11646/zootaxa.4019.1.15 [DOI] [PubMed] [Google Scholar]
- 124.Radashevsky VI, Neretina TV, Pankova VV, Tzetlin AB, Choi J-W. Molecular identity, morphology and taxonomy of the Rhynchospio glutaea complex with a key to Rhynchospio species (Annelida, Spionidae). Syst Biodivers. 2014;12(4): 424–33. 10.1080/14772000.2014.941039 [DOI] [Google Scholar]
- 125.Radashevsky VI, Pankova VV, Neretina TV, Stupnikova AN, Tzetlin AB. Molecular analysis of the Pygospio elegans group of species (Annelida: Spionidae). Zootaxa. 2016;4083(2): 239–50. 10.11646/zootaxa.4083.2.4 [DOI] [PubMed] [Google Scholar]
- 126.Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994;3(5): 294–9. [PubMed] [Google Scholar]
- 127.Katoh K, Misawa K, Kuma Ki, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30 (14): 3059–66. 10.1093/nar/gkf436 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 128.Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 2013;30(4): 772–80. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 129.Castresana J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000;17(4): 540–52. 10.1093/oxfordjournals.molbev.a026334 [DOI] [PubMed] [Google Scholar]
- 130.Miller MA, Pfeiffer W, Schwartz T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov 2010 New Orleans, LA: IEEE; 2010. pp. 1–8. [Google Scholar]
- 131.Posada D, Crandall KA. MODELTEST: testing the model of DNA substitution. Bioinformatics. 1998;14(9): 817–8. 10.1093/bioinformatics/14.9.817 [DOI] [PubMed] [Google Scholar]
- 132.Clement M, Posada D, Crandall KA. TCS: A computer program to estimate gene genealogies. Mol Ecol. 2000;9: 1657–9. 10.1046/j.1365-294x.2000.01020.x [DOI] [PubMed] [Google Scholar]
- 133.Drummond AJ, Suchard MA, Xie D, Rambaut A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol Biol Evol. 2012;29(8): 1969–73. 10.1093/molbev/mss075 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 134.Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993;10(3): 512–26. 10.1093/oxfordjournals.molbev.a040023 [DOI] [PubMed] [Google Scholar]
- 135.Baele G, Lemey P, Bedford T, Rambaut A, Suchard MA, Alekseyenko AV. Improving the accuracy of demographic and molecular clock model comparison while accommodating phylogenetic uncertainty. Mol Biol Evol. 2012;29(9): 2157–67. 10.1093/molbev/mss084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 136.Baele G, Li WL, Drummond AJ, Suchard MA, Lemey P. Accurate model selection of relaxed molecular clocks in bayesian phylogenetics. Mol Biol Evol. 2013;30(2): 239–43. 10.1093/molbev/mss243 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 137.Drummond AJ, Ho SY, Phillips MJ, Rambaut A. Relaxed phylogenetics and dating with confidence. PLoS Biol. 2006;4(5): e88 10.1371/journal.pbio.0040088 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 138.Gernhard T. The conditioned reconstructed process. J Theor Biol. 2008;253(4): 769–78. 10.1016/j.jtbi.2008.04.005 [DOI] [PubMed] [Google Scholar]
- 139.Loeza-Quintana T, Carr CM, Khan T, Bhatt YA, Lyon SP, Hebert PDN, et al. Recalibrating the molecular clock for Arctic marine invertebrates based on DNA barcodes. Genome. 2019;62(3): 200–16. 10.1139/gen-2018-0107 [DOI] [PubMed] [Google Scholar]
- 140.Fauvel P. Polychètes sédentaires. Addenda aux Errantes, Archiannélides, Myzostomaires. Faune Fr. 1927;16: 1–494. [Google Scholar]
- 141.Rullier F. Les Annélides Polychètes du Bosphore, de la Mer de Marmara et de la Mer Noire, en relation avec celles de la Méditerranée. Rapp P-V Réun Com Int Explor Sci Mer Medit, Monaco. 1963;17(2): 161–260. [Google Scholar]
- 142.Bhaud M. Les larves planctoniques d’Annélides Polychètes; leur intérêt pour une meilleure connaissance faunistique. Vie Milieu. 1966;17B(1): 435–7. [Google Scholar]
