Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

Maryam Hajikarimlou; Houman Moteshareie; Katayoun Omidi; Mohsen Hooshyar; Sarah Shaikho; Tom Kazmirchuk; Daniel Burnside; Sarah Takallou; Narges Zare; Sasi Kumar Jagadeesan; Nathalie Puchacz; Mohan Babu; Myron Smith; Martin Holcik; Bahram Samanfar; Ashkan Golshani

doi:10.1371/journal.pone.0235033

. 2020 Jul 8;15(7):e0235033. doi: 10.1371/journal.pone.0235033

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

Maryam Hajikarimlou ¹, Houman Moteshareie ¹, Katayoun Omidi ¹, Mohsen Hooshyar ¹, Sarah Shaikho ², Tom Kazmirchuk ¹, Daniel Burnside ¹, Sarah Takallou ¹, Narges Zare ¹, Sasi Kumar Jagadeesan ¹, Nathalie Puchacz ¹, Mohan Babu ³, Myron Smith ¹, Martin Holcik ⁴, Bahram Samanfar ^1,⁵, Ashkan Golshani ^1,^*

Editor: Arthur J Lustig⁶

PMCID: PMC7343135 PMID: 32639961

Abstract

Lithium Chloride (LiCl) toxicity, mode of action and cellular responses have been the subject of active investigations over the past decades. In yeast, LiCl treatment is reported to reduce the activity and alters the expression of PGM2, a gene that encodes a phosphoglucomutase involved in sugar metabolism. Reduced activity of phosphoglucomutase in the presence of galactose causes an accumulation of intermediate metabolites of galactose metabolism leading to a number of phenotypes including growth defect. In the current study, we identify two understudied yeast genes, YTA6 and YPR096C that when deleted, cell sensitivity to LiCl is increased when galactose is used as a carbon source. The 5’-UTR of PGM2 mRNA is structured. Using this region, we show that YTA6 and YPR096C influence the translation of PGM2 mRNA.

Introduction

Dysregulation of signaling pathways in the brain is thought to be the main cause of bipolar disorder (BD) [1]. Lithium chloride (LiCl) has remained an important treatment option for BD for decades [2,3]. It has been prescribed to prevent both new depressive and manic episodes and is known to be the only compound to have anti-suicidal effects in BD patients [4].

When LiCl is used as a therapeutic agent, it is generally accepted that in the short term, it influences Protein Kinase C (PKC) and glycogen synthesis kinase-3 (GSK-3) signal transduction pathways. Long term exposure to LiCl modifies the expression of different genes/pathways including PI/PKC signaling cascade, leading to alterations in the synaptic function of the nerve cells [1,5–7]. Inducing autophagy, oxidative metabolism, apoptosis and affecting translation machinery are other pathways proposed to be influenced by LiCl intake [2,6]. LiCl has also been investigated as a treatment option for Alzheimer’s disease which is caused by the aging of the nervous system [6,8]. Although much has been learned about the influence of LiCl, how it affects the cell at the molecular level and the mechanism(s) of its activity, as well as its side effects (secondary effects) require further investigations [1,2,8].

At the molecular level, the sensitivity of yeast cells to LiCl was previously described by changes in the level of expression and activity for PGM2 that encodes a phosphoglucomutase [9,10]. Phosphoglucomutase is responsible for converting glucose-1-phosphate to glucose-6-phosphate and LiCl is an inhibitor of its enzymatic activity. When galactose is used as the carbon source, inhibition of phosphoglucomutase by LiCl results in the accumulation of galactose metabolite intermediates that in turn causes growth defects [11,12]. In the presence of glucose, LiCl reduces the levels of UDP-glucose and disrupts the associated pathways. It has also been suggested that LiCl may inhibit RNA processing enzymes [13,14]. Also, it is reported that under LiCl stress, there seems to be a rapid loss of ribosomal protein gene pre-mRNAs and a decrease in the number of mature mRNAs in the cytoplasm [14]. In addition, it is possible that LiCl may inhibit the initial steps of the protein synthesis pathway. It is thought that LiCl may disrupt the association of translation initiation factor eIF4A RNA helicase to the yeast translation machinery [9] impairing translation initiation. Deletion of TIF2 that codes for the eIF4A helicase increased yeast sensitivity to LiCl. Over-expression of eIF4A helicase reverted the translational inhibition caused by LiCl [9].

In the current study, we observed that the deletion of two yeast genes, YTA6 and YPR096C increased the sensitivity of yeast cells to LiCl. YTA6 codes for a putative ATPase of the CDC48/PAS1/SEC18 (AAA) family of proteins and YPR096C codes for a protein of unknown function. Neither of the genes was previously linked to cell responses to LiCl. Our follow-up genetic investigations suggest that the involvement of YTA6 and YPR096C in yeast LiCl sensitivity seems to be due to their influence on PGM2 translation.

Materials and methods

Strains, plasmids, gene collections and cell and DNA manipulations

MATa mating strain Y4741 orfΔ::KanMAX4 his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 and MATα mating strain, Y7092 can1Δ::STE2pr-Sp_his5 lyp1Δ his3Δ1 leu21Δ0 ura3Δ0 met15Δ0 were used. Yeast non-essential gene knockout collections [15], yeast over-expression plasmid library [16] and the collection of yeast gene-GFP fusion strains were utilized as before [17–19]. Yeast gene knockout was performed by PCR transformation using the Lithium Acetate method and confirmed by PCR analysis [20,21]. Over-expression plasmids for YTA6 and YPR096C were purchased from Thermofisher^® and their integrity was confirmed using PCR analysis. PGM2-GFP strain was purchased from Thermofisher^® Yeast GFP Clone Collection and was utilized in qRT-PCR and western blot analysis. The integrity of this strain was confirmed using PCR and drug sensitivity analyses.

p281 construct carries a LacZ expression cassette under the control of a gal promoter. p281-4 construct carries an insert with a strong hairpin structure (5’GATCCTAGGATCCTAGGATCCTAGG ATCCTAG3’) upstream of LacZ cassette[22]. pAG25 plasmid was used as a DNA template for nourseothricin sulfate (clonNAT) resistance gene marker in PCR reactions for gene knockout experiments. Kanamycin and NAT markers were used as selection markers for corresponding deletion mutant strains. All plasmids carried an ampicillin resistance gene which was used as a selection marker in E. coli DH5α, and a URA3 marker gene for selection in yeast.

P416 construct carries a LacZ expression cassette under the transcriptional control of a gal promoter. To generate reporter LacZ mRNAs under the translational control of complex RNA structures, three different fragments were cloned upstream of the LacZ mRNA in p416 construct using XbaI restriction site. In this way three expression constructs were designed as follows: pPGM2 construct contains the 5’-UTR of PGM2 gene (5’TAATAAGAAAAAGATCACCAATC TTTCTCAGTAAAAAAAGAACAAAAGTTAACATAACAT 3’), pTAR construct contains the 5’ UTR of HIV1-tar gene (5’GGGTTCTCTGGTTAGCCAGATCTGAGCCCGGGAGCTCTCTGGCTAGCTAGGGAACC CACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCC 3’) and pRTN that contains the 5’ UTR of FOAP-11 gene (5’GGGATTTTTACATCGTCTTGGTAAAGGCGTGTGACCCATA GGTTTTTTAGATCAAACACGTCTTTACAAAGGTGATCTAAGTATCTC 3’).

YP (1% Yeast extract, 2% Peptone) or SC (Synthetic Complete) with selective amino acids (0.67% Yeast nitrogen base w/o amino acids, 0.2% Dropout mix,) either with 2% dextrose or 2% galactose, as a source of carbohydrates, was used as culture medium for yeast and LB (Lysogeny Broth) was used for E. coli cultures. 2% agar was used for all solid media. Yeast plasmid extraction was performed using yeast plasmid miniprep kit (Omega Biotek^®) and E. coli plasmid extraction was carried out using GeneJET plasmid miniprep kit (Thermofisher^® and Bio-Basics^®) according to the manufacturers’ instructions.

Drug sensitivity analysis

For drug sensitivity analysis, yeast cells were grown from independent colonies to saturation for two days at 30°C in liquid YPgal. Spot test analysis of serial dilutions of cell suspensions were spotted onto solid media with or without LiCl. For growth sensitivity to LiCl, 10 mM and 100 mM concentrations were used in media containing galactose or glucose, respectively, as described before [10,11]. Sensitivity to the compound was assessed by comparing the number and size of the colonies formed on each plate after 48 hours in comparison with wild type [20].

For quantification analysis, colony counting was done by taking 100 μL of diluted (10⁻⁴) cell cultures from independent colonies, grown for two days at 30°C in liquid YPgal, and spreading on YPgal plates in the absence and presence of LiCl. The colonies were counted two days after incubation at 30°C. Each experiment was repeated at least three times. t-test analysis (P-value ≤ 0.05) was used to determine statistically significant differences.

Quantitative β-galactosidase assay

The effect of 5’-UTR regions to mediate translation in different yeast strains were examined using LacZ reporter systems. To evaluate the activity of LacZ expression cassettes, quantitative β-galactosidase assay was performed using ONPG (O-nitrophenyl-α-D-galactopyranoside) as described [23,24]. Each experiment was repeated at least three times.

Quantitative real time PCR (qRT-PCR)

The content of mRNAs was evaluated using qRT-PCR analysis. Deletion mutants in PGM2-GFP strain background were grown in YPgal overnight with or without LiCl treatment. Total RNA was extracted with Qiagen^® RNeasy Mini Kit. Complementary DNA (cDNA) was made using iScript Select cDNA Synthesis Kit (Bio-Rad^®) according to the manufacturer’s instructions. cDNA was then used as a template for quantitative PCR. qPCR was carried out using Bio-Rad^® iQ SYBR Green Supermix and the CFX connect real time system (Bio-Rad^®), according to the manufacturer’s instructions. PGK1 was used as a constitutive housekeeping gene (internal control). The procedure and data analysis were performed according to MIQE guidelines [25].

The procedure was done in three repeats and t-test analysis (P-value ≤ 0.05) was used to determine statistically significant results. The following primers were used to quantify PGM2 and PGK1 mRNAs, as our positive control in different mutant strains.

PGM2: Forward GGTGACTCCGTCGCAATTAT; Reverse: CGTCGAACAAAGCACAGAAA

PGK1: Forward ATGTCTTTATCTTCAAAGTT; Revers: TTATTTCTTTTCGGATAAGA

Western blot analysis

Western blot analysis was used to investigate the protein content for Pgm2p-GFP fusion protein. Different strains were grown in media treated with and without LiCl. Protein extraction was performed as described by Szymanski [26]. Bicinchoninic acid assay (BCA) was performed to estimate protein concentration as described by the manufacturer (Thermo Fisher^®). Equal amounts of total protein extract (50 μg) were loaded onto a 10% SDS-PAGE gel, run on Mini-PROTEAN Tetra cell electrophoresis apparatus system (Bio-Rad^®). Proteins were transferred to a nitrocellulose 0.45 μm membrane via a Trans-Blot Semi-Dry Transfer (Bio-Rad^®). Mouse monoclonal anti-GFP antibody (Santa Cruz^®) was used to detect protein levels of Pgm2p-GFP. Mouse anti-Pgk1 (Santa Cruz^®) was used to detect Pgk1 protein levels used as internal controls. Immunoblots were visualized with chemiluminescent substrates (Bio-Rad^®) on a Vilber Lourmat gel doc Fusion FX5-XT (Vilber^®). Densitometry analysis was carried out using the FUSION FX software (Vilber^®). Experiments were repeated at least three times; t-test analysis (P-value ≤ 0.05) was used to determine statistically significant results.

Genetic interaction analysis

Synthetic genetic analysis for YTA6 and YPR096C was performed in a 384 format as before [17,19,27]. In brief, deletion mutant for query genes in Mat α mating type were crossed to two sets of gene deletion mutants in Mat a mating type. After a few rounds of selection, double gene deletion mutants were selected in Mat a mating type. Colony size was used as a measure of fitness [27,28]. Colony size was measured as described before [29,30]. The experiment was repeated three times.

For Phenotypic Suppression Array (PSA) analysis a MATα yeast strain having an over-expression plasmid of our query gene is mated into the entire deletion set along with an empty plasmid used as a control [31,32]. For phenotypic suppression analysis, the final constructs transformed into deletion library were grown on YPgal compared to the control plasmid. Phenotypic suppression array was performed by growing the transformed cells on YPgal with a sub-inhibitory concentration of LiCl (3 mM, approximately 1/3 of the concentration used for strain sensitivity analysis) as a stress condition drug [33]. We investigated the ability of the over-expression of our query genes to compensate for the sick phenotype of our deletion sets under the inhibitory concentration of LiCl. If the over-expression of our candidate genes overcome the sensitivity of a yeast deletion strain caused by drug inhibition, we can suggest that a functional connection exists between the two genes [20,34].

