Abstract
Phenanthrene (Phe) female rat model was established to explore the mechanism of Phe on immune impairment. The rats were randomly divided into three groups, including control (C), low (L), and high (H) groups. Phe was supplied to L and H groups at the dose of 180 and 900 mg/kg orally at first day and with the dose of 90 and 450 mg/kg by intraperitoneal injection at the last 2 days. The C group was enriched with the same volume of corn oil. The liver tissue was collected. Then, the protein and mRNA expressions of interleukin (IL)-35 and the concentration IL-17 were detected to evaluate the function of regulatory T cells (Treg cells) and T helper 17 cells (Th17 cells). In addition, IL-1β and interferon-γ (IFN-γ) were analyzed to evaluate the immune impairment. The results showed that the protein and mRNA expressions of IL-35 decreased significantly in H groups (P < 0.05). Meanwhile, there were significant increases in IL-17, IFN-γ and IL-1β in the liver of H group (P < 0.05). This study demonstrated that Phe exposure might be associated with the immune impairment via changing inflammatory mediators including IL-35 and IL-17 in female rats.
Keywords: interleukin-35, interleukin-17, phenanthrene, female
Introduction
In recent years, Particulate Matter 2.5 (PM 2.5)-related air pollution in China has attracted extensive concerns [1–3]. PM 2.5 could absorb much more toxic compounds, such as polycyclic aromatic hydrocarbons (PAHs), heavy metal and others [4]. Therein, PAHs are regarded as the main toxic constituents of ambient aerosols [5, 6]. PAHs are a large group of chemicals with 2–7 fused aromatic rings [7]. Some PAHs are well known as carcinogens, mutagens and teratogens [8] and therefore pose a serious threat to the health of human [9, 10]. China has the largest emissions of PAHs in the world and contributed of PAHs to global emissions due to the largest source contributions from traffic, industry and residential heating [1]. And the high levels of PAHs in northwestern China have been focused in recent years, particularly in winter aggravated by domestic heating [11].
Through the composition analysis of PAHs in our previous air sampling from a village in northwest China, the phenanthrene (Phe), a low molecular weight PAH, was ranked as top one of the 16 PAHs in local atmosphere [12]. Phe is a main component of environmental PAHs and can come from various ambient sources, including particulate matter formed from combusted coal, soil, diesel emissions, tobacco smoke, foodstuffs and some water sources [13]. Therefore, people are easily exposed to Phe through diet, breathing, smoking, drinking and occupational exposures in daily life. The association between impairments of immune functions and PAH exposure in rural women was confirmed in our previous study [11]. Then, Phe female rat model was established to explore the effects of Phe on oxidative stress and inflammation in our previous study to verify if the immune damage in field sample has the relationship with the Phe [12]. In that study, the cytokines interleukin (IL)-10, transforming growth factor-β (TGF-β) and Forkhead box transcription factor 3 (Foxp3) a specific biomarker of regulatory T cells (Treg cells), were all changed, hinting the effect of Phe on immune impairment, while the potential mechanism might be related to Treg cells [11, 12, 14].
