Abstract
The yeast Komagataella phaffii is widely used as a microbial host for heterologous protein production. However, molecular tools for this yeast are basically restricted to a few integrative and replicative plasmids. Four sequences that have recently been proposed as the K. phaffii centromeres could be used to develop a new class of mitotically stable vectors. In this work, we designed a color-based genetic assay to investigate plasmid stability in K. phaffii and constructed vectors bearing K. phaffii centromeres and the ADE3 marker. These genetic tools were evaluated in terms of mitotic stability by transforming an ade2/ade3 auxotrophic strain and regarding plasmid copy number by quantitative PCR (qPCR). Our results confirmed that the centromeric plasmids were maintained at low copy numbers as a result of typical chromosome-like segregation during cell division. These features, combined with in vivo assembly possibilities, prompt these plasmids as a new addition to the K. phaffii genetic toolbox.
Introduction
Komagataella phaffii is a methylotrophic yeast of great industrial importance that has been used for more than 30 years as a heterologous protein production platform [1]. Its genome was firstly published in 2009 and has since then been refined and thoroughly studied [2, 3]. As a result, in addition to a protein factory, K. phaffii has also been widely considered as a platform for the production of chemicals, biopharmaceuticals, vitamins, and other molecules. However, the construction and regulation of new pathways demand complex molecular biology tools that are not yet readily available for this yeast [4].
K. phaffii genetic manipulation traditionally involves the use of shuttle vectors assembled in Escherichia coli and subsequently integrated in the yeast genome [5]. Recent studies have described the development of a wide range of genetic parts for use in this yeast, as well as new methods of plasmid assembly and transformation [6]. An alternative to integrative strategies is the use of replicative plasmids, which are usually based on the well-known autonomously replicating sequence 1 (ARS1) [1]. These plasmids may overcome some drawbacks such as the genetic instability in multi-copy strains, non-specific genomic integration, and different expression levels depending on the integration locus [7–9]. In addition, they present higher transformation efficiency when compared to integrative vectors and can be assembled by in vivo recombination, which eliminates the need for bacterial transformation [10, 11]. However, replicative plasmids show low mitotic stability when compared to integrative vectors and there are few vector options of this kind [12]. Stability problems can be circumvented by the construction of centromeric plasmids, which may provide proper segregation during mitosis. A greater mitotic stability, as well as low copy numbers, would allow stable and constant protein expression [13]. Considering that centromeric vectors can be assembled in vivo, allowing the cloning of large sequences (including whole metabolic pathways and regulatory regions) [14], the construction of such vectors would be of great value for K. phaffii strain development in the context of synthetic biology.
In most organisms, centromeres are typically surrounded by large heterochromatin sections [15]. Their structure ranges from simple “point” centromeres of only ~125 bp in Saccharomyces cerevisiae to epigenetic, sequence-independent centromeres such as those present in plants and animals. The reason for this phenomenon is that, for most eukaryotes, centromeres are maintained epigenetically and not genetically. Sequence homologies are rare in and between species, hindering the definition of a consensus sequence. In addition, some DNA regions can be centromeric or not depending on its function in previous cell cycles, which highlights the epigenetic nature of the centromere [16].
As for non-conventional yeasts, there are wide variations in centromere size and structure. Candida glabrata has centromeres that show some homology to the CDEI and CDEIII regions of S. cerevisiae while Kuraishia capsulata centromeres have 200-bp conserved sequences [17,18]. On the other hand, Candida tropicalis, Schizosaccharomyces pombe, and Candida albicans have regional centromeres named after their sizes, which range from 3 to 110 kb [19–21].
K. phaffii centromeres have recently been identified, bearing no sequence similarities to those of any other yeast [3]. Since centromere function relies strongly on its structure rather than on its sequence, a centromere-specific histone H3 variant (Cse4) was used in the search for centromeric regions in K. phaffii. A Cse4 homolog was identified in chromosome 2 and tagged with a fluorescence marker. The corresponding nuclear localization of the histone-DNA complex indicated a centromere pattern typical of budding yeasts [3]. Tridimensional conformation analysis followed the centromere clustering pattern observed in yeasts and narrowed down all four K. phaffii centromere locations to 20-kb windows [22].
Considering that a low transcription rate is typical of centromeric regions, RNA-seq analyses allowed researchers to pinpoint the putative centromeric locations for all four K. phaffii centromeres [3]. As is the case in C. tropicalis and S. pombe, K. phaffii centromeres are formed by inverted repeats. All four sequences have two inverted repeats of ~2.5 kb separated by a central segment of 800 to 1300 bp. Analyses of chromatin immunoprecipitation showed that the Cse4 histone bound preferably to the central region of the centromeres, but also along the inverted repeats [23].