Genetic interaction data analysis

Scoring fitness was done by colony size measurement as in [29,30]. Those deletions that had 30% or more reduction in colony size in at least two experiments were considered hits. Based on their biological process and/or molecular function, hits were clustered into groups with enriched GO terms using Gene Ontology Resource http://geneontology.org/ and Genemania database http://genemania.org.

Results and discussion

Deletion of YTA6 and YPR096C increases yeast sensitivity to lithium

Drug sensitivity of mutant strains to a target chemical is an important tool to investigate how a chemical compound affects the cell at the molecular level and pathways influenced by the drug [17,19,35]. While investigating yeast gene deletion mutants that are sensitive to LiCl we identified two gene deletion mutants for YTA6 and YPR096C that showed increased sensitivity to LiCl. Little is known about the molecular activity of these two genes and the cellular process in which they participate making them interesting targets to study. YTA6 codes for a putative ATPase and YPR096C is an uncharacterized ORF.

In the spot test assay indicated in Fig 1 yta6Δ and ypr096cΔ show growth reduction in the presence of LiCl (10 mM LiCl) suggesting increased sensitivity of yeast strains when these two genes are deleted. tif2Δ was used as a positive control. Introduction of the over-expression plasmids that express the deleted genes, into the corresponding gene deletion mutants reversed the observed sensitivities to LiCl (Fig 1). To confirm the results obtained by the spot test assay we perform colony count measurement analysis, which represents a more quantitative approach. In this method, the decreased percentage of colonies is calculated by dividing the number of colonies in media in the presence of the LiCl to the number of colonies in control media and normalized to Wild Type (WT). Indicated in Fig 2 deletion of YTA6, YPR096C or TIF2 show reduced colony formation in the presence of LiCl. As before, introduction of the over-expression plasmids that express the deleted genes into the corresponding gene deletion mutants suppressed cell sensitivities to LiCl caused by gene deletions.

Fig 2 — The average number of colonies formed for different yeast strains in the presence of LiCl (10 mM) was normalized to that for the WT strain (WT average colony count = 285.33). Double deletion for *GAL1* with *YTA6* or *YPR096C* suppressed the observed sensitivity of single-gene deletions for *YTA6* or *YPR096C*. Data represent the average from three independent experiments (n = 3) and error bars represent standard deviation. * represent statistically significant results compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences.

LiCl reduces the activity of phosphoglucomutase enzyme leading to the accumulation of intermediate metabolites from the galactose metabolism including galactose-1-phosphate, a toxic intermediate. In yeast, galactokinase is encoded by the GAL1 gene. To investigate the influence of YTA6 and YPR096C on LiCl toxicity through galactose metabolism, we generated double gene deletions for YTA6 or YPR096C with the GAL1 gene. Deletion of the GAL1 gene relieved the sensitivity of gene deletion mutants for YTA6 or YPR096C to LiCl (Fig 1). Also, when glucose was used as a carbon source deletion strains for YTA6 or YPR096C showed no sensitivity to 10 mM LiCl. When the concentration of LiCl was increased to a toxic level (100 mM) in the presence of glucose as a carbon source [11,36], deletion mutants for YTA6 or YPR096C did not show increased sensitivity (S1 Fig). Together these results further connect the observed LiCl sensitivity for YTA6 and YPR096C deletion strains to galactose metabolism.

YTA6 and YPR096C regulate the expression of PGM2 at the level of translation

PGM2 has been identified as a target of LiCl in yeast cells and its expression has been reported to change in the presence of LiCl [10]. Next, we investigated the ability of YTA6 and YPR096C to change PGM2 expression both at the levels of translation (Fig 3A) and transcription (Fig 3B). This was done using western blot analysis in a strain where Pgm2p was tagged with a GFP gene. In the absence of LiCl, we observed no notable alteration in the Pgm2p levels when either YTA6 or YPR096C were deleted. However, when cells were challenged with 10 mM LiCl, the deletion of either YTA6 or YPR096C reduced the protein content of Pgm2p.

Fig 3 — (A) Protein content analysis of Pgm2p-GFP protein in deletion of yeast strains for *yta6Δ* and *ypr096cΔ*. Western blot analysis was used to measure the protein content for Pgm2p-GFP protein in the absence or presence of LiCl (10 mM) and related to WT. Pgk1p was used as a housekeeping gene and the values are normalized to that. The inset represents a typical blot (B) mRNA content analysis of *PGM2* in *yta6Δ* and *ypr096cΔ*. qRT-PCR was used to evaluate the content of *PGM2* mRNA in yeast gene deletion mutants related to WT strain and normalized to *PGK1* mRNA levels in the absence or presence of LiCl (10 mM). Each experiment was repeated at least three times (n ≥ 3). Error bars represent standard deviation. * represent statistically significant results compared to the value in the corresponding WT. t-test analysis (P-value ≤ 0.05) was used to compare differences.

To investigate the possible effect of YTA6 and YPR096C on PGM2 transcription, we used qRT-PCR analysis to measure the content of PGM2 mRNA when YTA6 and YPR096C were deleted. Indicated in Fig 3B, deletion of YTA6 and YPR096C did not noticeably change the content of PGM2 mRNA when cells were treated with LiCl. This suggests that YTA6 and YPR096C are unlikely to alter PGM2 expression at the transcription level. Together these observations connect the activities of YTA6 and YPR096C to the expression of Pgm2p at the protein level. This is in agreement with a previous observation by Sofola-Adesakin et al. that in Drosophila melanogaster LiCl impaired gene expression at the protein synthesis level and not the mRNA level[6].

Translation of β-galactosidase reporter mRNA with a hairpin structure is altered by the deletion of YTA6 and YPR096C

The 5’-UTR of PGM2 mRNA is predicted to contain a highly structured region [37,38] (S2 Fig). This knowledge along with the observation that YTA6 and YPR096C appear to impact PGM2 expression at the translation level prompted us to investigate the influence of YTA6 and YPR096C on the translation of other structured mRNAs. First, we placed the 5’-UTR of PGM2 mRNA in front of a LacZ reporter gene in a p416 expression construct [39]. Indicated in Fig (4A and 4B), when YTA6 and YPR096C were deleted the activity of β-galactosidase was reduced for the reporter gene that contained 5’-UTR of PGM2 mRNA and not a control mRNA without the 5’-UTR of PGM2. The deletion of TIF2 was used as a positive control.

Fig 4 — Activities from *β-galactosidase* mRNAs that carry 5’-UTR of *PGM2* mRNA (pPGM2) (A) upstream of *LacZ* reporter was reduced in *yta6Δ* and *ypr096cΔ* strains; *tif2Δ* was used as a positive control. Strains carrying low complexity regions upstream of *LacZ* reporters p416 (B) did not show as significant reductions in *β-galactosidase* activity. Values are normalized to that for WT which resulted in average *β-galactosidase* values of 38.1U and 407.5U for pPGM2 and p416 constructs, respectively. Each experiment was repeated at least three times (n ≥ 3) and error bars represent standard deviation. * represent statistically significant results (P-value ≤ 0.05) compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences. The insets represent schematic reporter mRNA structures.

Next, we utilized an expression cassette, p281-4 with a strong hairpin structure in front of a LacZ reporter gene [22]. A second construct, p281 without the hairpin structure was used as a control. Illustrated in Fig (5A and 5B) it was observed that when YTA6 and YPR096C were deleted the activity of β-galactosidase was reduced for the reporter gene that contained a hairpin structure. When the hairpin was absent, the activity of β-galactosidase was independent of YTA6 and YPR096C. Together these data show that the deletion of YTA6 and YPR096C seem to reduce the translation of structured reporter mRNAs.

Fig 5 — A strong hairpin structure (p281-4) (A) upstream of a *LacZ* reporter pTAR (C) highly structured 5’-UTR of *HIV1-tar* and pRTN (D) constructs contain the highly structured 5’-UTR of *FOAP-11* genes in front of the *β-galactosidase* reporter mRNA. P281 (B) was served as a control plasmid with no inhibitory structure did not show as significant reductions in *β-galactosidase* activity. Values are normalized to that for WT which resulted in average *β-galactosidase* values of 14.1U and 37.9U for pRTN and p416 constructs, respectively. Each experiment was repeated at least three times (n ≥ 3) and error bars represent standard deviation. * represent statistically significant results (P-value ≤ 0.05) compared to the WT. t-test analysis (P-value ≤ 0.05) was used to compare differences. The insets represent schematic reporter mRNA structures.

Next, we investigated the influence of YTA6 and YPR096C on other structured mRNAs. For this, we designed two additional β-galactosidase mRNA reporters each carrying different complex RNA structures. pTAR carries the 5’-UTR of the HIV1-tar gene. This region contains a strong hairpin loop involved in modulating expression [40]. pRTN carries the 5’ UTR of FOAP-11 gene that contains a highly structured region [41]. Indicated in (Fig 5C and 5D), deletion strains for YTA6 and YPR096C had a reduced level of β-galactosidase expression.

Genetic interaction analysis further connects the activity of YTA6 and YPR096C to the protein biosynthesis pathway

Genetic Interaction (GI) analysis is based on the assumption that parallel compensating cellular pathways give the cell its plasticity and tolerance against random deleterious mutations [29]. In this way, deletion of individual genes that can functionally compensate for each other has little or no phenotypic consequences. However, when both genes are deleted, an unexpected phenotype can emerge which can often be detected but a decrease in cell fitness or even cell death. In this case, the two genes are said to be forming a negative genetic interaction (nGI). An nGI can reveal the involvement of genes in compensating parallel pathways. nGI analysis has been used in various investigations to study gene function [17,18,33]. Systematic analysis of GIs in yeast is made possible by its two mating types. A target gene deletion in α-mating type (MAT alpha) is crossed with an array of single-gene deletion in a-mating type (MAT a) background and after a few rounds of selection double gene knockouts are selected [27]. Colony size measurement is often used to determine the fitness of double gene knockouts [28]. To this end, we generated a set of double gene deletions mutants for our two query genes with 402 deletion mutants for genes involved in gene expression (S2 Table). This array was termed gene expression array. Due to inherent bias associated with such enriched subsets, a second set of double gene deletions were made for our query genes with 304 random gene deletions, termed random array, and was used as a control (S2 Table).

YTA6 formed 7 nGIs with different genes (S3 Table). The list of interactors includes YPL079W that encodes for large ribosomal subunit protein 21B and YPL090C that codes for small ribosomal subunit 6A. YPR096C interacted with 8 genes including YOR091W that codes for a protein associated with translating ribosomes and YOR078W that codes for a protein involved in small ribosomal subunit biogenesis (S3 Table). The low number of nGIs observed for both YTA6 and YPR096C makes it difficult to draw a statistically meaningful enrichment for the interacting genes. As a result, formulating function(s) for YTA6 and YPR096C on the basis of the observed interactions is not feasible.

In addition, we also investigated the conditional nGIs for the two target genes. Conditional GIs represent an interesting form of gene association. They represent a further insight into the function of genes under a specific condition. The activities of many genes are known to be condition dependent. For example, the expression of many DNA repair genes are regulated in response to DNA damage [42,43]. To this end, we investigated conditional nGIs for YTA6 and YPR096C in the presence of a mild concentration of LiCl (3 mM). Illustrated in Fig 6 YTA6 formed a total of 14 conditional nGIs. On the basis of their functions and cellular processes in which they participate, these genes can be divided into different categories. Of note, the category of genes involved in protein biosynthesis was the only significantly enriched category (P = 1.6e-4). Within this category, we find 7 genes including, RPL2B that encodes large ribosomal subunit protein 2B and YDR159W that codes for a protein required for biogenesis of small ribosomal subunit. YPR096C formed 13 conditional nGIs, 6 of which belonged to the category of protein biosynthesis (P = 6.6e-4). The genes in this category include YDL081C that codes for ribosomal stalk protein P1 alpha and YER153C that codes for a mitochondrial translation activator. The conditional nGIs observed here suggest a possible functional association for YTA6 and YPR096C to protein biosynthesis when cells are challenged with LiCl.

Fig 6 — Our data shows a cluster of interactors involved in the protein biosynthesis pathway for *YTA6* (P = 1.6e-4) and *YPR096C* (P = 6.6e-4). *CTK1*, *HAC1*, *BCK1*, *MRPL1*, and *PGM2* are mutual hits shared between *YTA6* and *YPR096C*. Circles represent genes, dashed lines represent nGIs identified in this study and solid lines represent previously reported interactions in the literature. The inset represents an example of a typical interaction.