- 143.Bhaud M. Contribution a l’écologie des larves pélagiques d’Annélides Polychètes à Banyuls-sur-Mer. Comparaisons avec les régions septentrionales. Vie Milieu. 1967;18B(2): 273–315. [Google Scholar]
- 144.Katzmann W. Die Polychaeten Rovinjs (Istrien/Jugoslawien). Zool Anz. 1972;188(1–2): 116–44. [Google Scholar]
- 145.Cognetti-Varriale A-M, Zunarelli-Vandini R. Distribution des Polychètes sur les fonds meubles infa littoraux dumolise (Adriatique). Cah Biol March 1978;19(1): 37–47. [Google Scholar]
- 146.Gambi MC, Giangrande A. Distribution of soft-bottom polychaetes in two coastal areas of the Tyrrhenian Sea (Italy): Structural analysis. Estuar Coast Shelf Sci. 1986;23(6): 847–62. [Google Scholar]
- 147.Sardá R. Polychaete communities related to plant covering in the mediolittoral and infralittoral zones of the Balearic Islands (Western Mediterranean). Mar Ecol. 1991;12(4): 341–60. [Google Scholar]
- 148.Somaschini A. A Mediterranean fine-sand polychaete community and the effect of the tube-dwelling Owenia fusiformis DELLE CHIAJE on community structure. Int Rev gesamten Hydrobiol Hydrograph. 1993;78(2): 219–33. [Google Scholar]
- 149.Martin D, Pinedo S, Sardá R. Distribution patterns and trophic structure of soft-bottom polychaete assemblages in a north-western Mediterranean shallow-water bay. Ophelia. 2000;53(1): 1–17. 10.1080/00785326.2000.10409431 [DOI] [Google Scholar]
- 150.Simboura N, Nicolaidou A. The polychaetes (Annelida, Polychaeta) of Greece: checklist, distribution and ecological characteristics. Monogr Mar Sci. 2001;4: 1–115. [Google Scholar]
- 151.Aleffi F, Bettoso N, Solis-Weiss V. Spatial distribution of soft-bottom polychaetes along western coast of the northern Adriatic Sea (Italy). ANNALES, Ser Hist Nat. 2003;13(2): 211–22. [Google Scholar]
- 152.Ayari R, Afli A. Bionomie benthique du petit Golfe de Tunis. Bull Inst Natn Scien Tech Mer de Salammbô. 2003;30: 79–90. [Google Scholar]
- 153.Ayari R, Afli A. Functional groups to establish the ecological quality of soft benthic fauna within Tunis Bay (western Mediterranean). Vie Milieu. 2008;58: 67–75. [Google Scholar]
- 154.Dagli E, Ergen Z, Çinar ME. The significance of Spionidae (Annelida, Polychaeta) species living in the benthic environment the coasts of Turkey. Turk Sucul Yasam Derg. 2007;3–5(5–8): 152–8. [Google Scholar]
- 155.Castelli A, Bianchi CN, Cantone G, Çinar ME, Gambi MC, Giangrande A, et al. Annelida Polychaeta. Biol Mar Mediterr. 2008;15 (suppl.): 327–77. [Google Scholar]
- 156.Mutlu E, Çinar ME, Ergev MB. Distribution of soft-bottom polychaetes of the Levantine coast of Turkey, eastern Mediterranean Sea. J Mar Syst. 2010;79: 23–35. [Google Scholar]
- 157.Lorenti M, Gambi MC, Guglielmo R, Patti FP, Scipione MB, Zupo V, et al. Soft-bottom macrofaunal assemblages in the Gulf of Salerno, Tyrrhenian Sea, Italy, an area affected by the invasion of the seaweed Caulerpa racemosa var. cylindracea. Mar Ecol. 2011;32(3): 320–34. [Google Scholar]
- 158.Serrano LG, Cardell MJ, Lozoya JP, Sardá R. A polychaete-dominated community in the NW Mediterranean Sea, 20 years after cessation of sewage discharges. Ital J Zool. 2011;78(S1): 333–46. [Google Scholar]
- 159.Çinar ME, Dagli E, Açik S. Annelids (Polychaeta and Oligochaeta) from the Sea of Marmara, with descriptions of five new species. J Nat Hist, London. 2011;45(33–34): 2105–43. [Google Scholar]
- 160.Çinar ME, Katagan T, Öztürk B, Bakir K, Dagli E, Açik S, et al. Spatio-temporal distributions of zoobenthos in soft substratum of Izmir Bay (Aegean Sea, eastern Mediterranean), with special emphasis on alien species and ecological quality status. J Mar Biol Assoc UK. 2012;92(7): 1457–77. 10.1017/S0025315412000264 [DOI] [Google Scholar]