IL-35 is a novel member of interleukin-12 cytokine family and is composed of IL-12 p35 (IL-12a) subunit and Epstein–Barr virus-induced gene 3(Ebi3) [15, 16]. And, it is an anti-inflammatory cytokine, which is secreted from Treg cells, and also an immunomodulator in autoimmune disorders with therapeutic effect through expansion of Treg cells and suppression of T helper (Th) 17 cells [17, 18]. IL-17 cytokine is mainly produced by Th17 cells, which is potent inflammatory factor for activating the adaptive immune response [19, 20]. The dynamic balance between Th17 cells and Treg cells may be closely related to the immune response [21, 22]. Th17 cells and Treg cells can be transformed into each other in some conditions, and the imbalanced distribution of Th17 cells and Treg cells could induce autoimmune diseases, infections, tumors and other diseases [23]. Meanwhile, IL-35 and IL-17 may indirectly reflect the function of Treg cells and Th17 cells in some extent. A recent study reported that the higher levels of serum IL-35 may reflect compensatory anti-inflammatory responses to inhibit Th17, Th2 and Th1 responses during the development and progression of systemic sclerosis [24]. Meanwhile, interferon-γ (IFN-γ) produced by Th1 cells, which is a key cytokine in bridging the innate and the adaptive arms of the immune system [25]. And IL-1β was a pro-inflammatory cytokine that is mainly secreted by activated monocytes/macrophages, such as dendritic cells, epithelial cells and endothelial cells [26]. Some previous studies reported that IL-1β could enhance the differentiation of T cells through activating the nuclear factor-κB signal pathway, including Th1, Treg and Th17 cells [27, 28]. Therefore, the integrated determination of IL-35, IL-17, IFN-γ and IL-1β could reflect immune impairments in some extent.
Although several studies in recent year focus on the adverse effects of PAHs, the relationship and mechanism between Phe exposure and cytokines related to immune cells are still limited. Our research team has found that Phe could affect some inflammatory cytokines, including immune cytokines related to Treg cells, in female rats. So, this study aimed to further explore the effects of Phe on IL-35, IL-17, IFN-γ and IL-1β in female rat liver and to provide the basis for the research of molecular mechanisms between impairments of immune functions and PAH exposure.
Materials and Methods
Literature data collection and analysis method
To avoid the daily updating bias in the process of collecting database, the studies were searched at the same day. The following terms were used in search: Topic = (“Polycyclic aromatic hydrocarbons or PAHs”) and Topic = (“Immune disease”). In this study, all articles from the year 2009 to 2019 (up to October) were included. The text data were downloaded from Web of Science (WOS) and were imported into VOS viewer 1.6.5 (Leiden University, Leiden, Netherlands). The data were analyzed objectively. VOS viewer was used to carry out the cluster analysis of the articles and the analysis of keywords.
Chemicals and reagents
Phe with a purity 98% was obtained from Sigma-Aldrich (St. Louis, MO, USA). Radio immune precipitation assay (RIPA) buffer, phenyl methane sulfonyl fluoride and phosphatase inhibitors were bought from Solarbio Sciences and Technology Co. Ltd (Beijing, China). Antibodies against IL-12a and Ebi3 were provided by Abcam Biotechnology (Cambridge, USA). β-Actin was chosen as the endogenous standard and purchased from Zhongshan Golden Bridge Biotech (Beijing, China). Peroxidase-conjugated secondary antibodies were acquired from Signalway Antibody (Wuhan, China). IL-17, IFN-γ and IL-1β ELISA kits were provided by Elabscience (Wuhan, China). Bicinchoninic acid (BCA) and the enhanced chemiluminescence reagent were provided by Thermo Scientific Biotechnology (Massachusetts, USA). TRIzol reagent was gained from Life Technologies (Massachusetts, USA).
Experimental setup
Animals and treatment
Female rats (Wistar, 180–200 g) were obtained from the Center for Experimental Animals at Lanzhou University (Gansu, China) with the National Animal Use License number of SCXK (Gan 2018-0002). The rats were housed in the animal room (temperature: 20 ± 2°C, relative humidity: 60 ± 10%) with a 12 h/12 h light–dark cycle and received a standard chow diet with ad libitum access to tap water. Before starting the experiment, they were kept in a 1-week acclimatization period. All rats were randomly divided into three groups, including control (C group), low dose (L group) and high dose (H group), which consist of six animals in each group. Phe was administered orally in corn oil with doses equivalent to 10 and 50% of the LD 50 (180 and 900 mg/kg, respectively) at first day and then by intraperitoneal injection in corn oil with dose (90 and 450 mg/kg, respectively) [29, 30]. The control rats received the same volume of corn oil. All rats in C, L and H groups were oral administration by the volume of 2 ml/100 g body weight and intraperitoneal injection by the volume of 1 ml/100 g body weight [29, 30].