Phenotypic Suppression Array (PSA) analysis focuses on another form of GIs, where a specific phenotype associated with a gene deletion mutant is suppressed by the over-expression of the second gene [32,44,45]. This type of GI generally indicates a close functional association where the activity of an over-expressed gene compensates for the absence of the others. To this end, we subjected the gene expression array (described above) to 10 mM of LiCl. In this concentration, a number of strains showed sensitivity. We then attempted to reverse the observed sensitivities by over-expression of either YTA6 or YPR096C in these mutants. Interestingly over-expression of either YTA6 or YPR096C compensated for the sensitivity of the same two gene deletions, bck1Δ and eap1Δ, to LiCl (Fig 7). We confirmed our PSA data using spot test drug sensitivity analysis (Fig 7). We observed that sensitivity of bck1Δ and eap1Δ to 10 mM LiCl was relieved by introducing pYTA6 and pYPR096C over-expression plasmids into deletion mutant strains (Fig 7). The fact that YTA6 and YPR096C compensated the same two gene deletions, further connects their activities together in the context of LiCl sensitivity. Another possibility is that the over-expression of YTA6 and YPR096C would improve PGM2 mRNA translation, leading to an increase in PGM2 activity in the cells that was shown to confer resistance to lithium in galactose medium [11]. According to this hypothesis, if the main cause of toxicity under these conditions is the decrease in PGM2 activity, the over-expression of YTA6 and YPR096C would be "solving" the original problem and thus making any yeast strain more tolerant to lithium, not only those with a related function in the cell. Bck1 is reported to function in cell wall integrity pathway and deadenylation of mRNAs and Eap1 is an eIF4E-associated protein and accelerates the decapping of mRNAs. They have both been implemented in the regulation of alternative translation initiation via Dhh1p, a helicase protein [46–49]. Dhh1p is a member of the DEAD-box family of RNA helicases capable of unwinding strong secondary structures. It functions in mRNA decapping and translational repression among other processes [45,50]. A proposed functional association for both YTA6 and YPR096C to the regulation of translation via Dhh1 merits further investigations.

Fig 7 — (A) *BCK1* and *EAP1* are known to be involved in translation initiation via *DHH1* through previously reported genetic. New genetic interactions (PSA-based) identified in this study are shown with dashed lines. (B) Spot test analysis confirms the relief of drug sensitivity to LiCl for *eap1Δ and bck1Δ* by over-expression of *YTA6* and *YPR096C*. Spot test analysis was repeated three times (n = 3) with similar outcomes.

Supporting information

S1 Fig. Drug sensitivity analysis for different yeast strains on YPD media.

No increased LiCl sensitivity was observed for deletion mutant strains for YTA6 and YPR096C in media containing glucose as a carbon source. Spot test analysis was repeated at least three times (n ≥ 3) with similar outcomes.

(TIF)

Click here for additional data file.^{(331KB, tif)}

S2 Fig. The secondary structure of PGM2 5’-UTR.

Unlike most yeast ORFs, the 5’ UTR of PGM2 is thought to be structured (38).

(TIF)

Click here for additional data file.^{(349.4KB, tif)}

S1 Table. qRT-PCR raw data for different strains with and without LiCl treatment.

Each experiment was repeated at least three times (n ≥ 3).

(DOCX)

Click here for additional data file.^{(28KB, docx)}

S2 Table. List of mutant strains in gene expression and random arrays.

(DOCX)

Click here for additional data file.^{(60.1KB, docx)}

S3 Table. List of negative genetic interactions (nGIs) for YTA6 and YPR096C (no LiCl in media).

(DOCX)

Click here for additional data file.^{(21.5KB, docx)}

S1 Raw Images

(PDF)

Click here for additional data file.^{(184.3KB, pdf)}

Acknowledgments

This work is dedicated to the memory of our friend and colleague Fareed Arasteh who lost his life in the Tehran Plane Crash, 2020.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This research was funded by Natural Sciences and Engineering Research Council of Canada, NSERC grant number: 123456.

References

1.Lenox RH, Wang L. Molecular basis of lithium action: integration of lithium-responsive signaling and gene expression networks. Mol Psychiatry. 2003;8:135–44. 10.1038/sj.mp.4001306 [DOI] [PubMed] [Google Scholar]
2.Won E, Kim Y. An Oldie but Goodie: Lithium in the Treatment of Bipolar Disorder through Neuroprotective and Neurotrophic Mechanisms. Int J Mol Sci. 2017;18(12):2679. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Fornaro M, Berardis D De, Anastasia A, Novello S, Fusco A, Ignazio C, et al. The identification of biomarkers predicting acute and maintenance lithium treatment response in bipolar disorder: A plea for further research attention. Psychiatry Res. 2018;269:658–72. 10.1016/j.psychres.2018.08.034 [DOI] [PubMed] [Google Scholar]
4.Ariyasinghe D, Perera SR. The role of lithium in the treatment of bipolar disorder. Sri Lanka J Psychiatry. 2018;28–30. [Google Scholar]
5.Yang D, Song L, Hu J, Yin W, Li Z, Chen Y, et al. Biochemical and Biophysical Research Communications Enhanced tolerance to NaCl and LiCl stresses by over-expressing Caragana korshinskii sodium / proton exchanger 1 (CkNHX1) and the hydrophilic C terminus is required for the activity of CkNHX1 in Atsos3. Biochem Biophys Res Commun. 2012;417(2):732–7. 10.1016/j.bbrc.2011.12.023 [DOI] [PubMed] [Google Scholar]
6.Sofola-adesakin O, Castillo-quan J., Rallis C, Tain L., Bjedov I, Rogers I, et al. Lithium suppresses A β pathology by inhibiting translation in an adult Drosophila model of Alzheimer ‘ s disease. Front Aging Neurosci. 2014;6(July):1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Castillo-Quan J., Li L, Kinghorn K., Hardy J, Bjedov I, Partridge L. Lithium Promotes Longevity through GSK3 / NRF2- Dependent Hormesis Lithium Promotes Longevity. Cell Rep. 2016;15:638–50. 10.1016/j.celrep.2016.03.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Williams RS., Harwood A. Lithium therapy and signal transduction. Trends Pharmacol Sci. 2000;21(2):61–4. 10.1016/s0165-6147(99)01428-5 [DOI] [PubMed] [Google Scholar]
9.Montero-Lomelí M, Morais BLB, Figueiredo DL, Neto DCS, Martins JRP, Masuda CA. The initiation factor eIF4A is involved in the response to lithium stress in Saccharomyces cerevisiae. J Biol Chem. 2002;277(24):21542–8. 10.1074/jbc.M201977200 [DOI] [PubMed] [Google Scholar]
10.Bro C, Regenberg B, Lagniel G, Labarre J, Montero-Lomelí M, Nielsen J. Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. J Biol Chem. 2003;278(34):32141–9. 10.1074/jbc.M304478200 [DOI] [PubMed] [Google Scholar]
11.Masuda CA, Xavier MA, Mattos KA, Galina A, Montero-Lomeli M. Phosphoglucomutase Is an in Vivo Lithium Target in Yeast. Biol Chem. 2001;276:37794–801. [DOI] [PubMed] [Google Scholar]
12.Liu J., Zhang GC, Kong I., Yun E., Zheng J., Kweon D., et al. A mutation in PGM2 causing inefficient Galactose metabolism in the Probiotic Yeast Saccharomyces boulardii. Appl enviromental Microbiol. 2018;84(10):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Dichtl B, Stevens A, Tollervey D. Lithium toxicity in yeast is due to the inhibition of RNA processing enzymes. EMBO J. 1997;16(23):7184–95. 10.1093/emboj/16.23.7184 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Bergkessel M, Whitworth G., Guthrie C. Diverse environmental stresses elicit distinct responses at the level of pre-mRNA processing in yeast. RNA. 2011;17:1461–78. 10.1261/rna.2754011 [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, et al. Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis. Science (80-). 1999;285(5429):901–7. [DOI] [PubMed] [Google Scholar]
16.Gelperin DM, White MA, Wilkinson ML, Kon Y, Kung LA, Wise KJ, et al. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev. 2005;2816–26. 10.1101/gad.1362105 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Moteshareie H, Hajikarimlou M, Indrayanti AM, Burnside D, Paula A, Id D, et al. Heavy metal sensitivities of gene deletion strains for ITT1 and RPS1A connect their activities to the expression of URE2, a key gene involved in metal detoxification in yeast. Plose one. 2018;13:1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Jessulat M, Malty RH, Nguyen-tran D, Deineko V, Aoki H, Vlasblom J, et al. Spindle Checkpoint Factors Bub1 and Bub2 Promote DNA DoubleStrand Break Repair by Nonhomologous End Joining. mcb. 2015;35(14):2448–63. 10.1128/MCB.00007-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Alamgir M, Jessulat M, Azizi A, Golshani A. Chemical-genetic profile analysis of five inhibitory compounds in yeast. bmc Chem Biol. 2010;10(6). [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Samanfar B, Omidi K, Hooshyar M, Laliberte B, Alamgir M, Seal AJ, et al. Large-scale investigation of oxygen response mutants in Saccharomyces cerevisiae. Mol Biosyst. 2013;9(6):1351–9. 10.1039/c3mb25516f [DOI] [PubMed] [Google Scholar]
21.Karlsson-rosenthal C, Millar JBA. Cdc25: mechanisms of checkpoint inhibition and recovery. Trends Cell Biol. 2006;16(6). [DOI] [PubMed] [Google Scholar]
22.Altmann M, Müller P., Wittmer B, Ruchti F, Lanker S, Trachsel H. A Saccharomyces cerevisiae homologue of mammalian translation initiation factor 4B contributes to RNA helicase activity. EMBO J. 1993;12(10):3997–4003. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Stansfield I, Akhmaloka M, Tuite F. A mutant allele of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows temperature-dependent aUosuppressor and omnipotent suppressor phenotypes. Curr Genet. 1995;27:417–26. 10.1007/BF00311210 [DOI] [PubMed] [Google Scholar]
24.Krogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V, et al. Methylation of Histone H3 by Set2 in Saccharomyces cerevisiae Is Linked to Transcriptional Elongation by RNA Polymerase II. mcb. 2003;23(12):4207–18. 10.1128/mcb.23.12.4207-4218.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22. 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
26.Szymanski EP, Kerscher O. Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications. J Vis Exp. 2013;80(October):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Tong A, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, et al. Systematic Genetic Analysis with Ordered Arrays of Yeast Deletion Mutants. Science (80-). 2001;294(December):2364–9. [DOI] [PubMed] [Google Scholar]
28.Toufighi K, Youn J, Ou J, Luis BS, Hibbs M, Hess D, et al. Quantitative analysis of fitness and genetic interactions in yeast on a genome scale. Nat Methods. 2011;7(12):1017–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Wagih O, Usaj M, Baryshnikova A, Vandersluis B, Kuzmin E, Costanzo M, et al. SGAtools: one-stop analysis and visualization of array-based genetic interaction screens. Nucleic Acids Res. 2013;41(May):591–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Memarian N, Jessulat M, Alirezaie J, Mir-Rashed N, Xu J, Zareie M, et al. Colony size measurement of the yeast gene deletion strains for functional genomics. BMC Bioinformatics. 2007;8(117). [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K, et al. Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell. 2006;21:319–30. 10.1016/j.molcel.2005.12.011 [DOI] [PubMed] [Google Scholar]
32.Douglas AC, Smith AM, Sharifpoor S, Yan Z, Durbic T, Heisler LE, et al. Functional Analysis With a Barcoder Yeast Gene Overexpression System. G3 Genes|Genomes|Genetics. 2012;2(10):1279–89. 10.1534/g3.112.003400 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Samanfar B, Shostak K, Moteshareie H, Hajikarimlou M, Shaikho S, Omidi K, et al. The sensitivity of the yeast, Saccharomyces cerevisiae, to acetic acid is influenced by DOM34 and RPL36A. PeerJ. 2017;2017(11). [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Samanfar B, Tan LH, Shostak K, Chalabian F, Wu Z, Alamgir M, et al. A global investigation of gene deletion strains that affect premature stop codon bypass in yeast, Saccharomyces cerevisiae. Mol Biosyst. 2014;10(4):916–24. 10.1039/c3mb70501c [DOI] [PubMed] [Google Scholar]
35.Omidi K, Jessulat M, Hooshyar M, Burnside D, Schoenrock A, Kazmirchuk T, et al. Uncharacterized ORF HUR1 influences the efficiency of non-homologous end-joining repair in Saccharomyces cerevisiae. Gene. 2018;639:128–36. 10.1016/j.gene.2017.10.003 [DOI] [PubMed] [Google Scholar]
36.Phiel CJ, Klein PS. Molecular Targets of Lithium Action. Annu Rev Pharmacol Toxicol. 2001;41:789–813. 10.1146/annurev.pharmtox.41.1.789 [DOI] [PubMed] [Google Scholar]
37.Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, et al. The Transcriptional Landscape of the Yeast Genome Defined by RNA Sequencing. Science (80-). 2008;320(June):1344–50. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Tuller T, Ruppin E, Kupiec M. Properties of untranslated regions of the S. cerevisiae genome. BMC Genomics. 2009;10(391). [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Cuperus JT, Groves B, Kuchina A, Rosenberg AB, Jojic N, Fields S, et al. Deep learning of the regulatory grammar of yeast 5 ′ untranslated regions from 500, 000 random sequences. Genome Res. 2017;27:2015–24. 10.1101/gr.224964.117 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Bolinger C, Sharma A, Singh D, Yu L. RNA helicase A modulates translation of HIV-1 and infectivity of progeny virions. Nucleic Acids Res. 2010;38(5):1686–96. 10.1093/nar/gkp1075 [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Washietl S, Hofacker IL, Lukasser M, Hüttenhofer A, Stadler PF. Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome. Nat Biotechnol. 2005;23(11):1383–90. 10.1038/nbt1144 [DOI] [PubMed] [Google Scholar]
42.Omidi K, Hooshyar M, Jessulat M, Samanfar B, Sanders M, Burnside D, et al. Phosphatase Complex Pph3 / Psy2 Is Involved in Regulation of Efficient Non-Homologous End-Joining Pathway in the Yeast Saccharomyces cerevisiae. Plose one. 2014;9(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Hendry JA, Tan G, Ou J, Boone C, Brown GW. Leveraging DNA Damage Response Signaling to Identify Yeast Genes Controlling Genome Stability. G3 Genes|Genomes|Genetics. 2015;5(May):997–1006. [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Ooi SL, Pan X, Peyser BD, Ye P, Meluh PB, Yuan DS, et al. Global synthetic-lethality analysis and yeast functional profiling. Trends Genet. 2006;22(1):56–63. 10.1016/j.tig.2005.11.003 [DOI] [PubMed] [Google Scholar]
45.Boone C, Bussey H, Andrews BJ. Exploring genetic interactions and networks with yeast. Nat Rev Genet. 2007;8(6):437–49. 10.1038/nrg2085 [DOI] [PubMed] [Google Scholar]
46.Li X, Ohmori T, Irie K, Kimura Y, Suda Y, Mizuno T, et al. Different Regulations of ROM2 and LRG1 Expression by Ccr4, Pop2, and Dhh1 in the Saccharomyces cerevisiae Cell Wall Integrity Pathway. mSphere. 2016;1(5). [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Castelli LM, Lui J, Campbell SG, Rowe W, Zeef LAH, Holmes LEA, et al. Glucose depletion inhibits translation initiation via eIF4A loss and subsequent 48S preinitiation complex accumulation, while the pentose phosphate pathway is coordinately up-regulated. Mol Biol Cell. 2011;22(15):3379–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Blewett NH, Goldstrohm AC. A Eukaryotic Translation Initiation Factor 4E-Binding Protein Promotes mRNA Decapping and Is Required for PUF Repression. mcb. 2012;32(20):4181–94. 10.1128/MCB.00483-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Fischer N, Weis K. The DEAD box protein Dhh1 stimulates the decapping enzyme Dcp1. EMBO J. 2002;21(11):2788–97. 10.1093/emboj/21.11.2788 [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Carroll JS, Munchel SE, Weis K. The DExD/H box ATPase Dhh1 functions in translational repression, mRNA decay, and processing body dynamics. cell Biol. 2011;194(4):527–37. [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0235033.r001