- 161.Mikac B. A sea of worms: polychaete checklist of the Adriatic Sea. Zootaxa. 2015;3943(1): 1–172. 10.11646/zootaxa.3943.1.1 [DOI] [PubMed] [Google Scholar]
- 162.Delgado-Blas VH, Diaz-Diaz O, Vieitez JM. On the diversity of the genus Spiophanes Grube, 1860 (Annelida: Spionidae) in the Spanish peninsular coast, with descriptions of two new species. Cah Biol March 2019;60(4): 335–51. 10.21411/chm.a.f3ebdb5e [DOI] [Google Scholar]
- 163.Hannerz L. Larval development of the polychaete families Spionidae Sars, Disomidae Mesnil, and Poecilochaetidae n. fam. in the Gullmar Fjord (Sweden). Zool Bidr Uppsala. 1956;31: 1–204. [Google Scholar]
- 164.Hartmann-Schröder G. Annelida, Borstenwürmer, Polychaeta. Tierwelt Deutschlands. 1971;58: 1–594. [Google Scholar]
- 165.Hartmann-Schröder G. Annelida, Borstenwürmer, Polychaeta. Tierwelt Deutschlands. 1996;58(2., neubearbeitete Auflage): 1–645. [Google Scholar]
- 166.Cazaux C. Recherchez sur l'écologie et le développement larvaire des Polychètes de la région d'Arcachon. Thèse de Docteur ès Sciences Naturelles. Bordeaux: Université de Bordeaux; 1970. 355 pp. [Google Scholar]
- 167.Radashevsky VI, Yurchenko OV, Alexandrova YN. Fine structure of the gametes and spermiogenesis in Spiophanes uschakowi (Annelida: Spionidae) from the Sea of Japan, with comments on fertilization biology in broadcast-spawning spionids. Micron. 2018;115(1): 32–40. 10.1016/j.micron.2018.08.005 [DOI] [PubMed] [Google Scholar]
- 168.Annenkova NP. The Polychaeta fauna of the northern part of the Japan Sea. Explor Mers d'USSR. 1937;23: 139–216. [Google Scholar]
- 169.Uschakov PV. Polychaeta. A list of the fauna of the sea waters of the South Sakhalin and South Kurile Islands. Explor Far East Seas USSR. 1959;6: 201–8. [Google Scholar]
- 170.Pasternak FA. Quantitative distribution and faunistic composition of benthos of the Sakhalin Gulf and adjacent parts of Sea of Okhotsk. Proc Inst Oceanol Acad Sci USSR. 1957;23: 237–68. [Google Scholar]
- 171.Koblikov VN. Polychaete distribution in Peter the Great Bay (Sea of Japan). Proc Pac Res Inst Fish Oceanogr. 1977;101: 31–41. [Google Scholar]
- 172.Ozolinsh AV. Polychaetous worms (Sedentaria) from soft sediments of the subtidal zone of the Far East Marine Reserve. In: Gulbin VV, editor. Systematics and ecology of organisms from the Far East Marine Reserve. Vladivostok: FEB AS USSR; 1990. pp. 81–104. [Google Scholar]
- 173.Ozolinsh AV, Bagaveeva EV. Annelida. In: Tyurin AN, Drozdov AL, editors. Far-East Marine Biospherical Reserve Biota V 2. 2. Vladivostok: Dalnauka; 2004. pp. 135–46. [Google Scholar]
- 174.Radashevsky VI. Spionidae (Annelida) from shallow waters around the British Islands: an identification guide for the NMBAQC Scheme with an overview of spionid morphology and biology. Zootaxa. 2012;3152: 1–35. 10.5281/zenodo.209619 [DOI] [Google Scholar]
- 175.Hernández-Alcántara P, Solís-Weiss V. Systematics and distribution of the polychaetes (Annelida: Polychaeta) from the sublittoral zone in the Gulf of California. Oceánides. 1999;13(2): 25–38. [Google Scholar]
- 176.Méndez N. Annelid assemblages in soft bottoms subjected to human impact in the Urias estuary (Sinaloa, Mexico). Oceanol Acta. 2002;25(3–4): 139–47. [Google Scholar]
- 177.Díaz-Castañeda V, Valenzuela-Solano S. Polychaete fauna in the vicinity of bluefin tuna sea-cages in Ensenada, Baja California, Mexico. Zoosymposia. 2009;2: 505–26. [Google Scholar]