The body weights of rats were measured every day. All rats were sacrificed after 72 h by cervical decapitation under ether anesthesia. Liver tissue was washed with ice-cold physiological saline and flash frozen and stored at −80°C until analysis. All experiments and treatments were approved by the Institutional Animal Ethical Clearance (IAEC) of Lanzhou University (ethical clearance number: IRB181201-1). And, all efforts were made to minimize the number of rats used in the study and reduce their suffering.
Tissue sample preparation
Approximately 100 mg of liver tissue was homogenized in tissue homogenizer with 900 μl ice-cold 0.9% physiological saline. The homogenate was centrifuged at 2500 r.p.m./min for 10 min and then the supernatants were diluted to an appropriate concentration with physiological saline.
Determinations of IL-17, IFN-γ and IL-1β
The concentration of IL-17, IFN-γ and IL-1β in liver was measured using commercial ELISA kits according to the manufacturer’s instructions. The absorbance values were measured at 450 nm using a microplate reader. The concentration of IL-17, IFN-γ and IL-1β was calculated according to the standard curve.
Western blotting
Approximately 100 mg of liver tissue was homogenized, respectively, in 1000 μl RIPA buffer containing 10 μl phosphatase inhibitor and 10 μl protease inhibitor and then was centrifuged at 14 000 g at 4°C for 10 min. BCA kit was used to quantify the protein concentrations. After add 5× sodium dodecyl sulfate (SDS) buffer in protein samples, and all mix was denatured at 100°C for 10 min. Protein samples (20 μg) and 2.5 μl rainbow prestained protein marker (10–170 kDa) were separated for western blot using SDS-polyacrylamide gel electrophoresis (SDS-PAGE). About 8–12% SDS-PAGE was used to separate the target proteins. Then, the proteins samples were transferred to polyvinylidene membranes (PVDF) in a transfer buffer, and the membranes were blocked for 2 h at room temperature in Tris-saline-Tween 20 buffer (TBST) containing 5% bovine serum albumin.
The membranes were incubated with primary antibodies including anti-IL-12a (dilution ratio: 1:1000) and Ebi3 (dilution ratio: 1:1000) at 4°C overnight. Then, the membranes were incubated with secondary anti-mouse or anti-rabbit IgG antibodies (1:4000 dilution) for 2 h at room temperature.
Finally, the membranes were exposed by a Molecular Imager ChemiDoc XRS System (BioRad, USA), and intensity of each chemiluminescent band was quantified using Image ProPlus 6.0 software (Media Cybernetics, USA).
RNA isolation and real-time PCR analysis
Approximately 100 mg of liver tissue was used to extract total RNA by TRIzol reagent according to the manufacturer’s protocol. Then, 1 μg of total RNA was reverse-transcribed with a PrimeScript™ RT Master Mix cDNA Synthesis Kit. Real-time polymerase chain reaction (PCR) was performed using a SYBR® Premix Ex Tap™ II Kit in iQ™ 5 Real-Time PCR Detection System (Bio-Rad, USA) under the conditions of heating at 95°C for 30 s, 50 cycles of denaturing at 95°C for 5 s, annealing at 55–60°C for 30 s and extension of annealing at 60°C for 15 s for 71 cycles. The β-actin was used as the internal reference, and the relative expression of mRNA was analyzed using the Pfaffl method. The primer sequences are listed in Table 1, and the relative mRNA expression of the target genes is expressed as a fold change compared with the control group.
Table 1.