Decision Letter 0

Arthur J Lustig

21 Aug 2019

PONE-D-19-21480

Lithium chloride toxicity is connected to regulation of gene expression in yeast

PLOS ONE

Dear Dr. Golshani,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

As Reviewer 2 points out, LiCl also has an interaction in galactose metabolism, independent of toxicity. The consideration of galactose metabolism intermediates that are likely accumulate in yeast cells creating a large amount of phenotypes may be due to specific galactose-1-phosphate accumulation, already known as part of toxicity of galactosemia. Since there is a second pathway that has not been considered, discussion of that pathway is required. Add appropriate references.
Testing of the alternative pathway per the suggestions of Reviewer 2 is required: 1) control experiments testing lithium toxicity in using media that use other carbon sources (e.g. glucose, glycerol, lactate, etc); 2) test the effect of the gal1 gene deletion on the growth tests of the mutant trains. Test the alternative hypothesis by suppression through deletion of YTA6 and YPR096C.
Cell size as an assay of fitness is flawed since it could be due to a higher cell death rate or a slower growth rate. These paramaters need to be determined independently.
Present the results of non-treated cells.
The PGM2 hairpin hypothesis requires more controls including testing a) the effect of the hairpin on translational assays and b) the absence of the hairpin on the suppression of the phenotype.
The authors need to clarify the potential of non-isogenicity on the nGI results.
Statistical analysis requires a description in methods.
Figure 6 is difficult to see (see the AE comments below).
The major textual problem is the over-comparison with the use of Li in bi-polar disorder, as noted by Reviewer 1. This may be mentioned only briefly as it is peripheral to the actual study
Reviewer 2 has more specialized knowledge essential for the interpretation of the data. Reviewer 1 focused on the presentation.
The AE reading of the manuscripts found numerous additional problem. First, Figures 1 and 7 show spot assays that are strips of data. The nature of the splicing is not mentioned in the text and it is unknown whether they are derived from one or more plate. The original data must be presented to the Reviewers for all of the data by the new PLOS One data presentation rules. Second, the other Figures would be assisted by a diagram of the assay shown in that Figure. Third, the statistical tests frequire exact n values and methods in the Figure Legends. Fourth, are the cells that are the origin of the quantitative cell counting independent colonies from independent cells?. If not, this must be repeated with colonies from independent cells that may require a larger sample size. Fifth, when data are non-statistically significant, they should not be shown in any Figure, including the supplement. Sixth, terms such as gene expression and protein translation are muddled. These need to be fixed. Seventh, the references are incomplete. Please correct carefully. Eighth, spelling errors detract from the coherent reading of the manuscript. The authors should have an independent individual unassociated with the paper read the manuscript for spelling and grammar.

We would appreciate receiving your revised manuscript by Oct 05 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Arthur J. Lustig, PhD

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a concise piece of work on a physiological target function of LiCl toxicity in yeast. The experiments are properly conducted and the results are reasonably interpreted. The presentation is, however, somewhat misleading. More than half (six lines out of ten) of the Abstract describes the link between LiCl and bipolar disorder, although the work has very little to do with the disease. This disproportional presentation is confusing and misleading for general readership. It may be acceptable to mention bipolar disorder in the Introduction, although I recommend to curtail the part from the Abstract.

Typos or errors:

l.82

Insert a space after his5.

l.130, l.166,

Capitalize c of Licl.

l.180-188

This section should be in the Introduction, and therefore should be removed.

l.191

TIF2 should be Italicized.

l.201

Insert a space between 10 and mM.

l.218 and Fig.1 and 7

Ypgal or YPgal (l.107)? Stick to the same nomenclature.

l.356

EAP1, not EAp1.

l.356

The legend mentions dhh1D but the corresponding strain is tif2D in the Fig.7. Which is correct?

Reviewer #2: The present work aims to describe new molecular mechanisms of lithium since it has been used in treatment of bipolar disorder for decades without a complete knowledge of it mechanism of action. Using a yeast genetic approach, the authors identified two genes that when deleted in yeast cells decreases tolerance to lithium treatment in the presence of galactose. Moreover, the deletion of these genes - YTA6 and YPR096C - seems to enhance lithium toxicity by interfering with PGM2 translation, an already known target of lithium chloride. Further, as PGM2 mRNA possesses a highly structured hairpin in the 5’ UTR region, the authors were able to demonstrate that YTA6 and YPR096C participate in the process of translation of some other highly structured mRNAs, suggesting a possible mechanism explaining why PGM2 translation and cell growth are affected by knocking out those genes in the presence of LiCl. As YTA6 and YPR096C are yeast genes with little information so far, the authors focused in genetic interaction screenings to further identify how those deletions could promote emerging double-knockout phenotypes when crossed with deletion mutants of genes involved in gene expression. Using this tool, they could observe enrichment in negative genetic interactions with genes already known to participate in protein biosynthesis. Moreover, by overexpressing YTA6 and YPR096C in two of the negative interaction hits of the previous screening – bck1� and eap1� -, they observed suppression of LiCl toxicity in YPGal medium.

The data presented by the authors contribute to the literature in the context of LiCl toxicity in galactose containing medium, and also propose a function for two yeast genes that, until now, little was known. But, in my point of view, major concerns have to be addressed to fit criteria for publication.

Major concerns:

- The authors argue that effects observed by LiCl treatment regards only lithium toxicity but, in fact, Masuda et al 2001,2008 demonstrated that there is a potent interaction of LiCl treatment and galactose metabolism. By blocking PGM2 activity with lithium, galactose metabolism intermediates accumulate in yeast cells and a large amount of phenotypes are due to specific galactose-1-phosphate accumulation, a molecule already known as part of toxicity of a genetic disease called classic galactosemia. We cannot exclude the hypothesis presented by the authors that lithium is (directly) inducing a protein translation problem, but at this point they cannot exclude that the translation problem is being induced by galactose-1-phosphate (or other intermediary metabolite of the galactose pathway) accumulation neither. No comment about the galactose-1-phosphate toxicity was presented in this manuscript. Because previous work has observed that most phenotypes under these condition can be suppressed by the galactokinase gene GAL1 deletion, authors should at least comment on the hypothesis, but preferably, test it. Suggestions for this test are: 1) control experiments testing lithium toxicity in other media containing other carbon sources (e.g. glucose, glycerol, lactate, etc); 2) test the effect of the gal1 gene deletion on the growth tests of the mutant trains. If the deletion of YTA6 and YPR096C can be completely suppressed by gal1 deletion, it would favor the hypothesis that the toxicity modulated by the presence of these genes is more related to galactose-1-phosphate accumulation than to lithium toxicity directly.

- In order to claim that the effect of the deletions of YTA6 and YPR096C on lithium/galactose toxicity is really due to the impact on PGM2 translation, I would suggest authors to: 1) test the actual PGM2 mRNA hairpin on the translational assays used in this work; 2) test the expression of a PGM2 gene allele without the hairpin – I would expect that this allele would suppress the effect of the deletions.

- The quality of the presented figures is bad, some are almost impossible to visualize (especially figure 6), please increase quality for publication.

- Usually, yeast spot growth assays are presented as one photograph of each plate containing all the strains that are to be compared. It makes the comparison of relative growth rate more straight-forward and convincing.

- The nGI screening present a bias as authors crossed the mutants yta6� and ypr0963c� to a called “gene expression library”, thus enhancing the chances of enrichment in protein biosynthesis interactions. So, I am not sure whether the enrichment of the class observed is a good indicator in this case. Also, since the screening was performed with a subset of the entire library, authors should list all the mutants included in the screening.

- Some of the arguments used during the manuscript are missing references, and some are wrongly interpreted from the literature. For example, in the lines 35/36 authors argue that LiCl reduces PGM2 expression but Masuda et al 2001 shows that lithium treatment increases the mRNA levels of PGM2. In lines 255-257 the group argue that deletion of TIF2 reduces PGM2 expression in response to LiCl accordingly to Montero-lomeli et al., 2002 but this data does not exist in this publication.

- Please recheck the references section of your work. Many references are lacking informations like journal name and/or DOI. In line 173 there is a reference missing from the list (Memarian et al., 2007). In line 191 the reference Bro et al., 2003 is actually Montero-Lomeli et al., 2003.

- No statistical analysis details are presented in the work. Although differences in data are clear, please indicate in the method section the type of test used in Figure 4 and perform statistical analysis for the rest of the data.

Minor concerns:

- It would be interesting if authors could present the result of non-treated cells on figure 3b to observe any effect of the deletions on the basal expression of PGM2 gene.

- Because of the way the quantitative growth experiment was performed, it is impossible to discern whether the effect of the deletion of YTA6 and YPR096C genes is increasing lethality (cytotoxicity) or decreasing growth rates (cytostatic effect). It would be interesting to discern between these effects performing some viability assays since the figure 2 result shows that overexpression of genes lead to a colony number higher than the WT strain, suggesting a decreased cytotoxicity.

- The term gene expression is usually used to address gene transcription, not so much for effect in translation. Although I do not consider the actual (in this manuscript) use of the term wrong, I suggest being more precise in describing the phenotypes observed, even in the title, and better establish that the hypothesis is that these genes (and lithium?) affect the process of translation.

- For better understanding, improve the description of the method for colony counting in the methods section.

- The housekeeping gene used to normalize qRT-PCR is always an issue, and I this case PGK1 was used. Is this a good housekeeping gene to this context? Have you tried others such as ACT1 or TAF10?