- 178.Blake JA. Spionida. In: Rouse G, Pleijel F, editors. Reproductive Biology and Phylogeny of Annelida Vol 4 of Series: Reproductive Biology and Phylogeny. Reproductive Biology and Phylogeny. Enfield, NH: Science Publisher; 2006. pp. 565–638. [Google Scholar]
- 179.Berkeley C. A checklist of Polychaeta recorded from British Columbia since 1923, with references to name changes, descriptions, and synonymies. II. Sedentaria. Can J Zool. 1968;46: 557–67. [DOI] [PubMed] [Google Scholar]
- 180.Carey AG Jr. Ecological observation on the benthic invertebrates from the central Oregon continental shelf. In: Pruter AF, Alverson DL, editors. The Columbia River Estuary and adjacent ocean waters: Bioenvironmental studies. Seattle: University of Washington Press; 1996. pp. 422–43. [Google Scholar]
- 181.Macdonald TA, Burd BJ, Macdonald VI, van Roodselaar A. Taxonomic and feeding guild classification for the marine benthic macroinvertebrates of the Strait of Georgia, British Columbia. Can Tech Rep Fish Aquat Sci. 2010;2874: 1–63. [Google Scholar]
- 182.Carrasco FD. Sublittoral macrobenthic fauna off Punta Coloso, Antofagasta, Northern Chile: High persistence of the polychaete assemblage. Bull Mar Sci. 1997;60(2): 443–59. [Google Scholar]
- 183.Mendez MM, Schwindt E, Bortolus A. Relationships between macroinfaunal invertebrates and physicochemical factors in two sandy beaches of Patagonia. J Mar Biol Assoc UK. 2010;90(3): 429–35. [Google Scholar]
- 184.Hartmann-Schröder G. Zur Kenntnis des Sublitorals der chilenischen Küste unter besonderer Berücksichtigung der Polychaeten und Ostracoden. (Mit Bemerkungen über den Einflub sauerstoffarmer Strömungen auf die Besiedlung von marinen Sedimenten). Teil II: Die Polychaeten des Sublitorals. Mitt Hambg Zool Mus Inst. 1965;62(Erg. Bd.): 59–305. [Google Scholar]
- 185.Chamberlin RV. New polychaetous annelids from Laguna Beach, California. Pomona College J Entomol Zool. 1919;11(1): 1–23. [Google Scholar]
- 186.Hartman O. Some contributions to the biology and life history of Spionidae from California. With keys to species and genera and descriptions of two new forms. Allan Hancock Pac Exped. 1941;7(4): 289–323. [Google Scholar]
- 187.Hartman O. Submarine canyons of southern California. Part III. Systematics: Polychaetes. Allan Hancock Pac Exped. 1963;27(3): 1–93. [Google Scholar]
- 188.Reish DJ, Winter HA. The ecology of Alamitos Bay, California, with special reference to pollution. Calif Fish Game. 1954;40(2): 105–21. [Google Scholar]
- 189.Barnard JL, Reish DJ. Ecology of Amphipoda and Polychaeta of Newport Bay, California. Allan Hancock Found Publ, Occ Pap. 1959;21: 1–106. [Google Scholar]
- 190.Reish DJ, Barnard JL. The benthic polychaeta and amphipoda of Morro Bay, California. Proc US Natn Mus. 1967;120(3565): 1–26. [Google Scholar]
- 191.Reish DJ. A biological survey of Bahia de Los Angeles, Gulf of California, Mexico. II. Benthic polychaetous annelids. Trans San Diego Soc Nat Hist. 1968;15(7): 67–106. 10.5962/bhl.part.12054 [DOI] [Google Scholar]
- 192.Reish DJ. Invertebrates, especially benthic annelids in outer Anaheim Bay. Fish Bull Calif Dep Fish Game. 1975;165: 73–8. [Google Scholar]
- 193.Kauwling TJ, Reish DJ. A quantitative study of the benthic polychaetous annelids of Anaheim Bay and Huntington Bay, California. Fish Bull Calif Dep Fish Game. 1975;165: 57–68. [Google Scholar]
- 194.Maurer D, Gerlinger T, Nguyen H. The response of two spionid polychaetes to natural processes and anthropogenic activities on the San Pedro Shelf, California. Ophelia. 1998;48(3): 185–206. [Google Scholar]
- 195.Salazar-Vallejo SI, Londoño-Mesa MH. Lista de especies y bibliografía de poliquetos (Polychaeta) del Pacífico Oriental Tropical. An Inst Biol, Univ Nac Auton Mex, Ser Zool. 2004;75(1): 9–97. [Google Scholar]