K. phaffii centromeric sequences contain early replication peaks with autonomously replicating sequences, which is also observed in centromeres of other yeasts [24, 25]. According to recently published studies, there are native ARSs contained within centromeres 2 and 4. These comprise regions within the inverted repeats, as well as unique adjacent sequences [12, 23, 26].
In order to expand the molecular toolbox used in K. phaffii genetic manipulation, in this study we developed a genetic system based on an ade2/ade3 auxotrophic strain and a replicative vector carrying the wild-type ADE3 gene. Vectors carrying K. phaffii centromeres were then constructed and transformed to assess plasmid copy number and mitotic stability.
Materials and methods
Strains and media
DNA cloning was performed using chemically competent Escherichia coli XL-10 Gold (Agilent Technologies) grown in Luria-Bertani (LB) medium (5 g L-1 yeast extract, 10 g L-1 peptone and 10 g L-1 NaCl, pH 7.2). When needed, agar was added to a final concentration of 1.5%. When zeocin (25 μg mL-1) was used for bacterial antibiotic selection, the NaCl concentration was reduced to 5 g L-1.
K. phaffii strains were derived from X-33 (Invitrogen). The LA2 strain (amd2 ade2) was described in previous work [27]. Yeast was routinely grown in YPD medium (10 g L-1 yeast extract, 20 g L-1 peptone and 20 g L-1 glucose). Solid medium used 2% agar. Zeocin and geneticin, when used, were added at 100 μg mL-1 and 500 μg mL-1, respectively. Hygromycin B was used to a final concentration of 50 μg mL-1. MD medium used 0.34% Yeast Nitrogen Base, 1% (NH4)2SO4, 2% glucose, 0.00004% biotin, and 0.0002% adenine or 0.004% histidine, when needed.
PCR
DNA was amplified using Invitrogen Platinum Taq DNA Polymerase (High Fidelity), Promega GoTaq Colorless Master Mix, or Sigma-Aldrich Accutaq LA DNA Polymerase. All primers used in this work are shown in Table 1.
Table 1. Primers used in this work.
Primer | Sequence | Enzyme |
---|---|---|
ADE3up-F | GATAAGCTTGATATCGAATTCCTGCAGCCCCCCGGGACGTAATGGAATAACTGCTGAC | SmaI |
ADE3up-R | GAAGTTATGGATCCTACGAGGTAATTGAAGGCTCAC | |
ADE3lox-F | CTTCAATTACCTCGTAGGATCCATAACTTCGTATAATG | |
ADE3lox-R | CAATCTCTCCCTTGTCATCGGATCCATAACTTCGTATAG | |
ADE3dw-F | GAAGTTATGGATCCGATGACAAGGGAGAGATTGAAG | |
ADE3dw-R | GGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCCCCGGGTGCAATGTACTGTTGAGTAGG | SmaI |
ADE3conF | GGGGACCGGAGGTAAAAGAC | |
ADE3conR | GTTGGAATAATTGCATGGTCTG | |
MUT1(Hpa) | CCATTGACATGGTAAACAGTTGGA | |
MUT2(Bam) | GAACACTGGGATCTTGGTTGAGG | |
Cen1-F | GAGTTTAAACGGATCCACGAAGCAATGGATAGGCACT | BamHI |
Cen1-R | CCGCGAATTCGGATCCTGAAGTCTTTCAGAGAGGAGCA | BamHI |
Cen1c-F | CAAGTATGCGTGATCCCAGGT | |
Cen1c-R | TACGAATTGTGGGGCTCTGT | |
Cen2-F | GAGTTTAAACGGATCCATCTCCGTTGATACTCCCAAC | BamHI |
Cen2-R | CCGCGAATTCGGATCCATCGACAAGCAGAACACTAAG | BamHI |
Cen2c-F | GAATGGAGGTGCTGGTGGTTA | |
Cen2c-R | TGTAATGCTCGCTGGTGAGT | |
Cen3-F | GAGTTTAAACGGATCCAAGTGGTACACCAGTCAGCG | BamHI |
Cen3-R | CCGCGAATTCGGATCCTCAGTATTCAACTGCAACTGC | BamHI |
Cen3c-F | TCAGCCGAATACCCACACTT | |
Cen3c-R | TCAGCCGTCAGCGAAATGAT | |
Cen4-F | GAGTTTAAACGGATCCCAAACGCACCGTCTTGTTCA | BamHI |
Cen4-R | CCGCGAATTCGGATCCAATTGATGTAGACGAGCAGC | BamHI |
Cen4c-F | TCAAGAATCGTACTGGCACCT | |
Cen4c-R | CAAGCTCGTGAGATGGGATGT | |
Cen370-F | CGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTGGTCATGAGATCAGATCTAACATCCAAAGACGAAAGGTTGAATGAGTTTAAACGGATCCAAGTGG | |
Cen370-R | GCTGGCCCTCTCTTCCCAGCTCACGAATCAGATCCTAAGTCCTACTCAACAGTACATTGCAGCGGCCGCGTTTAAACGAATTCGGATCCTCAGTATTCAA | |
qZEO-F | CGACGTGACCCTGTTCATCA | |
qZEO-R | TGGACACGACCTCCGACCA | |
qHIS-F | GTGTATCCTGGCTTGGCATCT | |
qHIS-R | GCCAAGTACGGTGTGACGTT |
Restriction sites are underlined.