- Add references to the arguments in lines 41-42, 42-43, 265 (for TIF2 as control),348-349.

- Period between lines 47-52 is difficult to understand.

- Misspelling in lines 126 (Reference of krogan et al 2003); 227 (MasudA et al 2001); 245 – legend- PGM2 protein and mRNA content analysis

- Cite Tong et al., 2001 also in the methods section

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Claudio Akio Masuda

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Jul 8;15(7):e0235033. doi: 10.1371/journal.pone.0235033.r002

Author response to Decision Letter 0

5 Feb 2020

Responses to Editor and Reviewers comments

We would like to start by thanking Drs. AJ Lusting, CA Masuda and unanimous reviewer #1 for their invaluable time and comments to improve the quality of this manuscript.

Editor’s comments:

• As Reviewer 2 points out, LiCl also has an interaction in galactose metabolism, independent of toxicity. The consideration of galactose metabolism intermediates that are likely accumulate in yeast cells creating a large amount of phenotypes may be due to specific galactose-1-phosphate accumulation, already known as part of toxicity of galactosemia. Since there is a second pathway that has not been considered, discussion of that pathway is required. Add appropriate references.

Our response: The text is now modified accordingly.

• Testing of the alternative pathway per the suggestions of Reviewer 2 is required: 1) control experiments testing lithium toxicity in using media that use other carbon sources (e.g. glucose, glycerol, lactate, etc); 2) test the effect of the gal1 gene deletion on the growth tests of the mutant trains. Test the alternative hypothesis by suppression through deletion of YTA6 and YPR096C.

Our response: Both suggested experiments are now performed and the results are reported. Please refer to our answer to reviewer #2 major comment #1.

• Cell size as an assay of fitness is flawed since it could be due to a higher cell death rate or a slower growth rate. These paramaters need to be determined independently.

Our response: We agree with this comment. Although cell death and growth rate can both represent sensitivity, they do not signify the same parameter. In the current study, general cell sensitivity serves as a starting point for follow-up analyses. We feel the outcome of this experiment will not affect the conclusions of the current study.

• Present the results of non-treated cells.

Our response: The text is now modified accordingly (Fig 3).

• The PGM2 hairpin hypothesis requires more controls including testing a) the effect of the hairpin on translational assays and b) the absence of the hairpin on the suppression of the phenotype.

Our response: Suggested experiments are now performed. We now have a new b-gal construct with and without PGM2 hairpin. The results are shown in modified Figure 4 panels A and B.

• The authors need to clarify the potential of non-isogenicity on the nGI results.

Our response: We agree that such screens have inherent bias. Please refer to our answer to the same point raised by Reviewer #2, under major concerns, point 5. We have used a random plate to estimate the overall rate of GIs for a target gene in our hands. In this case we can drive more meaningful P-values. For clarity, the description of the control plate is modified.

• Statistical analysis requires a description in methods.

Our response: The text is now modified accordingly.

• Figure 6 is difficult to see (see the AE comments below).

Our response: The resolution is now improved.

• The major textual problem is the over-comparison with the use of Li in bi-polar disorder, as noted by Reviewer 1. This may be mentioned only briefly as it is peripheral to the actual study

Our response: The text is now modified accordingly.

• Reviewer 2 has more specialized knowledge essential for the interpretation of the data. Reviewer 1 focused on the presentation.

The AE reading of the manuscripts found numerous additional problem. First, Figures 1 and 7 show spot assays that are strips of data. The nature of the splicing is not mentioned in the text and it is unknown whether they are derived from one or more plate. The original data must be presented to the Reviewers for all of the data by the new PLOS One data presentation rules. Second, the other Figures would be assisted by a diagram of the assay shown in that Figure. Third, the statistical tests frequire exact n values and methods in the Figure Legends. Fourth, are the cells that are the origin of the quantitative cell counting independent colonies from independent cells?. If not, this must be repeated with colonies from independent cells that may require a larger sample size. Fifth, when data are non-statistically significant, they should not be shown in any Figure, including the supplement. Sixth, terms such as gene expression and protein translation are muddled. These need to be fixed. Seventh, the references are incomplete. Please correct carefully. Eighth, spelling errors detract from the coherent reading of the manuscript. The authors should have an independent individual unassociated with the paper read the manuscript for spelling and grammar.

Our response: The text is now modified accordingly. We have kept some of the non-statistically significant data, only when a comparison is needed. For example, growth under different conditions.

Reviewers’ Comments to the Author

Our response: The abstract and the text is modified accordingly.

Typos or errors:

l.82

Insert a space after his5.

l.130, l.166,

Capitalize c of Licl.

l.180-188

This section should be in the Introduction, and therefore should be removed.

l.191

TIF2 should be Italicized.

l.201

Insert a space between 10 and mM.

l.218 and Fig.1 and 7

Ypgal or YPgal (l.107)? Stick to the same nomenclature.

l.356

EAP1, not EAp1.

l.356

The legend mentions dhh1D but the corresponding strain is tif2D in the Fig.7. Which is correct?

Our response: The text is modified accordingly.

Reviewer #2:

Major concerns:

1- The authors argue that effects observed by LiCl treatment regards only lithium toxicity but, in fact, Masuda et al 2001,2008 demonstrated that there is a potent interaction of LiCl treatment and galactose metabolism. By blocking PGM2 activity with lithium, galactose metabolism intermediates accumulate in yeast cells and a large amount of phenotypes are due to specific galactose-1-phosphate accumulation, a molecule already known as part of toxicity of a genetic disease called classic galactosemia. We cannot exclude the hypothesis presented by the authors that lithium is (directly) inducing a protein translation problem, but at this point they cannot exclude that the translation problem is being induced by galactose-1-phosphate (or other intermediary metabolite of the galactose pathway) accumulation neither. No comment about the galactose-1-phosphate toxicity was presented in this manuscript. Because previous work has observed that most phenotypes under these condition can be suppressed by the galactokinase gene GAL1 deletion, authors should at least comment on the hypothesis, but preferably, test it. Suggestions for this test are: 1) control experiments testing lithium toxicity in other media containing other carbon sources (e.g. glucose, glycerol, lactate, etc); 2) test the effect of the gal1 gene deletion on the growth tests of the mutant trains. If the deletion of YTA6 and YPR096C can be completely suppressed by gal1 deletion, it would favor the hypothesis that the toxicity modulated by the presence of these genes is more related to galactose-1-phosphate accumulation than to lithium toxicity directly.

Our response: We completely agree with this comment. It is a big oversight from our end. We have now performed both suggested experiments. The results are shown in Figure 1D and Figure 4 A and B. In brief, we believe that the influence of LiCl on translation in through previously reported galactose metabolism. The text is modified accordingly. Considering this comment and the new data, the title of the manuscript is now modified.

2- In order to claim that the effect of the deletions of YTA6 and YPR096C on lithium/galactose toxicity is really due to the impact on PGM2 translation, I would suggest authors to: 1) test the actual PGM2 mRNA hairpin on the translational assays used in this work; 2) test the expression of a PGM2 gene allele without the hairpin – I would expect that this allele would suppress the effect of the deletions.

Our response: We now have a new b-gal reporter construct with and without PGM2 hairpin. The results are shown in new Figure 4A and B. Reduction of b-gal is linked to the presence of the PGM2 hairpin on the mRNA.

3- The quality of the presented figures is bad, some are almost impossible to visualize (especially figure 6), please increase quality for publication.

Our response: The manuscript is modified accordingly.

4- Usually, yeast spot growth assays are presented as one photograph of each plate containing all the strains that are to be compared. It makes the comparison of relative growth rate more straight-forward and convincing.

Our response: The new Figure 1 is modified accordingly.

5- The nGI screening present a bias as authors crossed the mutants yta6� and ypr0963c� to a called “gene expression library”, thus enhancing the chances of enrichment in protein biosynthesis interactions. So, I am not sure whether the enrichment of the class observed is a good indicator in this case. Also, since the screening was performed with a subset of the entire library, authors should list all the mutants included in the screening.

Our response: We agree with this comment. Although this type of enriched screening and its modified versions have been commonly used by us (e.g. Alamgir et al BMC Genomics, 2008; Samanfar et al Mol Biosyst, 2013; Gagarinova et al Cell Rep, 2016; etc) and others (e.g. Laribee et al 2007, PNAS; Collins et al Nature, 2007; Roguev et al Science, 2008; Zheng et al Mol Syst Biol, 2010; etc) they all have certain inherent bias associated with them. In our case we always use a random set of mutants (384 strains) as a control plate to estimate the overall rate of GIs for a target gene in our hands. In this case we can drive more meaningful P-values. For clarity, the description of the control plate is modified.

6- Some of the arguments used during the manuscript are missing references, and some are wrongly interpreted from the literature. For example, in the lines 35/36 authors argue that LiCl reduces PGM2 expression but Masuda et al 2001 shows that lithium treatment increases the mRNA levels of PGM2. In lines 255-257 the group argue that deletion of TIF2 reduces PGM2 expression in response to LiCl accordingly to Montero-lomeli et al., 2002 but this data does not exist in this publication.

Our response: The manuscript is modified accordingly.

7- Please recheck the references section of your work. Many references are lacking informations like journal name and/or DOI. In line 173 there is a reference missing from the list (Memarian et al., 2007). In line 191 the reference Bro et al., 2003 is actually Montero-Lomeli et al., 2003.

Our response: The manuscript is modified accordingly.

8- No statistical analysis details are presented in the work. Although differences in data are clear, please indicate in the method section the type of test used in Figure 4 and perform statistical analysis for the rest of the data.

Our response: The manuscript is modified accordingly.

Minor concerns:

- It would be interesting if authors could present the result of non-treated cells on figure 3b to observe any effect of the deletions on the basal expression of PGM2 gene.

Our response: The suggested experiment is performed and now included in Figure 3.

Our response: We agree with this comment. In the current study, general cell sensitivity serves as a starting point for follow-up analyses. We feel the outcome of this experiment will not affect the conclusions of the current study, but plan to include it in our future work. Also we discovered an issue with normalization of our overexpression genes in Figure 2; this is now corrected.

Our response: The manuscript is modified accordingly. The title is also modified.

- For better understanding, improve the description of the method for colony counting in the methods section.

Our response: The manuscript is modified accordingly.

- The housekeeping gene used to normalize qRT-PCR is always an issue, and I this case PGK1 was used. Is this a good housekeeping gene to this context? Have you tried others such as ACT1 or TAF10?

Our response: This is an interesting point. We have not used additional housekeeping genes but would be interesting to examine a second gene in future.

- Add references to the arguments in lines 41-42, 42-43, 265 (for TIF2 as control),348-349.

Our response: The manuscript is modified accordingly.

- Period between lines 47-52 is difficult to understand.

Our response: The manuscript is modified accordingly.

- Misspelling in lines 126 (Reference of krogan et al 2003); 227 (MasudA et al 2001); 245 – legend- PGM2 protein and mRNA content analysis

Our response: The manuscript is modified accordingly.

- Cite Tong et al., 2001 also in the methods section

Our response: The manuscript is modified accordingly.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(22KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0235033.r003

Decision Letter 1

Arthur J Lustig

3 Mar 2020

PONE-D-19-21480R1

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

PLOS ONE

Dear Dr. Golshani,

The AE agrees with the comments of Reviewers 1 and 2. In particular, Reviewer 2 provides a number of appropriate issues of confusion that results from both the manner of presentation and some bona fide confusion regarding the pathway involvement.
The AE finds that the manuscript needs to be written in a more accessible fashion and with greater clarity. These include methodological, logical and data presentation issues. In particular, in order of priority,
- The manuscript has a large number of grammatical mistakes;. in particular, the lack of use of articles ( e.g, "the"). This problem is present throughout the paper and compromises the ease of reading the manuscript. This is necessary to meet the standards for publication in PLOS. Please have an individual familiar with publication standards review your grammar.
- The methodology lacks sufficient clarity for reproduction. This includes an insufficient description of selection schemes, strain development, and design rationale.
  - Specific errors include the definition of NAT (it is not nourseothricin but, rather nourseothricin N-acetyl transferase).
  - How was the concentration of LiCl determined? What were the effects in different concentration of LiCl> and a clear relationship between context for which methods are involved in which experiments.
  - Is the statistical basis of the qPCR the MIQE convention? If not, please redo these evaluations according the this convention.
  - Define SDL.
  - Statistical tests should include the sets of values that are being compared (for example in Western blot analysis). Also place n value and statistical test in Figure Legends.
  - Please define the unconventional use of "fitness". Are you not referring to colony size?
  - Please describe the tests for the functionality of fusion proteins used in this study. Also clarify which experiments used and did not use the fusion protein.
  - The introduction of high copy number genes that complement nulls is not a test of complementation of the gene. Rather, re-integration of a single copy gene is needed to prove that the correct gene has been isolated in plasmids.
- Much of the data is presented graphically in Figures 2,3,4,5. An example of each dataset is required in these Figures. Similarly, a subset of the data interactions summarized in Figure 6 that have been uncovered in this paper should be presented. In addition, in a Supplementary Data section, by PLOS One regulations, all of the raw data must be presented so that the data is can be directly assessed.
- In the spot assays in Figure 1, are all the plates derived from the same microarray plate?
- The logic behind the interpretation of mutations in the presence of gal1 null alleles must be explained more clearly as noted by Reviewer 2.
- The argument for hairpin structure involvement is quite good. Why was the relationship to the growth sensitivity data not tested by conducting hairpin structure experiments in gal null alleles in a subset of experiments?
- The isolation of interacting genes in some ribosomal protein genes and regulators of translation implicates the translation process. However, conclusions the basis of these studies should be in line with the strength of the data.
- Eliminate the bipolar discussion in the Results. It is not relevant to this manuscript.
There are no conflicts between the Reviewers. Reviewer 1 is primarily concerned with presentation issues. Reviewer 2 is involved with scientific issues and mis-statements and the AE is examining the manuscript as an entirety. All of the issues must be addressed.