- 196.Hernández-Alcántara P, Solís-Weiss V. Distribution of the Polychaete assemblages on the continental shelf of the Northern Gulf of California, Eastern Pacific. Ital J Zool. 2011;78(S1): 280–9. 10.1080/11250003.2011.580660 [DOI] [Google Scholar]
- 197.Blake JA, Ruff RE. Annelida: Polychaeta. In: Carlton JT, editor. The Light & Smith manual: intertidal invertebrates from central California to Oregon. Berkeley, Los Angeles: University of California Press; 2007. pp. 309–410. [Google Scholar]
- 198.Schiff K, Greenstein D, Dodder N, Gillett DJ. Southern California Bight regional monitoring. Reg Stud Mar Sci. 2016;4: 34–46. 10.1016/j.rsma.2015.09.003 [DOI] [Google Scholar]
- 199.Hartman O. Catalogue of the Polychaetous Annelids of the World. Allan Hancock Found Publ, Occ Pap. 1959;23: 1–628. [Google Scholar]
- 200.Grube AE. Beschreibung neuer oder wenig bekannter Anneliden. Arch Naturgesch, Berlin. 1860;26(1): 71–118. [Google Scholar]
- 201.Hartman O. Non-pelagic Polychaeta of the Swedish Antarctic Expedition 1901–1903. Furth Zool Res Swedish Antarctic Exped 1901–1903. 1953;4(11): 1–83. [Google Scholar]
- 202.Orensanz JM, Gianuca NM. Contribuição ao conhecimento dos anelídos poliquetas do Rio Grande do Sul, Brasil. I. Lista sistemática preliminar e descrição de três novas espécies. Comun Mus Cienc PUCRGS. 1974;4: 1–37. [Google Scholar]
- 203.Rozbaczylo N, Castilla JC. Invertebrados marinos del Archipiélago de Juan Fernández. In: Castilla JC, editor.: Ediciones Universidad Católica de Chile; 1987. pp. 167–89. [Google Scholar]
- 204.Cañete JI, Leighton GL, Aguilera FF. Polychaetes from Aysén Fjord, Chile: distribution, abundance and biogeographical comparison with the shallow soft-bottom polychaete fauna from Antarctica and the Magellan Province. Sci March 1999;63(Supl. 1): 243–52. [Google Scholar]
- 205.Maciolek NJ. New species and records of Aonidella, Laonice, and Spiophanes (Polychaeta: Spionidae) from shelf and slope depth of the western north Atlantic. Bull Mar Sci. 2000;67(1): 529–47. [Google Scholar]
- 206.Lancellotti DA, Stotz WB. Effects of shoreline discharge of iron mine tailings on a marine soft-bottom community in northern Chile. Mar Pollut Bull. 2004;48(3–4): 303–12. 10.1016/j.marpolbul.2003.08.005 [DOI] [PubMed] [Google Scholar]
- 207.Palma M, Quiroga E, Gallardo VA, Arntz W, Gerdes D, Schneider W, et al. Macrobenthic animal assemblages of the continental margin off Chile (22° to 42°S). J Mar Biol Assoc UK. 2005;85(2): 233–45. 10.1017/S0025315405011112h [DOI] [Google Scholar]
- 208.Morgado EH, Amaral ACZ. Anelídeos poliquetos da região de Ubatuba (SP)—padrões de distribuição geográfica. Rev Bras Zool. 1989;6(3): 535–68. 10.1590/S0101-81751989000300013 [DOI] [Google Scholar]
- 209.Paiva PC. Trophic structure of a shelf polychaete taxocoenosis in southern Brazil. Cah Biol Mar. 1993;35(1): 39–55. [Google Scholar]
- 210.Paiva PC. Anelídeos poliquetas da plataforma continental norte do Estado de São Paulo: I—Padrões de densidade e diversidade específica. Bol Inst Oceanogr. 1993;41(1/2): 69–80. [Google Scholar]
- 211.Muniz P, Pires AMS. Trophic structure of polychaetes in the São Sebastião Channel (southeastern Brazil). Mar Biol (Berlin). 1999;134(3): 517–28. [Google Scholar]
- 212.Arasaki E, Muniz P, Pires-Vanin AMS. A functional analysis of the benthic macrofauna of the São Sebastião Channel (Southeastern Brazil). Mar Ecol. 2004;25(4): 249–63. [Google Scholar]
- 213.Santi L, Tavares M. Polychaete assemblages of an impacted estuary, Guanabara Bay, Rio de Janeiro, Brazil. Braz J Oceanogr. 2009;57(4): 287–303. [Google Scholar]