Primer sequences and theoretical amplification length
| Genes | Orientation | Primer sequences (5′ to 3′) | Accession number |
|---|---|---|---|
| IL-12a | Forward | CTTCAGAGCCACAATCATCAGCA | NM_053390.1 |
| Reverse | CATGGAGCAGGATACAGAGCTTCA | ||
| Ebi3 | Forward | GGGTCACTAACTCGGATCCAAAGA | NM_001109421.1 |
| Reverse | CAGCCACAGGGTACCGAGAA | ||
| β-actin | Forward | GGAGATTACTGCCCTGGCTCCTA | NM_031144.2 |
| Reverse | GACTCATCGTACTCCTGCTTGCTG |
Statistical analysis
Data were presented as the mean ± standard deviation and analyzed with the one-way analysis of variance (ANOVA) when the equal variances were assumed, and then significant difference between two groups was judged according to the least significant difference test. Meanwhile, the data were analyzed using non-parametric test (Kruskal–Wallis H test) when the equal variances were not assumed using SPSS 21.0 software (Chicago, USA). A two-sided p-value of less than 0.05 was considered to be statistically significant.
Results
Cluster analysis and keywords analysis
A total of 147 researches met the screening criteria (Fig. 1A and B). All researches were analyzed by VOS viewer and divided into five clusters: “Health Effect-Related Study,” “Concentration-Related Study,” “Component-Related Study,” “Benzo(a)pyrene-Related Study” and “Inflammation-Related Study.” The cluster analysis showed that the main fields of PAHs include five research directions. As shown in Fig. 1A and B, VOS viewer applied colors to keywords. Item occurrence frequency was showed by different default colors ranging from blue (low frequency) to green (median frequency) to yellow (high frequency). Keywords with high occurrence frequency were captured and considered as the hotspots in this field. From the literature analysis, we found that Phe is in green area, which is a little reported keyword in researches of PAHs. Therefore, we confirmed that the current research fields of Phe and association between it and immune impairments were limited.
Figure 1.
Cluster analysis and hotspot analysis on PAHs and immune disease research. Five clusters: Health Effect-Related Study, Concentration-Related Study, Component-Related Study, Benzo(a)pyrene-Related Study and Inflammation-Related Study (A). Keywords with high frequency were captured and considered as hotspot in this field (B).
Effect of Phe on the protein and mRNA expressions of IL-35 in female rats
The protein and mRNA expressions of IL-12a and Ebi3 were identified to confirm the function of Treg cells (Fig. 2A–C). The results showed that the protein and mRNA expressions of IL-12a and Ebi3 decreased significantly in H group compared with C group (P < 0.05). These results displayed that Phe might induce immune impairments in liver by suppressing Treg cells secreted IL-35.
Figure 2.
Effect of Phe on the protein and mRNA expressions of IL-35: protein expression (A) and semi-quantitative analysis of IL-12a and Ebi3 (B) and the mRNA expression of IL-12a and Ebi3 (C) (n = 6). Control and treatments, statistically different, are marked by an asterisk (*P < 0.05).
Influence of Phe on IL-17 in female rats
In order to explore the effect of Phe on Th17 cells in the liver tissue, the concentration of IL-17 was detected (Fig. 3). The results showed that IL-17 concentration increased significantly in H group compared with L and C groups in liver (P < 0.05). This result implied that Phe also could lead to IL-17 increase thereby exacerbating immune impairments.
Figure 3.
Influence of Phe on IL-17: IL-17 concentration in liver (n = 6). Control and treatments, statistically different, are marked by an asterisk. L group and H group, statistically different, are marked by hash (*#P < 0.05).
Influence of Phe on IFN-γ and IL-1β in female rats
As the result shown in Fig. 4A and B, there were significantly elevated concentrations of IFN-γ and IL-1β in H group compared with C group (P < 0.05), indicating that Phe might induce immune impairments through changing the pro-inflammatory cytokines in female rats.
Figure 4.
Influence of Phe on IFN-γ and IL-1β: IFN-γ and IL-1β concentration in liver (A, B) (n = 6). Control and treatments, statistically different, are marked by an asterisk (*P < 0.05).