We would appreciate receiving your revised manuscript by Apr 17 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Arthur J. Lustig, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Further work is needed in presentation, sufficiency of data, control experiments, quality of methodology, and in experimental interpretation.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: As I pointed out in the previous review, the work has very little to do with BD. Furthermore, the results and discussion section should not contain lengthy explanation of the background information. From these reasons, I recommend to eliminate the section from l.174 to l.185.

Reviewer #2: The authors addressed most of the concerns raised in the first round of revision and the manuscript improved significantly. However, I still think there are a few point that should be corrected in order to make the manuscript ready for publication.

1) Abstract: “Reduced activity of phosphoglucomutase in the presence of galactose causes an accumulation of glucose-1-p leading to a number of phenotypes including growth defect.”

Glucose-1-phosphate is not the only metabolite accumulated under this condition. So, it is more accurate to say that “intermediate metabolites of galactose metabolism” accumulates.

And in work of other groups and ours, many of the phenotypes induced by PGM inhibition is mimicked by the deletion of the GAL7 gene. Because of that, we suggest that galactose-1-phosphate (not glucose-1-phosphate) may be the real culprit of these effects. (Reasoning: Galactose-1-phosphate is the only common metabolite downstream of galactokinase (GAL1) that accumulate in both PGM inhibition and GAL7 inhibition conditions)

2) Abstract: “In the current study we identify two understudied genes, YTA6 and YPR096C that when deleted increase cell sensitivity to LiCl treatment in yeast.”

Specify that the increased sensitivity to lithium is observed only in the presence of galactose.

3) Abstract: “…YTA6 and YPR096C exert their activities by influencing PGM2 at the level of translation.”

Suggest to highlight that the mRNA of PGM2 has a structured 5’ UTR to match the title.

4) “Lithium chloride (LiCl) has remained an important treatment option for BD for more than ten decades (2,3).”

Correct “ten decades”. The lithium use to treat neurological disorders started with the work of Dr. John Cade in 1949 and only “officially” accepted later on.

5) “Phosphoglucomutase is responsible for converting glucose-1-phosphate to glucose-6-phosphate.”

Suggestion: add here the information that lithium is an inhibitor of the enzymatic activity of PGM.

6) “When galactose is used as the carbon source, inhibition of phosphoglucomutase by LiCl results in accumulation of glucose-1-phosphate that in turn causes growth defects (11,12).”

Change glucose-1-phosphate to “galactose metabolites intermediates”.

7) “…be a rapid loss of ribosomal protein gene (RBG) pre-mRNAs”

RBG is not used afterwards.

8) “…LiCl reduces the activity of phosphoglucomutase enzyme leading to the accumulation of galactose-1-phosphate, a toxic intermediate in galactose metabolism.”

Suggestion to change for: … accumulation of intermediate metabolites from the galactose metabolism including galactose-1-phosphate, a toxic intermediate.

9) “we generated double gene deletions for YTA6 or YPR096C with GAL1 gene. Deletion of GAL1 gene relieved the sensitivity of gene deletion mutants for YTA6 or YPR096C to LiCl (Fig 1).”

There is no previous reference to the GAL1 gene, what enzyme it encodes and the reasoning behind the GAL1 deletion effect. This experiment needs more contextualization for a non-expert reader to understand these results.

10) “sensitivity of deletions strains for YTA6 or YPR096C to LiCl diminished when glucose was used as a carbon source further connecting the observed LiCl sensitivity for YTA6 and YPR096C deletion strains to galactose metabolism.”

According to the results presented (YPD + 10 mM LiCl), deletions of YTA6 and YPR096C does not cause ANY sensitivity to LiCl in the absence of galactose, not a DIMINISHED sensitivity to galactose.

That said, it would be interesting to check the effect of these deletions to toxic concentrations of LiCl in YPD (100 - 300 mM range). This experiment could either unmask a possible direct effect of lithium independent of galactose metabolism, or further emphasize that the increased sensitivity of these strains to lithium is dependent on its effect on galactose metabolism.

11) Figures 4 and 5 – Because both figures address the same general question (effect of YTA6 and YPR096C deletion on translation efficiency of mRNAs containing structures), I suggest to either join figures 4 and 5, or transfer the figures 4C and D to figure 5 to isolate on Figure 4 the discussion about PGM2 mRNA.

12) Since the nGI and PSA screenings were performed with a subset of the entire Yeast KO library, authors should list all the mutants included in the screenings and identify the groups (gene expression / random groups).

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Claudio A Masuda

PLoS One. 2020 Jul 8;15(7):e0235033. doi: 10.1371/journal.pone.0235033.r004

Author response to Decision Letter 1

4 Apr 2020

Responses to Editor and Reviewers comments

We would like to start by thanking Drs. AJ Lusting, CA Masuda and the unanimous reviewer #1 for their invaluable time and comments to improve the quality of this manuscript.

Editor’s comments:

• The manuscript has a large number of grammatical mistakes; in particular, the lack of use of articles (e.g, "the"). This problem is present throughout the paper and compromises the ease of reading the manuscript. This is necessary to meet the standards for publication in PLOS. Please have an individual familiar with publication standards review your grammar.

Our response: The text is now modified accordingly.

• Specific errors include the definition of NAT (it is not nourseothricin but, rather nourseothricin N-acetyl transferase).

Our response: NAT is now replaced by clonNAT (nourseothricin sulfate).

• How was the concentration of LiCl determined? What were the effects in different concentration of LiCl> and a clear relationship between context for which methods are involved in which experiments.

Our response: Proper references are now included for the starting concentrations of LiCl. Additional explanation is also provided. Description is added for each method connecting it to the corresponding experiment.

• Is the statistical basis of the qPCR the MIQE convention? If not, please redo these evaluations according the this convention.

Our response: Yes, it is. The text is now modified to reflect this.

• Define SDL.

Our response: “SDL” is now removed from the text.

• Statistical tests should include the sets of values that are being compared (for example in Western blot analysis). Also place n value and statistical test in Figure Legends.

Our response: The text is now modified accordingly.

• Please define the unconventional use of "fitness". Are you not referring to colony size?

Our response: A description is now added in the Materials and methods section. In Genetic Interaction analysis, colony size is commonly used as a measure of fitness. For example: Tong et al 2001 Science; Toufighi et al 2011 Nature Methods; Roguev et al 2018 Cold Spring Harb Protoc; etc.

• Please describe the tests for the functionality of fusion proteins used in this study. Also clarify which experiments used and did not use the fusion protein.

Our response: PCR analysis and LiCl sensitivity was used to confirm the integrity of Pgm2p-GFP strain. The Material and methods section is modified accordingly.

• The introduction of high copy number genes that complement nulls is not a test of complementation of the gene. Rather, re-integration of a single copy gene is needed to prove that the correct gene has been isolated in plasmids.

Our response: The text is now modified accordingly.

• Much of the data is presented graphically in Figures 2,3,4,5. An example of each dataset is required in these Figures. Similarly, a subset of the data interactions summarized in Figure 6 that have been uncovered in this paper should be presented. In addition, in a Supplementary Data section, by PLOS One regulations, all of the raw data must be presented so that the data is can be directly assessed.

Our response: An example for each data set is now added. Negative genetic interaction data is now represented in Table S3. An inset for Figure 4A is now included. An inset for Figure 6 is now included.

• In the spot assays in Figure 1, are all the plates derived from the same microarray plate?

Our response: Yes, each set is spotted on the same plate and grown under the same conditions.

• The logic behind the interpretation of mutations in the presence of gal1 null alleles must be explained more clearly as noted by Reviewer 2.

Our response: The text is now modified accordingly.

• The argument for hairpin structure involvement is quite good. Why was the relationship to the growth sensitivity data not tested by conducting hairpin structure experiments in gal null alleles in a subset of experiments?

Our response: Gal1 deletion analysis was to study the function of YTA6 and YPR096C in the context of LiCl mode of toxicity. It was performed to functionally link sensitivity of YTA6 and YPR096C to the accumulation of toxic intermediate when galactose was used as a carbon source. This is in contrast to other experiments that were mainly concerned with the expression and translatability of mRNAs. For example, β-galactosidase activity analyses derived from the constructs that carry different hairpin structures on their 5’-UTRs, including that for PGM2, are independent of GAL1 function. They focus on the ability of mutant strains to translate β-galactosidase mRNAs that contain hairpin structures. Similarly, the RNA (qRT-PCR) and protein (western) content analyses were focused on the expression of PGM2 and not its function. Deletion of GAL1 is expected to have no consequence in the outcome of these experiments and would not change the conclusion of the study about translation of structured mRNAs.

• The isolation of interacting genes in some ribosomal protein genes and regulators of translation implicates the translation process. However, conclusions the basis of these studies should be in line with the strength of the data.

Our response: The text is now modified to reduce the strength of the concluding sentence regarding GI data.

• Eliminate the bipolar discussion in the Results. It is not relevant to this manuscript.

Our response: The text is now modified accordingly.

Reviewers’ Comments to the Author

Reviewer #1:

1- As I pointed out in the previous review, the work has very little to do with BD. Furthermore, the results and discussion section should not contain lengthy explanation of the background information. From these reasons, I recommend to eliminate the section from l.174 to l.185.

Our response: The text is now modified accordingly.

Reviewer #2:

1- Abstract: “Reduced activity of phosphoglucomutase in the presence of galactose causes an accumulation of glucose-1-p leading to a number of phenotypes including growth defect.”

Glucose-1-phosphate is not the only metabolite accumulated under this condition. So, it is more accurate to say that “intermediate metabolites of galactose metabolism” accumulates.

Our response: The text is now modified accordingly.

2- Abstract: “In the current study we identify two understudied genes, YTA6 and YPR096C that when deleted increase cell sensitivity to LiCl treatment in yeast.”

Specify that the increased sensitivity to lithium is observed only in the presence of galactose.

Our response: The text is now modified accordingly.

3- Abstract: “…YTA6 and YPR096C exert their activities by influencing PGM2 at the level of translation.”

Suggest to highlight that the mRNA of PGM2 has a structured 5’ UTR to match the title.

Our response: The text is now modified accordingly.

4- “Lithium chloride (LiCl) has remained an important treatment option for BD for more than ten decades (2,3).”

Correct “ten decades”. The lithium use to treat neurological disorders started with the work of Dr. John Cade in 1949 and only “officially” accepted later on.

Our response: The text is now modified accordingly.

5- “Phosphoglucomutase is responsible for converting glucose-1-phosphate to glucose-6-phosphate.”

Suggestion: add here the information that lithium is an inhibitor of the enzymatic activity of PGM.

Our response: The text is now modified accordingly.

6- “When galactose is used as the carbon source, inhibition of phosphoglucomutase by LiCl results in accumulation of glucose-1-phosphate that in turn causes growth defects (11,12).”

Change glucose-1-phosphate to “galactose metabolites intermediates”.

Our response: The text is now modified accordingly.

7- “…be a rapid loss of ribosomal protein gene (RBG) pre-mRNAs”

RBG is not used afterwards.

Our response: The text is now modified accordingly.

8- “…LiCl reduces the activity of phosphoglucomutase enzyme leading to the accumulation of galactose-1-phosphate, a toxic intermediate in galactose metabolism.”

Suggestion to change for: … accumulation of intermediate metabolites from the galactose metabolism including galactose-1-phosphate, a toxic intermediate.

Our response: The text is now modified accordingly.