- 214.Scarabino F. Faunística y taxonomía de invertebrados bentónicos marinos y estuarinos de la costa uruguaya. In: Menafra R, Rodríguez-Gallego L, Scarabino F, Conde D, editors. Montevideo: Vida Silvestre Uruguay; 2006. pp. 113–42. [Google Scholar]
- 215.Pagliosa PR, Doria JG, Alves GF, Almeida TCM, Lorenzi L, Netto SA, et al. Polychaetes from Santa Catarina State (southern Brazil): checklist and remarks on species distribution. Zootaxa. 2012: 1–49. [Google Scholar]
- 216.Shimabukuro M, Bromberg S, Pires-Vanin AMS. Polychaete distribution on the southwestern Atlantic continental shelf. Mar Biol Res. 2016: 1–16. 10.1080/17451000.2015.1131299 [DOI] [Google Scholar]
- 217.Nordenskjöld OG. Die Schwedische Südpolar-Expedition und ihre geographische Tätigkeit. (Volume 1 of: Wissenschaftliche Ergebnisse der Swedischen Sudpolar-Expedition, 1901–1903). Stockholm: Lithographisches Institut des Generalstabs; 1911. [Google Scholar]
- 218.Hartman O. Polychaetous annelids collected by the USNS Eltanin and Staten Island cruises, chiefly from Antarctic Seas. Allan Hancock Monogr Mar Biol. 1967;2: 1–387. [Google Scholar]
- 219.Parapar J, López E, Gambi MC, Núñez J, Ramos A. Quantitative analysis of soft-bottom polychaetes of the Bellingshausen Sea and Gerlache Strait (Antarctica). Polar Biol. 2011;34: 715–30. [Google Scholar]
- 220.Norte-Campos AGC, Palla RQ. Distribution of family Spionidae (Annelida: Polychaeta) in the Calamianes Islands, northern Palawan, Philippines. Coast Mar Sci. 2006;30(1): 133–9. [Google Scholar]
- 221.Joydas TV, Qurban MA, Al-Suwailem A, Krishnakumar PK, Nazeer Z, Cali NA. Macrobenthic community structure in the northern Saudi waters of the Gulf, 14 years after the 1991 oil spill. Mar Pollut Bull. 2012;64(2): 325–35. 10.1016/j.marpolbul.2011.11.007 [DOI] [PubMed] [Google Scholar]
- 222.Hartwich G. Die Polychaeten-Typen des Zoologischen Museums in Berlin. Mitt Zool Mus Berl. 1993;69(1): 73–154. [Google Scholar]
- 223.Laubier L. Un spionidien des vases bathyales de Banyuls-sur-Mer, Spiophanes kroyeri reyssi ssp. n. Bull Soc Zool Fr. 1964;89(4): 562–77. [Google Scholar]
- 224.Sars GO. Diagnoser af nye Annelider fra Christianiafjorden, efter Professor M. Sars's efterladte Manuskripter. Forhand Vidensk-Selskab Christiania. 1872;for the year 1871: 406–17. [Google Scholar]
- 225.Sars M. Bidrag til Kundskaben om Christianiafjordens Fauna. III. Væsentlig udarbeidet efter Prof. Dr. M. Sars’s efterladte Manuscripter. Nyt Mag Naturvidensk. 1873;19: 201–81. [Google Scholar]
- 226.Jelsing J. Ultrastructural studies of dorsal ciliated organs in Spionidae (Annelida: Polychaeta). Hydrobiologia. 2003;496(1–3): 241–51. 10.1023/A:1026105200983 [DOI] [Google Scholar]
- 227.Zettler ML, Beermann J, Dannheim J, Ebbe B, Grotjahn M, Günther C-P, et al. An annotated checklist of macrozoobenthic species in German waters of the North and Baltic Seas. Helgol Mar Res. 2018;72(5): 1–10. 10.1186/s10152-018-0507-5 [DOI] [Google Scholar]
- 228.Berkeley E, Berkeley C. Notes on Polychaeta from the coast of western Canada. 1. Spionidae. Ann Mag Nat Hist, London, Ser 10. 1936;18: 468–77. [Google Scholar]
- 229.Berkeley E, Berkeley C. Some further records of pelagic Polychaeta from the northeast Pacific north of latitude 40ºN. and east of longitude 175ºW., together with records of Siphonophora, Mollusca and Tunicata from the same region. Can J Zool. 1960;38(4): 787–99. 10.1139/z60-083 [DOI] [Google Scholar]
- 230.Tauber P. Annulata Danica. En kritisk Revision af de i Danmark fundne Annulata, Chaetognatha, Gephyrea, Balanoglossi, Discophorea, Oligochaeta, Gymnocopa og Polychaeta. Copenhagen; 1879. 143 pp.