Discussion
PAHs have been considered as a crucial environmental risk for immune impairments. However, the responsible component of PAHs and the involved mechanism has not been well discussed. In the present study, the association between Phe exposure and potential molecular mechanism of immune impairment was further explored based on our previous study.
LD50 is a reasonable factor to determine the treatment dose, and the LD50 of rats administered by Phe is 1800 mg/kg [29]. Park et al. reported that Phe could be dissolved in corn oil and administered orally at doses equal to 10% and 50% of the LD50 (180 and 900 mg/kg, respectively) in rats, then the rats were sacrificed after 72h treatment [28]. In this study, Phe was administered orally with the doses equivalent to 10 and 50% of the LD50 at the first day (180 and 900 mg/kg, respectively) and with 5 and 25% of the LD50 by intraperitoneal injection at the last 2 days (90 and 450 mg/kg) based on the Park’s and Eivor Elovaara’s studies [29, 30] and our preliminary experiment. The treatment dose was lower than LD50 of Phe, which is successful to establish rat model.
Teng et al. found that plasma IL-35 level and circulating acute hepatitis B virus peptide-induced Th17 frequency were significantly elevated in acute hepatitis B patients, and IL-35 expression negatively correlated with liver inflammation [31]. Jiang et al. discovered that the serum level of IL-17 was upregulated and IL-35 was downregulated in stable chronic obstructive pulmonary disease compared with healthy controls [19]. While Su et al. found that IL-35 serum level decreased and IL-17 significantly elevated in 90 children with Kawasaki disease [32]. Whitehead et al. reported that IL-35 production by inducible costimulator positive Treg cells can suppress IL-17 production in mice [33]. Another study reported that IL-17 increased and IL-35 decreased in joint tissue of collagen-induced arthritis mouse model [34]. And, Zhang et al. found that the expression of Th17 cell and related cytokine IL-17 could increase, as well as decrease Treg prevalence and related cytokine IL-35 when rats exposed in smoke for 6 and 24 h [21]. The relationship between IL-17 and IL-35 and immune function has been confirmed. In the present study, decreased protein and mRNA expressions of IL-12a and Ebi3 and increased concentration of IL-17 were observed in the liver of female rats, proposing that Phe could induce Treg cells and Th17 cells secreting inflammatory cytokines to mediate immune impairment.
In addition, the imbalance between pro-inflammatory and anti-inflammatory immune responses plays a key role in immune impairment [35]. IFN-γ and IL-β take on potent anti-inflammatory effects. Hew et al. found that the protein expression of IFN-γ increased in asthma subjects with the cumulative PAHs exposure in Fresno [36]. A study reported that allergic rhinitis rats exhibited remarkably higher cytokine expression level of IFN-γ when exposed to airborne fine particulate matter compared with normal rats [37]. And Li et al. also discovered that PM 2.5 suspensions at different dosages were, respectively, given to rats by the intratracheal instillation, and the results showed that PM 2.5 exposure elevated the levels of pro-inflammatory mediator IL-1β in rat lung [22]. Tian et al. reported that PM 2.5 exposure resulted in an increase of the release of pro-inflammatory cytokines IL-1β with a dose-dependent manner when measured by ELISA in rat lung [38]. These results mentioned above showed that IFN-γ and IL-1β played some roles in the effect of atmosphere pollution on health. In this study, Phe exposure could induce IL-1β and IFN-γ increased, demonstrating that Phe could induce the immune damage by changing pro-inflammatory cytokines.
In our previous study, PAH exposure in household air pollution possibly induced immune impairments was found in rural women in northwest China [11]. Although previous filed sample study hinted that PAHs could induce immune impairment to female, the mechanism involved in this process could not be explored thoroughly due to the limitation of human study. However, animal experiment could make up for this limitation in some extent. And, in our previous animal experimental study, we found that Phe could lead to oxidative stress and inflammation in female rats by changing the cytokines related to inflammation and Treg cells, including TNF-α, IL-6, IL-10 and TGF-β [12]. In many studies, the relationship between IL-10 and TGF-β and IL-35 (related to Treg cells) and IL-17 (related to Th17 cells) was demonstrated. And, Treg cells and Th17 cells play an opposite role in inflammatory and immune responses, and the generation and balance of Th17 and Treg cells were influenced by many factors [39]. IL-6 detected by our previous study is a critical determinant to effect cell function, and it could drive Th17 cell differentiation by phosphorylating and activating STAT3 (signal transducers and activators of transcription 3), which then induces Th17-specific genes [40]. Meanwhile, STAT3 could inhibit Treg cell differentiation by downregulating TGF-β induced expression of Foxp3. And, the effect of IL-6 is bolstered by IL-1β and TNF-α [41]. Therefore, combining the results of our previous study and this study, we could found that IL-17 secreted by Th17 cells could be initiated by IL-6, and IL-35 secreted by Treg cells could be inhibited by TGF-β, which might be the underlying mechanism how Phe induced immune impairment. Of course, this study is a pilot mechanism exploration of PAHs on immune impairment using a female rat model and provides us the idea for follow-up research to further explore the accurate mechanism of PAHs.
Conclusion
The results of this study indicated that Phe could lead to immune impairment in liver of female rats changing the cytokines IL-35 related to Treg cells and IL-17 related to Th17 cells and pro-inflammatory cytokines. So, Phe might play a role in the relationship between impairments of immune functions and PAH exposure. Further molecular mechanisms involved in these processes need to be determined in the future.
Funding
This study was supported by the National Natural Science Foundation of China (81828011) and the Fundamental Research Funds for the Central Universities of China (lzujbky-2018-it32).
Conflict of interest statement
The authors declare that there is no conflict of interest.
Reference
- 1. Shen H, Huang Y, Wang R et al. Global atmospheric emissions of polycyclic aromatic hydrocarbons from 1960 to 2008 and future predictions. Environ Sci Technol 2013;47:6415–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Wang C, Meng Z, Yao P et al. Sources-specific carcinogenicity and mutagenicity of PM2.5-bound PAHs in Beijing, China: variations of contributions under diverse anthropogenic activities. Ecotoxicol Environ Saf 2019;183:109552. [DOI] [PubMed] [Google Scholar]
- 3. Falcon-Rodriguez CI, Osornio-Vargas AR, Sada-Ovalle I et al. Aeroparticles, composition, and lung diseases. Front Immunol 2016;7:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Abbas I, Badran G, Verdin A et al. Polycyclic aromatic hydrocarbon derivatives in airborne particulate matter: sources, analysis and toxicity. Environmental Chemistry Letters 2018;16:439–75. [Google Scholar]
- 5. Zhang L, Xu H, Fang B et al. Source identification and health risk assessment of polycyclic aromatic hydrocarbon-enriched PM2.5 in Tangshan, China. Environ Toxicol Chem 2020;39:458–67. [DOI] [PubMed] [Google Scholar]
- 6. Ji X, Abakumov E, Polyako V et al. The ecological impact of mineral exploitation in the Russian Arctic: a field-scale study of polycyclic aromatic hydrocarbons (PAHs) in permafrost-affected soils and lichens of the Yamal-Nenets autonomous region. Environ Pollut 2019;255:113239. [DOI] [PubMed] [Google Scholar]
- 7. Kim KH, Jahan SA, Kabir E et al. A review of airborne polycyclic aromatic hydrocarbons (PAHs) and their human health effects. Environ Int 2013;60:71–80. [DOI] [PubMed] [Google Scholar]
- 8. Bostrom CE, Gerde P, Hanberg A et al. Cancer risk assessment, indicators, and guidelines for polycyclic aromatic hydrocarbons in the ambient air. Environ Health Perspect 2002;110:451–88. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Blaszczyk E, Rogula-Kozlowska W, Klejnowski K et al. Polycyclic aromatic hydrocarbons bound to outdoor and indoor airborne particles (PM2.5) and their mutagenicity and carcinogenicity in Silesian kindergartens, Poland. Air Qual Atmos Health 2017;10:389–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Ewa B, Danuta MS. Polycyclic aromatic hydrocarbons and PAH-related DNA adducts. J Appl Genet 2017;58:321–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Yao Y, Wang D, Ma H et al. The impact on T-regulatory cell related immune responses in rural women exposed to polycyclic aromatic hydrocarbons (PAHs) in household air pollution in Gansu, China: A pilot investigation. Environ Res 2019;173:306–17. [DOI] [PubMed] [Google Scholar]
- 12. Ma H, Wang H, Zhang H et al. Effects of phenanthrene on oxidative stress and inflammation in lung and liver of female rats. Environ Toxicol 2020;35:37–46. [DOI] [PubMed] [Google Scholar]
- 13. Huang L, Xi Z, Wang C et al. Phenanthrene exposure induces cardiac hypertrophy via reducing miR-133a expression by DNA methylation. Sci Rep 2017;6:20105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Gou P, Chang X, Ye Z et al. A pilot study comparing T-regulatory cell function among healthy children in different areas of Gansu, China. Environ Sci Pollut Res Int 2017;24:22579–86. [DOI] [PubMed] [Google Scholar]
- 15. Guo Y, Cao W, Zhu Y. Immunoregulatory functions of the IL-12 family of cytokines in antiviral systems. Viruses 2019;11:772. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Teymouri M, Pirro M, Fallarino F et al. IL-35, a hallmark of immune-regulation in cancer progression, chronic infections and inflammatory diseases. Int J Cancer 2018;143:2105–15. [DOI] [PubMed] [Google Scholar]
- 17. Pan X, Xu K, Li Y et al. Interleukin-35 expression protects against cigarette smoke-induced lung inflammation in mice. Biomed Pharmacother 2019;110:727–32. [DOI] [PubMed] [Google Scholar]
- 18. Niedbala W, Wei XQ, Cai B et al. IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 2007;37:3021–9. [DOI] [PubMed] [Google Scholar]
- 19. Jiang S, Shan F, Zhang Y et al. Increased serum IL-17 and decreased serum IL-10 and IL-35 levels correlate with the progression of COPD. Int J Chron Obstruct Pulmon Dis 2018;13:2483–94. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Chang SH, Dong C. A novel heterodimeric cytokine consisting of IL-17 and IL-17F regulates inflammatory responses. Cell Res 2007;17:435–40. [DOI] [PubMed] [Google Scholar]
- 21. Zhang F, Li M-Y, Lan Y-T et al. Imbalance of Th17/Tregs in rats with smoke inhalation-induced acute lung injury. Sci Rep 2016;6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Li R, Kou X, Xie L et al. Effects of ambient PM2.5 on pathological injury, inflammation, oxidative stress, metabolic enzyme activity, and expression of c-fos and c-Jun in lungs of rats. Environ Sci Pollut Res Int 2015;22:20167–76. [DOI] [PubMed] [Google Scholar]
- 23. Noack M, Miossec P. Th17 and regulatory T cell balance in autoimmune and inflammatory diseases. Autoimmun Rev 2014;13:668–77. [DOI] [PubMed] [Google Scholar]
- 24. Tang J, Lei L, Pan J et al. Higher levels of serum interleukin-35 are associated with the severity of pulmonary fibrosis and Th2 responses in patients with systemic sclerosis. Rheumatol Int 2018;38:1511–9. [DOI] [PubMed] [Google Scholar]
- 25. Kak G, Raza M, Tiwari BK. Interferon-gamma (IFN-gamma): exploring its implications in infectious diseases. Biomol Concepts 2018;9:64–79. [DOI] [PubMed] [Google Scholar]
- 26. Zhao R, Zhou H, Zhang J et al. Interleukin-1beta promotes the induction of retinal autoimmune disease. Int Immunopharmacol 2014;22:285–92. [DOI] [PubMed] [Google Scholar]
- 27. Gerondakis S, Fulford TS, Messina NL et al. NF-kappaB control of T cell development. Nat Immunol 2014;15:15–25. [DOI] [PubMed] [Google Scholar]
- 28. Oh H, Ghosh S. NF-kappaB: roles and regulation in different CD4(+) T-cell subsets. Immunol Rev 2013;252:41–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Park S-K, Ryu AR, Lee M-Y. Protein expression profiling in the liver of rats exposed to phenanthrene. Molecular & Cellular Toxicology 2013;9:267–75. [Google Scholar]
- 30. Elovaara E, Mikkola J, Stockmann-Juvala H et al. Polycyclic aromatic hydrocarbon (PAH) metabolizing enzyme activities in human lung, and their inducibility by exposure to naphthalene, phenanthrene, pyrene, chrysene, and benzo(a)pyrene as shown in the rat lung and liver. Arch Toxicol 2007;81:169–82. [DOI] [PubMed] [Google Scholar]
- 31. Teng D-K, Liu Y, Lv Y-F et al. Elevated interleukin-35 suppresses liver inflammation by regulation of T helper 17 cells in acute hepatitis B virus infection. Int Immunopharmacol 2019;70:252–9. [DOI] [PubMed] [Google Scholar]
- 32. Su Y, Feng SQ, Luo L et al. Association between IL-35 and coronary arterial lesions in children with Kawasaki disease (vol 19, pg 87, 2019). Clin Exp Med 2019;19:269–9. [DOI] [PubMed] [Google Scholar]
- 33. Whitehead GS, Wilson RH, Nakano K et al. IL-35 production by inducible costimulator (ICOS)-positive regulatory T cells reverses established IL-17-dependent allergic airways disease. J Allergy Clin Immunol 2012;129:207–15 e1–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wang X, Zhong W. Isorhamnetin attenuates collagen-induced arthritis via modulating cytokines and oxidative stress in mice. Int J Clin Exp Med 2015;8:16536–42. [PMC free article] [PubMed] [Google Scholar]
- 35. Boshtam M, Asgary S, Kouhpayeh S et al. Aptamers against pro- and anti-inflammatory cytokines: a review. Inflammation 2017;40:340–9. [DOI] [PubMed] [Google Scholar]
- 36. Hew KM, Walker AI, Kohli A et al. Childhood exposure to ambient polycyclic aromatic hydrocarbons is linked to epigenetic modifications and impaired systemic immunity in T cells. Clin Exp Allergy 2015;45:238–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Wang YL, Gao W, Li Y et al. Concentration-dependent effects of PM2.5 mass on expressions of adhesion molecules and inflammatory cytokines in nasal mucosa of rats with allergic rhinitis. Eur Arch Otorhinolaryngol 2017;274:3221–9. [DOI] [PubMed] [Google Scholar]
- 38. Tian CY, Yan M, Zhang Y et al. Effect of particulate matter 2.5 at urban Centre of Hangzhou on lung impairment in rats. Zhongguo Ying Yong Sheng Li Xue Za Zhi 2018;34:299–303 317. [DOI] [PubMed] [Google Scholar]
- 39. Lee GR. The balance of Th17 versus Treg cells in autoimmunity. Int J Mol Sci 2018;19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Yang XO, Panopoulos AD, Nurieva R et al. STAT3 regulates cytokine-mediated generation of inflammatory helper T cells. J Biol Chem 2007;282:9358–63. [DOI] [PubMed] [Google Scholar]
- 41. Durant L, Watford WT, Ramos HL et al. Diverse targets of the transcription factor STAT3 contribute to T cell pathogenicity and homeostasis. Immunity 2010;32:605–15. [DOI] [PMC free article] [PubMed] [Google Scholar]