9- “we generated double gene deletions for YTA6 or YPR096C with GAL1 gene. Deletion of GAL1 gene relieved the sensitivity of gene deletion mutants for YTA6 or YPR096C to LiCl (Fig 1).”

Our response: The text is now modified accordingly. Relative explanation has been added.

10- “sensitivity of deletions strains for YTA6 or YPR096C to LiCl diminished when glucose was used as a carbon source further connecting the observed LiCl sensitivity for YTA6 and YPR096C deletion strains to galactose metabolism.”

According to the results presented (YPD + 10 mM LiCl), deletions of YTA6 and YPR096C does not cause ANY sensitivity to LiCl in the absence of galactose, not a DIMINISHED sensitivity to galactose.

Our response: The text is now modified accordingly. Also, we subjected the yeast gene deletion strains for YTA6 or YPR096C to 100 mM of LiCl in YPD and observed no increased sensitivity for these mutants in comparison to a control strain. This observation is now reported in the text and the results are shown in Fig S1.

11- Figures 4 and 5 – Because both figures address the same general question (effect of YTA6 and YPR096C deletion on translation efficiency of mRNAs containing structures), I suggest to either join figures 4 and 5, or transfer the figures 4C and D to figure 5 to isolate on Figure 4 the discussion about PGM2 mRNA.

Our response: New figures are modified accordingly. The new figure 5 now includes the old figure 4C and 4D panels.

12- Since the nGI and PSA screenings were performed with a subset of the entire Yeast KO library, authors should list all the mutants included in the screenings and identify the groups (gene expression / random groups).

Our response: The list has been added to the supporting information.

Attachment

Submitted filename: Responses to Editor and Reviewers.docx

Click here for additional data file.^{(21.4KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0235033.r005

Decision Letter 2

Arthur J Lustig

23 Apr 2020

PONE-D-19-21480R2

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

PLOS ONE

Dear Dr. Golshani,

Three major issues remain
- First, please provide the alternative interpretation of the data expressed by Reviewer 2 or a rebuttal of that viewpoint.
- Second, the AE question regarding the failure to integrate a single copy of the gene to show complementation was not fully addressed. What is the evidence that the expected gene has been cloned?
- Third, while the images are quite good, the pdf is present at limiting resolution. Be certain that you increase the resolution of the figures and possibly the size of the lane designations so that they will be easily visible in the final version.
- Fourth, while the authors have addressed most of the issues, the answers to the AE's critique do not specify where in the text (line numbers) specific changes have been made. In the absence of this information, which by convention should be provided by the authors, the AE is forced to go through multiple re-reads to verify that each point has indeed been addressed. The AE requests that this detail be provided to ensure that every question has been answered.
- Fifth, please address the additional textual issues raised by Reviewer 2.
There are no significant differences between the reviewers.
The authors have dealt with each of the issues, although the AE requires more specification of where in the text specific changes have been made. In addition, the issue of the proper identification of the gene that is overproduced must be addressed.

We would appreciate receiving your revised manuscript by Jun 07 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Arthur J. Lustig, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

Several issues remain that must be addressed.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: (No Response)

Reviewer #2: The authors addressed most of the comments. A few minor changes are still suggested.

Minor suggestions:

line 219: "In yeast, galactose-1-phosphate is encoded by the GAL1 gene."

Correct to galactokinase is encoded by the GAL1 gene.

lines 363-365: "The fact that YTA6 and YPR096C compensated the same two gene deletions, further connects their activities together in the context of LiCl sensitivity."

Although this conclusion is possible (and should be kept in the manuscript), another possibility is that the overexpression of YTA6 and YPR096C would improve PGM2 translation, leading to an increase in PGM2 activity in cells that was shown to confer resistance to lithium in galactose medium (Masuda et al., 2001). According to this hypothesis, if the main cause of toxicity under these conditions is the decrease in PGM activity, the overexpression of YTA6 and YPR096C would be "solving" the original problem and thus making any yeast strain more tolerant to lithium, not only those with related function in the cell.

Since at this point we cannot discern between the two hypothesis, I think authors should discuss both possibilities.

line 418: reference # 11.

The citation format for this reference is wrong. Please correct this one, and check carefully for other mistakes in the reference section.

Figures quality: Still the quality of the figures presented in this PDF is low, especially Figure 5 that even if we amplify in a PDF reader, some legends are not readable. Possible that this is a problem of conversion to PDF, but be careful when submitting the final versions of the figure to assure readability in the final version of the manuscript.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Claudio A Masuda

PLoS One. 2020 Jul 8;15(7):e0235033. doi: 10.1371/journal.pone.0235033.r006

Author response to Decision Letter 2

2 Jun 2020

We would like to start by once again thanking Drs. AJ Lusting, CA Masuda and the unanimous reviewer #1 for their invaluable time and comments to improve the quality of this manuscript.

Editor’s comments:

1- First, please provide the alternative interpretation of the data expressed by Reviewer 2 or a rebuttal of that viewpoint.

Our response: The suggested alternative explanation is now included in the text. Lines 372-377.

2- Second, the AE question regarding the failure to integrate a single copy of the gene to show complementation was not fully addressed. What is the evidence that the expected gene has been cloned?

Our response: Discussion of complementation is now removed from the text and replaced by reporting the phenotypic observations after the introduction of the over-expression plasmid into the corresponding gene deletion mutants. These plasmids were purchased from Thermofisher and their integrity was confirmed by PCR analysis. Lines 81, 82, 195-197, 202 and 203.

3- Third, while the images are quite good, the pdf is present at limiting resolution. Be certain that you increase the resolution of the figures and possibly the size of the lane designations so that they will be easily visible in the final version.

Our response: Resolution of all figures is now increased.

4- Fourth, while the authors have addressed most of the issues, the answers to the AE's critique do not specify where in the text (line numbers) specific changes have been made. In the absence of this information, which by convention should be provided by the authors, the AE is forced to go through multiple re-reads to verify that each point has indeed been addressed. The AE requests that this detail be provided to ensure that every question has been answered.

Corresponding Associate Editor’s comments from the previous round:

• Specific errors include the definition of NAT (it is not nourseothricin but, rather nourseothricin N-acetyl transferase).

Our response: NAT is now replaced by clonNAT (nourseothricin sulfate). Line 89.

• Is the statistical basis of the qPCR the MIQE convention? If not, please redo these evaluations according the this convention.

Our response: Yes, it is. The text is now modified to reflect this. Line 137.

• Define SDL.

Our response: The text is now modified accordingly. SDL is removed from line 165 as this form of genetic interaction is not included in the manuscript.

• Statistical tests should include the sets of values that are being compared (for example in Western blot analysis). Also place n value and statistical test in Figure Legends.

Our response: The text is now modified accordingly. Lines 211, 215, 217, 219, 256-258, 276-280, 301-305, 354-355, and 387-388.

• Please define the unconventional use of "fitness". Are you not referring to colony size?

• Please describe the tests for the functionality of fusion proteins used in this study. Also clarify which experiments used and did not use the fusion protein.

Our response: PCR analysis and LiCl sensitivity was used to confirm the integrity of Pgm2p-GFP strain. The Material and methods section is modified accordingly. Lines 82-85.

Our response: Supporting information for each data set is added. An example of each dataset is added to each figure in lines 215, 277, 302 and 355. Table S1, S2 and S3 in lines 544-553 are added as supporting information data and are mentioned in the manuscript in lines 322, 325, 326, and 330. Figure 6, a representative interaction is now included; also see line 355.

• The logic behind the interpretation of mutations in the presence of gal1 null alleles must be explained more clearly as noted by Reviewer 2.

Our response: The text is now modified accordingly. Lines 221-222.

Our response: The text is now modified to reduce the strength of the concluding sentence regarding GI data. Lines 347-349.

Reviewer #2:

1- line 219: "In yeast, galactose-1-phosphate is encoded by the GAL1 gene."Correct to galactokinase is encoded by the GAL1 gene.

Our response: The text is now modified accordingly. Line 222.

2- lines 363-365: "The fact that YTA6 and YPR096C compensated the same two gene deletions, further connects their activities together in the context of LiCl sensitivity."

under these conditions is the decrease in PGM activity, the overexpression of YTA6 and YPR096C would be "solving" the original problem and thus making any yeast strain more tolerant to lithium, not only those with related function in the cell.

Since at this point we cannot discern between the two hypothesis, I think authors should discuss both possibilities.

Our response: The text is now modified accordingly. Added to manuscript from lines 369-375.

3- line 418: reference # 11.The citation format for this reference is wrong. Please correct this one, and check carefully for other mistakes in the reference.

Our response: The text is now modified accordingly.

4- Figures quality: Still the quality of the figures presented in this PDF is low, especially Figure 5 that even if we amplify in a PDF reader, some legends are not readable. Possible that this is a problem of conversion to PDF, but be careful when submittingthe final versions of the figure to assure readability in the final version of the manuscript.

Our response: Resolution of all figures is now increased.

Attachment

Submitted filename: Responses to Editor and Reviewers comments.docx

Click here for additional data file.^{(20.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0235033.r007

Decision Letter 3

Arthur J Lustig

9 Jun 2020

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

PONE-D-19-21480R3

Dear Dr. Golshani,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Arthur J. Lustig, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: (No Response)

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: (No Response)

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: (No Response)

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: (No Response)

**********

6. Review Comments to the Author

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: Yes: Claudio A Masuda

PLoS One. doi: 10.1371/journal.pone.0235033.r008

Acceptance letter

Arthur J Lustig

12 Jun 2020

PONE-D-19-21480R3

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

Dear Dr. Golshani:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Arthur J. Lustig

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Drug sensitivity analysis for different yeast strains on YPD media.

(TIF)

Click here for additional data file.^{(331KB, tif)}

S2 Fig. The secondary structure of PGM2 5’-UTR.

Unlike most yeast ORFs, the 5’ UTR of PGM2 is thought to be structured (38).

(TIF)

Click here for additional data file.^{(349.4KB, tif)}

S1 Table. qRT-PCR raw data for different strains with and without LiCl treatment.

Each experiment was repeated at least three times (n ≥ 3).

(DOCX)

Click here for additional data file.^{(28KB, docx)}

S2 Table. List of mutant strains in gene expression and random arrays.

(DOCX)

Click here for additional data file.^{(60.1KB, docx)}

S3 Table. List of negative genetic interactions (nGIs) for YTA6 and YPR096C (no LiCl in media).

(DOCX)

Click here for additional data file.^{(21.5KB, docx)}

S1 Raw Images

(PDF)

Click here for additional data file.^{(184.3KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(22KB, docx)}

Attachment

Submitted filename: Responses to Editor and Reviewers.docx

Click here for additional data file.^{(21.4KB, docx)}

Attachment

Submitted filename: Responses to Editor and Reviewers comments.docx

Click here for additional data file.^{(20.5KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0235033.ref001] 1.Lenox RH, Wang L. Molecular basis of lithium action: integration of lithium-responsive signaling and gene expression networks. Mol Psychiatry. 2003;8:135–44. 10.1038/sj.mp.4001306 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref002] 2.Won E, Kim Y. An Oldie but Goodie: Lithium in the Treatment of Bipolar Disorder through Neuroprotective and Neurotrophic Mechanisms. Int J Mol Sci. 2017;18(12):2679. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref003] 3.Fornaro M, Berardis D De, Anastasia A, Novello S, Fusco A, Ignazio C, et al. The identification of biomarkers predicting acute and maintenance lithium treatment response in bipolar disorder: A plea for further research attention. Psychiatry Res. 2018;269:658–72. 10.1016/j.psychres.2018.08.034 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref004] 4.Ariyasinghe D, Perera SR. The role of lithium in the treatment of bipolar disorder. Sri Lanka J Psychiatry. 2018;28–30. [Google Scholar]