- 231.Kirkegaard JB. Havbørsteorme. II. Sedentaria. Danmarks Fauna. 1996;86: 1–451. [Google Scholar]
- 232.Pettibone MH. New species of polychaete worms (Spionidae: Spiophanes) from the east and west coast of North America. Proc Biol Soc Wash. 1962;75: 77–88. [Google Scholar]
- 233.Lana PC, Santos CSG, Garraffoni ARS, Oliveira VM, Radashevsky VI. Checklist of polychaete species from Paraná State (Southern Brazil). Check List. 2006;2(3): 30–63. 10.15560/2.3.30 [DOI] [Google Scholar]
- 234.Örsted AS. Annulatorum danicorum conspectus. Fasc. I. Maricolæ. Havniæ [Copenhagen]: Sumtibus Librariæ Wahlianæ; 1843. 52 pp. [Google Scholar]
- 235.Örsted AS. Zur Classification der Annulaten, mit Beschreibung einiger neuner oder unzulänglich bekannter Gattungen und Arten. Arch Naturgesch, Berlin. 1844;10(1): 99–112. [Google Scholar]
- 236.Thulin G. Biologisch-faunistische Untersuchungen aus dem Öresund. VI. Über Cossura longocirrata Webster und Benedict und über die Röhren von Disoma multisetosum Örsted. Lunds Univ Årsskrift, NF, Avd 2. 1921;17(10): 1–14. [Google Scholar]
- 237.Ditlevsen H. Polychæta. Zool Faroes. 1929;16: 1–83. [Google Scholar]
- 238.Wesenberg-Lund E. Polychæta. Danish Ingolf-Exped. 1950;4(14): 1–92. [Google Scholar]
- 239.Pettibone MH. Marine polychaete worms of the New England region. I. Families Aphroditidae through Trochochaetidae. Bull US Natl Mus. 1963;227(1): 1–356. [Google Scholar]
- 240.Weitbrecht BE. Muscular anatomy of Trochochaeta multisetosum (Polychaeta; Trochochaetidae). In: Hutchings PA, editor. Proceedings of the First International Polychaete Conference, Sydney Sydney: The Linnean Society of New South Wales; 1984. pp. 401–12. [Google Scholar]
- 241.Hartman O. Disoma franciscanum, a new marine annelid from California. J Wash Acad Sci. 1947;37(5): 160–9. [Google Scholar]
- 242.Blake JA, Arnofsky PL. Reproduction and larval development of the spioniform Polychaeta with application to systematics and phylogeny. Hydrobiologia. 1999;402: 57–106. 10.1023/A:1003784324125 [DOI] [Google Scholar]
- 243.Radashevsky VI, Rizzo AE, Peixoto AJM. First record of Trochochaeta japonica (Annelida: Spionidae) in Brazil with identification key to species of the genus. Zootaxa. 2018;4462(4): 566–78. 10.11646/zootaxa.4462.4.8 [DOI] [PubMed] [Google Scholar]
- 244.Gladenkov AY, Oleinik AE, Marincovich L Jr, Barinov KB. A refined age for the earliest opening of Bering Strait. Palaeogeography, Palaeoclimatology, Palaeoecology. 2002;183(3–4): 321–8. 10.1016/S0031-0182(02)00249-3 [DOI] [Google Scholar]
- 245.Gladenkov AY, Gladenkov Y, B. Onset of connections between the Pacific and Arctic Oceans through the Bering Strait in the Neogene. Stratigr Geol Correl. 2004;12(2): 175–87. [Google Scholar]
- 246.Herman Y, Hopkins DM. Arctic oceanic climate in Late Cenozoic time. Science. 1980;209(4456): 557–62. 10.1126/science.209.4456.557 [DOI] [PubMed] [Google Scholar]
- 247.Maslin MA, Haug GH, Sarnthein M, Tiedemann R. The progressive intensification of northern hemisphere glaciation as seen from the North Pacific. Geol Rundsch. 1996;85(3): 452–68. 10.1007/BF02369002 [DOI] [Google Scholar]
- 248.Haug GH, Sigman DM, Tiedemann R, Pedersen TF, Sarnthein M. Onset of permanent stratification in the subarctic Pacific Ocean. Nature. 1999;401(6755): 779–82. 10.1038/44550 [DOI] [Google Scholar]
- 249.Harris SA. Thermal history of the Arctic Ocean environs adjacent to North America during the last 3.5 Ma and a possible mechanism for the cause of the cold events (major glaciations and permafrost events). Prog Phys Geogr. 2005;29(2): 218–37. 10.1191/0309133305pp444ra [DOI] [Google Scholar]
- 250.Horikawa K, Martin EE, Basak C, Onodera J, Seki O, Sakamoto T, et al. Pliocene cooling enhanced by flow of low-salinity Bering Sea water to the Arctic Ocean. Nature Communications. 2015;6(7587): 1–9. 10.1038/ncomms8587 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 251.Hewitt G. The genetic legacy of the Quaternary ice ages. Nature. 2000;405(6789): 907–13. 10.1038/35016000 [DOI] [PubMed] [Google Scholar]
- 252.Valentine JW. Numerical analysis of marine mMolluscan ranges on the extratropical northeastern Pacific shelf. Limnol Oceanogr Methods. 1966;11(2): 198–211. 10.4319/lo.1966.11.2.0198 [DOI] [Google Scholar]
- 253.Burton RS. Intraspecific phylogeography across the Point Conception biogeographic boundary. Evolution. 1998;52(3): 734–45. 10.1111/j.1558-5646.1998.tb03698.x [DOI] [PubMed] [Google Scholar]
- 254.Hellberg ME, Balch DP, Roy K. Climate-driven range expansion and morphological evolution in a marine gastropod. Science. 2001;292(5522): 1707–10. 10.1126/science.1060102 [DOI] [PubMed] [Google Scholar]
- 255.Blanchette CA, Melissa Miner C, Raimondi PT, Lohse D, Heady KEK, Broitman BR. Biogeographical patterns of rocky intertidal communities along the Pacific coast of North America. J Biogeogr. 2008;35(9): 1593–607. 10.1111/j.1365-2699.2008.01913.x [DOI] [Google Scholar]
- 256.Schulze SR, Rice SA, Simon JL, Karl SA. Evolution of poecilogony and the biogeography of North American populations of the polychaete Streblospio. Evolution. 2000;54(4): 1247–59. 10.1111/j.0014-3820.2000.tb00558.x [DOI] [PubMed] [Google Scholar]
- 257.Palumbi SR. Nucleic acids. II. The polymerase chain reaction. In: Hillis DM, Moritz C, Mable BK, editors. Molecular Systematics, 2nd edition Sunderland, MA: Sinauer; 1996. pp. 205–81. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Sampling location data and museum registration numbers of newly collected material of Spiophanes spp.; museum samples examined during this study; material from the Norwegian, North, Mediterranean and Aegean seas and North Pacific reported by Meißner & Blank [111] and from the North Sea identified by Dieter Fiege, Markus Böggemann and Karin Meißner which is deposited in the SMF and other polychaete collections and was only partially re-examined by the first author (VIR); records of S. bombyx (= S. uschakowi) from Japan provided by Imajima [88, 116–118], for which no museum numbers were reported; records of S. bombyx (= S. cf. norrisi) from Chile, Argentina and the Falkland Islands provided by Carrasco [119] and Blake [48]; records of S. bombyx (here referred either to S. bombyx or S. cf. convexus) from Spain provided by Meißner [8].
(XLSX)
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for COI (534 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 16S (244 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 18S (1656 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for 28S (287 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Uncorrected pairwise average distances (p, in %) between specific clades for Histone 3 (297 bp) sequences used in the five-genes Bayesian analysis of Spiophanes spp. rooted with sequences of Trochochaeta multisetosa. The numbers of corresponding samples from Table 1 are given in parentheses after names and sampling locations of the species. Average distances between sympatric conspecific individuals in italics, maximal values of average distances between different Spiophanes species in bold, and minimal values of average distances between different Spiophanes species underlined.
(XLSX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.

