DNA manipulation
All basic DNA manipulation and analyses were performed as previously described [28]. Restriction digestion was performed in accordance to the manufacturer instructions (New England Biolabs), as well as vector dephosphorylation with Shrimp Alkaline Phosphatase (Promega), and ligation with T4 DNA Ligase (USB). The In-Fusion Cloning Kit (Clontech) was used for in vitro assembly of plasmids. Site-directed mutagenesis was performed using the Transformer Site-Directed Mutagenesis Kit (Clontech). PCR and gel purification used the Promega Wizard SV Gel and PCR Clean-Up System.
qPCR
Three colonies harboring each of the zeocin resistance plasmids were grown to an OD600 (optical density measured at 600 nm) of 1 in 10 mL of YPD containing zeocin while LA3 was grown in 10 mL of YPD. Cells were collected by centrifugation at 2000 × g for 5 min. The cell pellet was resuspended with 1 mL 0.25% sodium dodecyl sulfate (SDS) and incubated at 98°C for 8 min according to previous work [26]. Finally, cellular debris was removed by centrifugation and the DNA was diluted 10-fold in nuclease-free water before the qPCR reactions.
qPCR reactions used primers qZEO-F and qZEO-R for plasmid quantification and qHIS-F and qHIS-R as an internal single-copy control. The assays used iTaq Universal SYBR Green Supermix (Bio-Rad) in a Rotor-Gene Q (Qiagen) thermal cycler in technical triplicates. The analysis used the absolute quantification method and standard curves that ranged from 1x103 to 1x107 copies of the gene of interest. pPIC9 (Invitrogen) and pPICH linearized plasmids were used for the construction of standard curves.
Yeast transformation
K. phaffii was electroporated following two different protocols. For integrative cassettes, we followed the Pichia Expression Kit protocol (Invitrogen), and when using replicative plasmids, we proceeded as described previously [29].
Construction of an ade2 ade3 strain for color-based stability assays
Strain LA2 [27] was transformed with an ADE3 deletion cassette and had the marker recycled before transformation with the centromeric plasmids. The construction of this deletion cassette used PCR reactions assembled by an In-Fusion cloning reaction. Briefly, primers ADE3up-F and R, ADE3dw-F and R were used for PCR amplification of 491 bp and 582 bp, respectively, of the K. phaffii genome. These sequences were used for directing the homologous recombination and substitution of the complete ADE3 coding sequence. Meanwhile, primers ADE3lox-F and ADE3lox-R were used in the amplification of the kanR geneticin resistance cassette from plasmid pGKL [30]. All three PCR fragments were assembled and cloned into pBluescript II SK+ linearized with SmaI. A final PCR reaction using primers ADE3up-F and ADE3dw-R amplified the whole deletion cassette, which was used in the transformation of K. phaffii LA2. Clones were selected on YPD containing geneticin.
The resulting ade2 ade3Δ::kanR strain was later transformed with pYRCre2 [31] and clones were selected on YPD supplied with hygromycin B. This step promoted a Cre-mediated excision of the kanR cassette, eliminating geneticin resistance. After PCR confirmation of marker recycling using primers ADE3conF and ADE3conR, the resulting strain was plated on non-selective YPD medium and lost the pYRCre2 plasmid. The final strain was named LA3. Table 2 summarizes the strains used and constructed in this work.
Table 2. K. phaffii strains used in this work.
K. phaffii Strain | Genotype | Reference |
---|---|---|
X-33 | Wild-type | Invitrogen |
LA2 | amd2 ade2 | 30 |
LA2Δade3 | amd2 ade2 ade3Δ::kanR | This work |
LA3 | amd2 ade2 ade3 | This work |
Construction of centromeric plasmids containing ADE3
Plasmid pPICH [27], derived from pPICHOLI (MoBiTec), contains the K. phaffii ARS1 replicating sequence [1]. This sequence is originally located on K. phaffii GS115 chromosome 2, coordinates 413701–413856 [2]. pPICH was digested with NotI for cloning of the K. phaffii native ADE3 gene. The complete gene was amplified from K. phaffii X-33 DNA using primers ADE3up-F and ADE3dw-R. This PCR reaction amplified 4141 bp from K. phaffii chromosome 4, coordinates 477160–481331, containing coding sequences for the Ade3 domains (formate-tetrahydrofolate ligase, methylene-tetrahydrofolate dehydrogenase, and methenyl tetrahydrofolate cyclohydrolase) and at least 500 bp of adjacent sequences that contained the native promoter and terminator elements [2]. This amplicon was then submitted to restriction digestion with NotI. After vector dephosphorylation, fragments were ligated and transformed into E. coli XL-10 Gold. One positive clone was then submitted to site-directed mutagenesis using primers Mut1(Hpa) and Mut2(Bam) for removing the BamHI restriction site present within the ADE3 coding sequence. The final plasmid containing ARS1, the Sh ble resistance marker, and ADE3 was named pPICH-ADE3. The maps for pPICH-ADE3 and all centromeric plasmids constructed in this work are present on S1 Fig.
pPICH-ADE3 was digested with BamHI for the cloning of all four K. phaffii centromeres. Since the amplification of entire centromeric regions revealed to be extremely difficult, we designed a strategy to amplify centromeres in halves in order to reduce fragment size and avoid primer annealing inside the inverted repeats (Fig 1). The amplified fragments exhibited overlapping regions in their ends that would allow recombination between each other and with vector pPICH-ADE3.
Centromeric primer sequences were designed using K. phaffii GS115 genome sequence as reference [2]. The amplified regions corresponded to the following chromosomal coordinates: chromosome 1 position 1401429–1406917 (5488 bp), chromosome 2 position 1543739–1550657 (6918 bp), chromosome 3 position 2204800–2211493 (6693 bp), and chromosome 4 position 1703369–1709958 (6589 bp). Primers Cen1/2/3/4-F and Cen1/2/3/4c-R amplified the first inverted repeat of each centromere while primers Cen1/2/3/4c-F and Cen1/2/3/4-R amplified the other half of the sequences. In order to promote in vitro/in vivo assembly, the amplicons had ~80 bp homology between each other on one end and 15 bp with pPICH-ADE3 on the other end.
First, we attempted an In-Fusion cloning reaction for each of the four centromeres using the linearized pPICH-ADE3 and two PCR fragments. Plasmids were extracted from E. coli colonies and analyzed by restriction digestion. Centromeres 1, 2, and 4 were successfully assembled and cloned using this strategy. Centromere 3 did not yield any E. coli clones following the In-Fusion reaction; we then proceeded to an in vivo assembly strategy. Primers Cen370-F and Cen3c-R; Cen3c-F and Cen370-R amplified both inverted repeats adding 70 bp of homologous sequences between the fragments and pPICH-ADE3. Finally, we transformed K. phaffii LA3 using the linearized vector and both centromeric fragments, using 85 bp of homology for directing recombination. Clones were selected on YPD supplied with zeocin. However, none of the obtained clones presented the assembled plasmid as it was expected and this centromeric sequence was not used in further analyses.
The resulting plasmids were named pPICH-CEN1, pPICH-CEN2, and pPICH-CEN4 and their maps are available in S1B Fig. All plasmids were transformed into K. phaffii LA3 for subsequent stability and quantification assays.
Stability analysis
Three colonies of the LA3 strain transformed with each of the three centromeric plasmids or pPICH-ADE3 were grown in 20 mL of YPD for 16 hours at 28°C and 200 rpm. These cultures were then inoculated in 20 mL of YPD to an initial OD600 of 0.1. After 24 h of growth under the same conditions, the cultures were inoculated in new flasks containing 20 mL of fresh YPD to an OD of 0.1. This procedure was repeated every 24 h until reaching 144 h of growth. At 96 and 144 h of growth, cells were diluted 104-fold and 100 μL of this dilution were plated on YPD. Plates were incubated at 30°C for 72 h. After incubation, the numbers of red and white colonies obtained in each plate were registered and the results were analyzed with an unpaired t-test with Welch’s correction.
Results and discussion
Construction of K. phaffi LA3, an ade2 ade3 double auxotrophic strain
In yeast, the adenine synthesis pathway is used as a tool for auxotrophic selection, gene copy number indication, and for plasmid stability analyses [32]. Many genes from this pathway have been deleted in S. cerevisiae in order to create auxotrophic strains, while in K. phaffii studies have only focused on ADE1 and ADE2 [33, 34]. K. phaffii LA2, a mutant ade2 strain [27], was used as a starting point for the construction of a strain that would allow plasmid stability verification. The deletion of the ADE2 gene results in cells that are auxotrophic for adenine and accumulate a red intermediate [32]; the additional deletion of genes located upstream in the adenine synthesis pathway, such as ADE1 or ADE3, should prevent the formation of such pigment [33].
As expected, the ADE3 deletion performed in the LA2 strain resulted in white colonies (Fig 2). In S. cerevisiae, this gene knock-out has regulatory effects in the histidine synthesis pathway [35]. Consequently, ade2 ade3 strains are not only auxotrophic for adenine, but also for histidine. In order to verify if this phenotype was also true for K. phaffii, we plated strains X-33, LA2 (amd2 ade2), and LA3 (amd2 ade2 ade3) on minimal dextrose (MD) medium. This was performed using MD medium without supplementation, MD medium with adenine, or MD medium with both adenine and histidine supplementation. The growth and colony color of each strain were compared on the different medium compositions (Fig 2) and the LA3 strain displayed the expected histidine auxotrophy phenotype, showing that the adenine-histidine pathways in K. phaffii and S. cerevisiae have common characteristics.
Plasmid stability
In order to assess plasmid stability, we first constructed plasmid pPICH-ADE3, carrying the wild-type ADE3 gene (S1A Fig). When transformed with pPICH-ADE3, LA3 colonies (originally white) should become red and any changes in colony color would allow a simple screening of plasmid loss [32]. Although adenine auxotrophy has been explored for other purposes [34], this particular color-based system has not yet been used for measuring plasmid stability in K. phaffii.
pPICH-ADE3 was then used for cloning K. phaffii centromeres in its unique BamHI site. Despite several attempts, we were unable to clone the centromere present in chromosome 3, which was excluded from our analysis. We speculate that its repetitive motifs, which were unlike those present in the other K. phaffii centromeres, rendered it extremely unstable in E. coli. Therefore, we proceeded with our analyses using centromeric plasmids that contained centromeres 1, 2, and 4 (pPICH-CEN1, pPICH-CEN2, and pPICH-CEN4).
Centromeric sequences are known as early replication regions and recently published studies have proposed that there are native ARS cores contained within K. phaffii centromeres 2 and 4 [12, 23]. These ARSs were identified by sequencing methods, and Fig 3 illustrates their positions within and around the centromeres. A 111-bp fragment present in the beginning of centromere 2 has also been tested in vivo for its replicative activity. This sequence, when cloned in an ARS-less plasmid, was able to ensure plasmid replication and provided small colonies in K. phaffii transformation [26].
In chromosome 2, the proposed ARS core sequences are located on coordinates 1543374–1543971 (597 bp) and 1550304–1550751 (447 bp). These were partially amplified in this work, containing 232 and 354 bp, respectively. Chromosome 4 has an ARS core on coordinates 1703466–1704103 (637 bp), which was fully amplified, as well as a partially amplified one (840 bp) on coordinates 1709118–1710114 (996 bp total). All these ARS sequences were classified by Liachko and colleagues as AT-ARS, meaning that they do not contain the proposed GC-rich GC-ACS motif and thus resemble those of other budding yeasts like S. cerevisiae [12].
The LA3 strain was individually transformed with pPICH-ADE3 and centromeric plasmids pPICH-CEN1, 2, and 4. One clone of each construction was verified for autonomous replication by plasmid rescue in E. coli, and restriction digestion with NotI confirmed vector integrity (S2 Fig). The transformation efficiency obtained with plasmid pPICH-ADE3 was higher than those obtained with the centromeric plasmids (S1 Table).
Plasmid stability was firstly verified by colony color in non-selective medium (Fig 4A). When plated on yeast extract-peptone-dextrose (YPD) medium, colonies transformed with pPICH-ADE3 lost their red color rapidly and presented a white coloration; this result was consistent with plasmid instability. In contrast, strains transformed with the centromeric plasmids presented uniform pink colonies.
Further examination of the stability of centromeric plasmids was performed by growing cells in liquid YPD medium for 144 h. These cultures were diluted and plated on non-selective medium, and finally the red and white colonies obtained in each plate were counted and compared between each construction (Fig 4B and 4C). LA3 strain transformed with pPICH-ADE3 did not yield red colonies in any growth period, indicating that the plasmid was mitotically unstable. Conversely, all centromeric plasmids mostly presented red colonies, indicating a higher mitotic stability in comparison to pPICH-ADE3.
Yeast centromeric plasmids knowingly have a higher mitotic stability under non-selective conditions in comparison to common replicative vectors. This happens because they are equally segregated between daughter cells and therefore provide a uniform culture of cells containing the plasmid [32]. A centromeric vector containing K. phaffii CEN2 has been constructed and presented an enhanced stability when compared to a replicative plasmid [26]. In addition to K. phaffii and S. cerevisiae, centromeric plasmids have been developed for other yeasts such as S. pombe, C. glabrata, and Scheffersomyces stipitis, and in all cases presented enhanced stability under non-selective conditions [13, 18].
A striking difference between pPICH-CEN1 and the other centromeric plasmids is the absence of an ARS core within the centromeric region of the former. In addition, it has been shown that K. phaffii ARS elements may have different effects on plasmid stability [12]. Considering that our analyses evidenced a comparable mitotic stability among all centromeric plasmids, including those containing ARSs within the cloned centromeres, the role, if any, of these ARS cores in K. phaffii plasmid stability remains unclear. Future studies should focus on further characterizing the centromeric plasmids, especially pPICH-CEN1, along with different ARSs, in order to analyze the effects on plasmid stability.
Plasmid copy number
Yeast replicative plasmids are normally replicated but are unevenly distributed between daughter cells, which creates cells with either multiple copies of the plasmid or none at all [32]. Under selective conditions, cells lacking the plasmid are unable to survive and the result is a population of multi-copy plasmid-containing cells. The construction of centromeric plasmids should provide better plasmid segregation and stability, allowing cells to maintain a low and stable plasmid copy number during yeast growth [36]. In this study, plasmid copy number was assessed by qPCR after three colonies of LA3 transformed with each centromeric plasmid were grown in YPD medium containing zeocin. The results were compared to those of the LA3 strain transformed with pPICH-ADE3 and grown in selective medium. The LA3 strain was used as control and grown in YPD medium.
qPCR results (Fig 4D) indicate that the strain transformed with centromeric plasmids carried less than one copy per cell, while the replicative plasmid was present at approximately 30 copies per cell. The difference in plasmid copy number between the replicative vector and each of the centromeric vectors was significant according to an unpaired t-test with Welch’s correction (p<0.005). This result illustrates the expected segregation pattern described above for growth in selective conditions and, together with the mitotic stability analysis, provides a clear picture of K. phaffii genetic manipulation using centromeric plasmids.
S. cerevisiae centromeric plasmids, in comparison to plasmids bearing the 2 micron sequence, presented the same difference in copy numbers when using auxotrophic markers. However, when the kanMX G418 resistance marker was used, the plasmid copy numbers did not differ between centromeric and replicative plasmids [37]. This indicates that factors other than the type of replication origin can influence plasmid copy numbers. In a previous study, K. phaffii transformed with a plasmid containing centromere 2 was analyzed regarding plasmid copy number and compared to both a replicative plasmid and an integrative strategy [26]. Results exhibited a low number of plasmids per cell in all strategies, which does not correspond to our observation. This difference may be related to the different strains, culture conditions, or plasmid constructions used in the two studies. Although both plasmids used the ARS1 replicative sequence and the zeocin resistance marker, pPICH-CEN1, 2, and 4 contained the ADE3 gene while the previously reported centromeric plasmid carried an EGFP reporter gene.
Altogether, our results indicate that centromeric plasmids could be employed as a new tool for the genetic manipulation of K. phaffii. These plasmids were maintained for long periods in non-selective medium, indicating that yeast growth could be performed without any form of selective pressure. The low copy numbers exhibited by the centromeric plasmids characterize a stable and homogeneous culture that could provide reliable expression results. Finally, their structure as a circular molecule allows in vivo plasmid assembly with relatively short homologous sequences when compared to genome integration, where sequences have to be much longer for directing homologous recombination. A simpler assembly may enable the construction of larger and more sophisticated vectors such as yeast artificial chromosomes (YACs), whose stability features may also be analyzed by the color-based assay described in this work.
Supporting information
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
LCP received a fellowship from CNPq (Brazil).
References
- 1.Cregg J. M., Barringer K. J., Hessler a Y., Madden K. R. Pichia pastoris as a host system for transformations. Mol. Cell. Biol. 1985; 5(12): 3376–85. 10.1128/mcb.5.12.3376 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.De Schutter K., Lin Y.-C., Tiels P., Van Hecke A., Glinka S., Weber-Lehmann J., et al. Genome sequence of the recombinant protein production host Pichia pastoris. Nat. Biotechnol. 2009;27(6): 561–566. 10.1038/nbt.1544 [DOI] [PubMed] [Google Scholar]
- 3.Sturmberger L., Chappell T., Geier M., Krainer F., Day K. J., Vide U., et al. Refined Pichia pastoris reference genome sequence. J. Biotechnol. 2016; 235: 121–131. 10.1016/j.jbiotec.2016.04.023 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Schwarzhans J. P., Luttermann T., Geier M., Kalinowski J., Friehs K. Towards systems metabolic engineering in Pichia pastoris. Biotechnol. Adv. 2017;35(6): 681–710. 10.1016/j.biotechadv.2017.07.009 [DOI] [PubMed] [Google Scholar]
- 5.Cereghino J. L., Cregg J. M. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 2000; 24(1): 45–66. 10.1111/j.1574-6976.2000.tb00532.x [DOI] [PubMed] [Google Scholar]
- 6.Obst U., Lu T. K., Sieber V. A modular toolkit for generating Pichia pastoris secretion libraries. ACS Synth. Biol. 2017; 6 (6): 1016–1025. 10.1021/acssynbio.6b00337 [DOI] [PubMed] [Google Scholar]
- 7.Camattari A., Goh A., Yip L. Y., Tan A. H. M., Ng S. W., Tran A., et al. Characterization of a panARS-based episomal vector in the methylotrophic yeast Pichia pastoris for recombinant protein production and synthetic biology applications. Microb. Cell Fact. 2016;15(139). 10.1186/s12934-016-0540-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Schwarzhans J.-P., Wibberg D., Winkler A., Luttermann T., Kalinowski J., Friehs K. Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization. Microb. Cell Fact. 2016;15 (84). 10.1186/s12934-016-0486-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Berg L., Strand T. A., Valla S., Brautaset T. Combinatorial mutagenesis and selection to understand and improve yeast promoters. Biomed Res. Int. 2013;926985 10.1155/2013/926985 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yu X., Wang R., Zhang M., Xu Y., Xiao R. Enhanced thermostability of a Rhizopus chinensis lipase by in vivo recombination in Pichia pastoris. Microb. Cell Fact. 2012;11(102). 10.1186/1475-2859-11-102 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lee C. C., Williams T. G., Wong D. W. S., Robertson G. H. An episomal expression vector for screening mutant gene libraries in Pichia pastoris. Plasmid 2005;54: 80–85. 10.1016/j.plasmid.2004.12.001 [DOI] [PubMed] [Google Scholar]
- 12.Liachko I., Youngblood R. A., Tsui K., Bubb K. L., Queitsch C., Raghuraman M. K., et al. GC-Rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris. PLOS Genet. 2014;10:3 10.1371/journal.pgen.1004169 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Cao M., Gao M., Lopez-garcia C. L., Wu Y., Seetharam A. S., Severin A. J., et al. Centromeric DNA facilitates nonconventional yeast genetic engineering. ACS Synth. Biol. 2017; 6(8): 1545–1553. 10.1021/acssynbio.7b00046 [DOI] [PubMed] [Google Scholar]
- 14.Kouprina N., Larionov V. Transformation-associated recombination (TAR) cloning for genomics studies and synthetic biology. Chromosoma 2016; 125(4): 621–632. 10.1007/s00412-016-0588-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Lyn Chan F., Wong L. H. Transcription in the maintenance of centromere chromatin identity. Nucleic Acids Res. 2012;40(22): 11178–11188. 10.1093/nar/gks921 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Malik H. S., Henikoff S. Major evolutionary transitions in centromere complexity. Cell 2009;138(6): 1067–1082. 10.1016/j.cell.2009.08.036 [DOI] [PubMed] [Google Scholar]
- 17.Morales L., Noel B., Porcel B., Marcet-Houben M., Hullo M. F., Sacerdot C., et al. Complete DNA sequence of Kuraishia capsulata illustrates novel genomic features among budding yeasts (Saccharomycotina). Genome Biol. Evol. 2013;5(12): 2524–2539. 10.1093/gbe/evt201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kitada K., Yamaguchi E., Arisawa M. Isolation of a Candida glabrata centromere and its use in construction of plasmid vectors. Gene 1996;175(1–2): 105–108. 10.1016/0378-1119(96)00132-1 [DOI] [PubMed] [Google Scholar]
- 19.Ketel C., Wang H. S. W., McClellan M., Bouchonville K., Selmecki A., Lahav T., et al. Neocentromeres form efficiently at multiple possible loci in Candida albicans. PLOS Genet. 2009;5(3). 10.1371/journal.pgen.1000400 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Chatterjee G., Sankaranarayanan S. R., Guin K., Thattikota Y., Padmanabhan S., Siddharthan R., et al. Repeat-associated fission yeast-like regional centromeres in the ascomycetous budding yeast Candida tropicalis. PLOS Genet. 2016;12(2). 10.1371/journal.pgen.1005839 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Smirnova J. B., McFarlane R. J. The unique centromeric chromatin structure of Schizosaccharomyces pombe is maintained during meiosis. J. Biol. Chem. 2002; 277(22); 19817–19822. 10.1074/jbc.M200765200 [DOI] [PubMed] [Google Scholar]
- 22.Varoquaux N., Liachko I., Ay F., Burton J. N., Shendure J., Dunham M. J., et al. Accurate identification of centromere locations in yeast genomes using Hi-C. Nucleic Acids Res. 2015;43(11): 5331–5339. 10.1093/nar/gkv424 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Coughlan A. Y., Hanson S. J., Byrne K. P., Wolfe K. H. Centromeres of the yeast Komagataella phaffii (Pichia pastoris) have a simple inverted-repeat structure. Genome Biol. Evol. 2016;8(8): 2482–2492. 10.1093/gbe/evw178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.McCarroll R. M., Fangman W. L. Time of replication of yeast centromeres and telomeres. Cell 1988;54(4): 505–513. 10.1016/0092-8674(88)90072-4 [DOI] [PubMed] [Google Scholar]
- 25.Koren A., Tsai H., Tirosh I., Burrack L. S., Barkai N., Berman J. Epigenetically-inherited centromere and neocentromere DNA replicates earliest in s-phase. PLOS Genet. 2010;6(8). 10.1371/journal.pgen.1001068 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Nakamura Y., Nishi T., Noguchi R., Ito Y., Watanabe T., Nishiyama T., et al. A stable, autonomously replicating plasmid vector containing Pichia pastoris centromeric DNA. Appl. Environ. Microbiol. 2018;84(15). 10.1128/AEM.02882-17 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Piva L. C., De Marco J. L., de Moraes L. M. P., Reis V. C. B., Torres F. A. G. Acetamidase as a dominant recyclable marker for Komagataella phaffii strain engineering. Appl. Microbiol. Biotechnol. 2018;102(6): 2753–2761. 10.1007/s00253-018-8824-9 [DOI] [PubMed] [Google Scholar]
- 28.Sambrook J., Fritsch E., Maniatis T. Molecular cloning: a laboratory manual. 2nd ed New York: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
- 29.Wu S., Letchworth G. J. High efficiency transformation by electroporation of Pichia pastoris pretreated with lithium acetate and dithiothreitol. Biotechniques 2004;36(1): 152–154. 10.2144/04361DD02 [DOI] [PubMed] [Google Scholar]
- 30.Reis V. C. B., Nicola A. M., de Souza Oliveira Neto O., Batista V. D. F., de Moraes L. M. P., Torres F. A. G. Genetic characterization and construction of an auxotrophic strain of Saccharomyces cerevisiae JP1, a Brazilian industrial yeast strain for bioethanol production. J. Ind. Microbiol. Biotechnol. 2012;39(11): 1673–1683. 10.1007/s10295-012-1170-5 [DOI] [PubMed] [Google Scholar]
- 31.Betancur M. O., Reis V. C. B., Nicola A. M., De Marco J. L., de Moraes L. M. P., Torres F. A. G. Multicopy plasmid integration in Komagataella phaffii mediated by a defective auxotrophic marker. Microb. Cell Fact. 2017;16(99). 10.1186/s12934-017-0715-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Hieter P., Mann C., Snyder M., Davis R. W. Mitotic stability of yeast chromosomes: a colony color assay that measures nondisjunction and chromosome loss. Cell 1985;40(2): 381–392. 10.1016/0092-8674(85)90152-7 [DOI] [PubMed] [Google Scholar]
- 33.Ugolini S., Bruschi C. V. The red/white colony color assay in the yeast Saccharomyces cerevisiae: epistatic growth advantage of white ade8-18, ade2 cells over red ade2 cells. Curr. Genet. 1996;30(6): 485–492. 10.1007/s002940050160 [DOI] [PubMed] [Google Scholar]
- 34.Du M., Battles M. B., Nett J. H. A color-based stable multi-copy integrant selection system for Pichia pastoris using the attenuated ADE1 and ADE2 genes as auxotrophic markers. Bioeng. Bugs 2012;3(1): 32–37. 10.4161/bbug.3.1.17936 [DOI] [PubMed] [Google Scholar]
- 35.Rébora K., Laloo B., Daignan-Fornier B. Revisiting purine-histidine cross-pathway regulation in Saccharomyces cerevisiae: a central role for a small molecule. Genetics 2005;170(1): 61–70. 10.1534/genetics.104.039396 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Steensels J., Snoek T., Meersman E., Nicolino M. P., Voordeckers K., Verstrepen K. J. Improving industrial yeast strains: exploiting natural and artificial diversity. FEMS Microbiol. Rev. 2014;38(5): 947–995. 10.1111/1574-6976.12073 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Karim A. S., Curran K. A., Alper H. S. Characterization of plasmid burden and copy number in Saccharomyces cerevisiae for optimization of metabolic engineering applications. FEMS Yeast Res. 2013;13(1): 107–116 10.1111/1567-1364.12016 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.