[pone.0235033.ref005] 5.Yang D, Song L, Hu J, Yin W, Li Z, Chen Y, et al. Biochemical and Biophysical Research Communications Enhanced tolerance to NaCl and LiCl stresses by over-expressing Caragana korshinskii sodium / proton exchanger 1 (CkNHX1) and the hydrophilic C terminus is required for the activity of CkNHX1 in Atsos3. Biochem Biophys Res Commun. 2012;417(2):732–7. 10.1016/j.bbrc.2011.12.023 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref006] 6.Sofola-adesakin O, Castillo-quan J., Rallis C, Tain L., Bjedov I, Rogers I, et al. Lithium suppresses A β pathology by inhibiting translation in an adult Drosophila model of Alzheimer ‘ s disease. Front Aging Neurosci. 2014;6(July):1–10. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref007] 7.Castillo-Quan J., Li L, Kinghorn K., Hardy J, Bjedov I, Partridge L. Lithium Promotes Longevity through GSK3 / NRF2- Dependent Hormesis Lithium Promotes Longevity. Cell Rep. 2016;15:638–50. 10.1016/j.celrep.2016.03.041 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref008] 8.Williams RS., Harwood A. Lithium therapy and signal transduction. Trends Pharmacol Sci. 2000;21(2):61–4. 10.1016/s0165-6147(99)01428-5 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref009] 9.Montero-Lomelí M, Morais BLB, Figueiredo DL, Neto DCS, Martins JRP, Masuda CA. The initiation factor eIF4A is involved in the response to lithium stress in Saccharomyces cerevisiae. J Biol Chem. 2002;277(24):21542–8. 10.1074/jbc.M201977200 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref010] 10.Bro C, Regenberg B, Lagniel G, Labarre J, Montero-Lomelí M, Nielsen J. Transcriptional, proteomic, and metabolic responses to lithium in galactose-grown yeast cells. J Biol Chem. 2003;278(34):32141–9. 10.1074/jbc.M304478200 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref011] 11.Masuda CA, Xavier MA, Mattos KA, Galina A, Montero-Lomeli M. Phosphoglucomutase Is an in Vivo Lithium Target in Yeast. Biol Chem. 2001;276:37794–801. [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref012] 12.Liu J., Zhang GC, Kong I., Yun E., Zheng J., Kweon D., et al. A mutation in PGM2 causing inefficient Galactose metabolism in the Probiotic Yeast Saccharomyces boulardii. Appl enviromental Microbiol. 2018;84(10):1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref013] 13.Dichtl B, Stevens A, Tollervey D. Lithium toxicity in yeast is due to the inhibition of RNA processing enzymes. EMBO J. 1997;16(23):7184–95. 10.1093/emboj/16.23.7184 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref014] 14.Bergkessel M, Whitworth G., Guthrie C. Diverse environmental stresses elicit distinct responses at the level of pre-mRNA processing in yeast. RNA. 2011;17:1461–78. 10.1261/rna.2754011 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref015] 15.Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B, et al. Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis. Science (80-). 1999;285(5429):901–7. [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref016] 16.Gelperin DM, White MA, Wilkinson ML, Kon Y, Kung LA, Wise KJ, et al. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes Dev. 2005;2816–26. 10.1101/gad.1362105 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref017] 17.Moteshareie H, Hajikarimlou M, Indrayanti AM, Burnside D, Paula A, Id D, et al. Heavy metal sensitivities of gene deletion strains for ITT1 and RPS1A connect their activities to the expression of URE2, a key gene involved in metal detoxification in yeast. Plose one. 2018;13:1–18. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref018] 18.Jessulat M, Malty RH, Nguyen-tran D, Deineko V, Aoki H, Vlasblom J, et al. Spindle Checkpoint Factors Bub1 and Bub2 Promote DNA DoubleStrand Break Repair by Nonhomologous End Joining. mcb. 2015;35(14):2448–63. 10.1128/MCB.00007-15 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref019] 19.Alamgir M, Jessulat M, Azizi A, Golshani A. Chemical-genetic profile analysis of five inhibitory compounds in yeast. bmc Chem Biol. 2010;10(6). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref020] 20.Samanfar B, Omidi K, Hooshyar M, Laliberte B, Alamgir M, Seal AJ, et al. Large-scale investigation of oxygen response mutants in Saccharomyces cerevisiae. Mol Biosyst. 2013;9(6):1351–9. 10.1039/c3mb25516f [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref021] 21.Karlsson-rosenthal C, Millar JBA. Cdc25: mechanisms of checkpoint inhibition and recovery. Trends Cell Biol. 2006;16(6). [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref022] 22.Altmann M, Müller P., Wittmer B, Ruchti F, Lanker S, Trachsel H. A Saccharomyces cerevisiae homologue of mammalian translation initiation factor 4B contributes to RNA helicase activity. EMBO J. 1993;12(10):3997–4003. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref023] 23.Stansfield I, Akhmaloka M, Tuite F. A mutant allele of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows temperature-dependent aUosuppressor and omnipotent suppressor phenotypes. Curr Genet. 1995;27:417–26. 10.1007/BF00311210 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref024] 24.Krogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V, et al. Methylation of Histone H3 by Set2 in Saccharomyces cerevisiae Is Linked to Transcriptional Elongation by RNA Polymerase II. mcb. 2003;23(12):4207–18. 10.1128/mcb.23.12.4207-4218.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref025] 25.Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22. 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref026] 26.Szymanski EP, Kerscher O. Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications. J Vis Exp. 2013;80(October):1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref027] 27.Tong A, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, et al. Systematic Genetic Analysis with Ordered Arrays of Yeast Deletion Mutants. Science (80-). 2001;294(December):2364–9. [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref028] 28.Toufighi K, Youn J, Ou J, Luis BS, Hibbs M, Hess D, et al. Quantitative analysis of fitness and genetic interactions in yeast on a genome scale. Nat Methods. 2011;7(12):1017–24. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref029] 29.Wagih O, Usaj M, Baryshnikova A, Vandersluis B, Kuzmin E, Costanzo M, et al. SGAtools: one-stop analysis and visualization of array-based genetic interaction screens. Nucleic Acids Res. 2013;41(May):591–6. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref030] 30.Memarian N, Jessulat M, Alirezaie J, Mir-Rashed N, Xu J, Zareie M, et al. Colony size measurement of the yeast gene deletion strains for functional genomics. BMC Bioinformatics. 2007;8(117). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref031] 31.Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K, et al. Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell. 2006;21:319–30. 10.1016/j.molcel.2005.12.011 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref032] 32.Douglas AC, Smith AM, Sharifpoor S, Yan Z, Durbic T, Heisler LE, et al. Functional Analysis With a Barcoder Yeast Gene Overexpression System. G3 Genes|Genomes|Genetics. 2012;2(10):1279–89. 10.1534/g3.112.003400 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref033] 33.Samanfar B, Shostak K, Moteshareie H, Hajikarimlou M, Shaikho S, Omidi K, et al. The sensitivity of the yeast, Saccharomyces cerevisiae, to acetic acid is influenced by DOM34 and RPL36A. PeerJ. 2017;2017(11). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref034] 34.Samanfar B, Tan LH, Shostak K, Chalabian F, Wu Z, Alamgir M, et al. A global investigation of gene deletion strains that affect premature stop codon bypass in yeast, Saccharomyces cerevisiae. Mol Biosyst. 2014;10(4):916–24. 10.1039/c3mb70501c [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref035] 35.Omidi K, Jessulat M, Hooshyar M, Burnside D, Schoenrock A, Kazmirchuk T, et al. Uncharacterized ORF HUR1 influences the efficiency of non-homologous end-joining repair in Saccharomyces cerevisiae. Gene. 2018;639:128–36. 10.1016/j.gene.2017.10.003 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref036] 36.Phiel CJ, Klein PS. Molecular Targets of Lithium Action. Annu Rev Pharmacol Toxicol. 2001;41:789–813. 10.1146/annurev.pharmtox.41.1.789 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref037] 37.Nagalakshmi U, Wang Z, Waern K, Shou C, Raha D, Gerstein M, et al. The Transcriptional Landscape of the Yeast Genome Defined by RNA Sequencing. Science (80-). 2008;320(June):1344–50. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref038] 38.Tuller T, Ruppin E, Kupiec M. Properties of untranslated regions of the S. cerevisiae genome. BMC Genomics. 2009;10(391). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref039] 39.Cuperus JT, Groves B, Kuchina A, Rosenberg AB, Jojic N, Fields S, et al. Deep learning of the regulatory grammar of yeast 5 ′ untranslated regions from 500, 000 random sequences. Genome Res. 2017;27:2015–24. 10.1101/gr.224964.117 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref040] 40.Bolinger C, Sharma A, Singh D, Yu L. RNA helicase A modulates translation of HIV-1 and infectivity of progeny virions. Nucleic Acids Res. 2010;38(5):1686–96. 10.1093/nar/gkp1075 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref041] 41.Washietl S, Hofacker IL, Lukasser M, Hüttenhofer A, Stadler PF. Mapping of conserved RNA secondary structures predicts thousands of functional noncoding RNAs in the human genome. Nat Biotechnol. 2005;23(11):1383–90. 10.1038/nbt1144 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref042] 42.Omidi K, Hooshyar M, Jessulat M, Samanfar B, Sanders M, Burnside D, et al. Phosphatase Complex Pph3 / Psy2 Is Involved in Regulation of Efficient Non-Homologous End-Joining Pathway in the Yeast Saccharomyces cerevisiae. Plose one. 2014;9(1). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref043] 43.Hendry JA, Tan G, Ou J, Boone C, Brown GW. Leveraging DNA Damage Response Signaling to Identify Yeast Genes Controlling Genome Stability. G3 Genes|Genomes|Genetics. 2015;5(May):997–1006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref044] 44.Ooi SL, Pan X, Peyser BD, Ye P, Meluh PB, Yuan DS, et al. Global synthetic-lethality analysis and yeast functional profiling. Trends Genet. 2006;22(1):56–63. 10.1016/j.tig.2005.11.003 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref045] 45.Boone C, Bussey H, Andrews BJ. Exploring genetic interactions and networks with yeast. Nat Rev Genet. 2007;8(6):437–49. 10.1038/nrg2085 [DOI] [PubMed] [Google Scholar]

[pone.0235033.ref046] 46.Li X, Ohmori T, Irie K, Kimura Y, Suda Y, Mizuno T, et al. Different Regulations of ROM2 and LRG1 Expression by Ccr4, Pop2, and Dhh1 in the Saccharomyces cerevisiae Cell Wall Integrity Pathway. mSphere. 2016;1(5). [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref047] 47.Castelli LM, Lui J, Campbell SG, Rowe W, Zeef LAH, Holmes LEA, et al. Glucose depletion inhibits translation initiation via eIF4A loss and subsequent 48S preinitiation complex accumulation, while the pentose phosphate pathway is coordinately up-regulated. Mol Biol Cell. 2011;22(15):3379–93. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref048] 48.Blewett NH, Goldstrohm AC. A Eukaryotic Translation Initiation Factor 4E-Binding Protein Promotes mRNA Decapping and Is Required for PUF Repression. mcb. 2012;32(20):4181–94. 10.1128/MCB.00483-12 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref049] 49.Fischer N, Weis K. The DEAD box protein Dhh1 stimulates the decapping enzyme Dcp1. EMBO J. 2002;21(11):2788–97. 10.1093/emboj/21.11.2788 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0235033.ref050] 50.Carroll JS, Munchel SE, Weis K. The DExD/H box ATPase Dhh1 functions in translational repression, mRNA decay, and processing body dynamics. cell Biol. 2011;194(4):527–37. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs

Maryam Hajikarimlou

Houman Moteshareie

Katayoun Omidi

Mohsen Hooshyar

Sarah Shaikho

Tom Kazmirchuk

Daniel Burnside

Sarah Takallou

Narges Zare

Sasi Kumar Jagadeesan

Nathalie Puchacz

Mohan Babu

Myron Smith

Martin Holcik

Bahram Samanfar

Ashkan Golshani

Roles

Abstract

Introduction

Materials and methods

Strains, plasmids, gene collections and cell and DNA manipulations

Drug sensitivity analysis

Quantitative β-galactosidase assay

Quantitative real time PCR (qRT-PCR)

Western blot analysis

Genetic interaction analysis

Genetic interaction data analysis

Results and discussion

Deletion of YTA6 and YPR096C increases yeast sensitivity to lithium

Fig 1. Drug sensitivity analysis for different yeast strains using spot test assay.

Fig 2. Quantitative analysis of drug sensitivity for different yeast strains.

YTA6 and YPR096C regulate the expression of PGM2 at the level of translation

Fig 3. Protein and mRNA content analysis.

Translation of β-galactosidase reporter mRNA with a hairpin structure is altered by the deletion of YTA6 and YPR096C

Fig 4. β-galactosidase expression analysis in different yeast strains.

Fig 5. Normalized β-galactosidase activity is lower in yta6Δ and ypr096cΔ for structured mRNAs.

Genetic interaction analysis further connects the activity of YTA6 and YPR096C to the protein biosynthesis pathway

Fig 6. Conditional nGIs for YTA6 and YPR096C in the presences of 3 mM concentration of LiCl.

Fig 7. Over-expression of YTA6 and YPR096C compensate for the sensitivity of eap1Δ and bck1Δ to 10 mM LiCl.

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Arthur J Lustig

Roles

Author response to Decision Letter 0

Decision Letter 1

Arthur J Lustig

Roles

Author response to Decision Letter 1

Decision Letter 2

Arthur J Lustig

Roles

Author response to Decision Letter 2

Decision Letter 3

Arthur J Lustig

Roles

Acceptance letter

Arthur J Lustig

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases