Skip to main content
BMC Veterinary Research logoLink to BMC Veterinary Research
. 2020 Jul 9;16:235. doi: 10.1186/s12917-020-02452-x

Molecular detection of Bartonella in ixodid ticks collected from yaks and plateau pikas (Ochotona curzoniae) in Shiqu County, China

Lili Hao 1, Dongbo Yuan 2, Li Guo 3, Wei Hou 2, Xi Mo 2, Jie Yin 2, Aiguo Yang 2, Rui Li 4,
PMCID: PMC7346470  PMID: 32646425

Abstract

Background

Bartonella bacteria have been associated with an increasingly wide range of human and animal diseases. These emerging pathogens have been identified as being globally dispersed. Ticks and small rodents are known hosts of Bartonella and play a significant role in the preservation and circulation of Bartonella in nature. This study investigated the occurrence of hoist spp. in ticks (Acari: Ixodidae) and plateau pikas (Ochotona curzoniae) in Shiqu County, which is located on the eastern Qinghai-Tibetan Plateau in China. Shiqu County is spread over approximately 26,000 km2, with an average altitude of above 4200 m and a vast area of pastureland.

Results

A total of 818 ticks (Dermacentor everestianus, 79.0%, 646/818; Haemaphysalis qinghaiensis, 21.0%, 172/818) were collected from yaks in 4 villages of Shiqu County. Only Bartonella melophagi was detected in tick samples, with a total prevalence of 30.1% (246/818). The infection rates of B. melophagi in ticks from Arizha, Maga, Derongma, and Changxgma were 4.8, 76.8, 12.5, and 18.0%, respectively. The infection rate of B. melophagi in Maga was higher (p < 0.01) than those in other villages. Regarding plateau pikas, the total infection rate of Bartonella spp. was 21.7% (62/286), with 16.7% (12/72), 30.9% (25/81), 13.8% (9/65), and 23.5% (16/68) in Arizha, Maga, Derongma, and Changxgma, respectively. Finally, B. queenslandensis and B. grahamii were detected in plateau pika. No significant difference was observed (p > 0.05) in the infection rates between these study sites.

Conclusion

To date, only D. everestianus and H. qinghaiensis were found in Shiqu County with high infection of Bartonella spp. in the ticks and plateau pika. The threats of Bartonella species to public health should be closely monitored.

Keywords: Bartonella, Ticks, Plateau pika, Shiqu County

Background

The Bartonella genus currently includes 36 named and 17 Candidatus species [1], which can be found in a wide range of mammalian hosts and arthropod vectors. Some of these species are zoonotic, including B. alsatica, B. bacilliformis, B. elizabethae, B. henselae, B. koehlerae, B. melophagi, B. quintana, B. rochalimae, B. tamiae, B. vinsonii subsp. berkhoffii, B. vinsonii subsp. arupensis, and B. washoensis [28]. Ticks and small rodents are known as vectors and reservoir hosts of Bartonella, respectively. They play an essential role in the preservation and movement of Bartonella in nature within arthropod-mammal systems. Shiqu County has an area of approximately 26,000 km2, an average altitude of above 4200 m and a vast area of pastureland on the eastern Qinghai-Tibetan Plateau. Its population was estimated at 97,000, consisting of individuals with low education and poor health. Yaks, horses and Tibetan sheep are common livestock in Shiqu County; among the three, yak has the largest population (approximately 600,000) and severe tick infestation is often observed in yak. Apart from livestock, plateau pika (Ochotona curzoniae) has the largest population of local small rodents and closely interact with local people and livestock. The significance of ticks has long been recognized due to their ability to feed on a large range of host species and to transmit Bartonella pathogens that can infect a variety of vertebrate hosts, including humans. However, little information is known about bartonella and their hosts and vectors in Shiqu County. This study aims to prove the presence of Bartonella spp. in plateau pikas and ticks and provide preliminary results for establishing prevention and control measures for this tick-borne disease.

Results

A total of 818 ticks were collected from 4 villages in Shiqu County (Fig. 1). Through morphological and molecular identification using the 16S rRNA gene, the presence of two different tick species was confirmed, namely Dermacentor everestianus (79.0%, 646/818) and Haemaphysalis qinghaiensis (21.0%, 172/818). Information on ticks and 16S rRNA sequences are included in Supplementary files 3, 4, 5, 6 and 7.

Fig. 1.

Fig. 1

The maps of Shiqu County. a The map of China; Sichuan Province is marked in yellow. b The map of Ganze Tibetan Autonomous Prefecture; Shiqu County is marked in yellow. c The map of Shiqu; the sample collection locations are represented with black triangles (1. Ariza; 2. Maga; 3. Derongma; 4. Changxgma). The map was created with Adobe Photoshop CS4 (Version 11.01, https://www.adobe.com/products/photoshop.html)

Ticks were first screened for Bartonella infection by PCR targeting the gltA gene, and gltA-positive samples were then screened for rpoB; a total prevalence of 30.1% (246/818, positive for both gltA and rpoB genes) was observed. The infection rates of Bartonella spp. in Arizha, Maga, Derongma, and Changxgma were 4.8, 76.8, 12.5, and 18.0%, respectively (Table 1). The infection rate of Bartonella spp. in ticks was higher in Maga (p < 0.01) (marked with “*” in Table 1) than those in other villages. In Maga, no significant difference was observed (p > 0.05), although the infection rate of Bartonella in H. qinghaiensis (79.1%) was higher than that in D. everestianus (69.2%).

Table 1.

The prevalence of B. melophagi in ticks collected from yaks in Shiqu County

Location No of samples Infection rates %
H. qinghaiensis D. everestianus H. qinghaiensis D. everestianus Total
Ariza 0/168 168/168 4.8 (8/168) 4.8
Maga 172/224 52/224 79.1 (136/172) 69.2 (36/52) 76.8*
Derongma 0/192 192/192 12.5 (24/192) 12.5
Changxgma 0/234 234/234 18.0 (42/234) 18.0

With regard to plateau pikas, spleen samples were first screened by PCR targeting the gltA gene, and gltA-positive samples were then screened for rpoB. Total infection rate of Bartonella spp. in plateau pikas was 21.7% (positive for both gltA and rpoB genes), with 16.7% (12/72), 30.9% (25/81), 13.8% (9/65), and 23.5% (16/68) in Arizha, Maga, Derongma, and Changxgma, respectively. No significant difference in infection rates was observed (p > 0.05) between these study sites.

In this study, all amplicons of the gltA and rpoB genes from ticks and pikas were sequenced and compared to each other. A total of seven unique sequences of gltA (Supplementary file 1) and nine unique sequences of rpoB (Supplementary file 2) were obtained and deposited in GenBank with the following ID numbers: gltA, MN056882-MN056888; rpoB, MN296286-MN296294. For the gltA gene, sequence MN056882 from ticks was completely identical to B. melophagi (AY724768), with 100% coverage; the sequences MN056883 and MN056888 from plateau pikas were 97.03–100% identical to B. queenslandensis (MH748120), with 99–100% coverage; the sequences MN056884, MN056886, and MN056887 from plateau pikas were 100, 97.61, and 96.73% identical to B. grahamii (KT445918 and CP001562), with 100% coverage; and sequence MN056885 from plateau pikas was 98.81% homologous to B. rochalimae (KU292571), with 100% coverage. For the rpoB gene, sequences MN296287-MN296291 from ticks were 99.12–99.71% identical to B. melophagi (EF605288), with 99–100% coverage; sequences MN296286 and MN296294 from plateau pikas were 95.65–97.86% identical to B. grahamii (AB426697 and JN810811), with 100% coverage; and sequence MN296292 from plateau pikas was 99.69% homologous to B. queenslandensis (MH748136), with 100% coverage. However, the sequence MN296293 from plateau pikas was only 92.28 and 92.58% similar to Bartonella sp. (AB529489) and B. grahamii (AB426696), respectively, with 100% coverage.

According to criteria (Bartonella spp. species thresholds: gltA ≥ 96.0% and rpoB ≥ 95.4%) proposed by La Scola et al. [9], only B. melophagi was detected in the tick samples (Table 1); for plateau pikas, as shown in Table 2, B. grahamii was the dominant species in the four villages, and B. queenslandensis was detected only in Maga. Furthermore, gltA- and rpoB-based phylogenetic analysis supported the classification of Bartonella spp. detected in the current study (Figs. 2 and 3).

Table 2.

The prevalence of Bartonella spp. in plateau pikas in Shiqu County

Location Infection rates %
B. queenslandens B.grahamii Total
Ariza 0 16.7 (12/72) 16.7
Maga 8.6 (7/81) 22.2 (18/81) 30.9
Derongma 0 13.8 (9/65) 13.8
Changxgma 0 23.5 (16/68) 23.5

Fig. 2.

Fig. 2

Neighbor joining (NJ) phylogenetic trees based on the Bartonella gltA gene; sequences obtained in this study are marked with black triangles

Fig. 3.

Fig. 3

Neighbor joining (NJ) phylogenetic trees based on the Bartonella rpoB gene; sequences obtained in this study are marked with black triangles

Discussion

Two tick species were identified in this study: H. qinghaiensis (in Maga only) and D. everestianus (in all four sites). D. everestianus was reported only in northwestern China and Nepal [10] at an altitude of 2600–4700 m [11]. Larvae and nymphs of this tick species often infest lagomorphs and rodents, while adult ticks usually infest medium to large sized, modest and wild mammals as hosts, including hares, sheep, yaks, and horses [10, 11]. However, H. qinghaiensis has only been reported in China [1216] and is particularly prevalent in the western plateau, including the provinces of Qinghai, Gansu, Sichuan, and Tibet [16]. Its natural hosts include sheep, goats, yaks, cattle, and hares (Lepus oiostolus). All life stages of the tick can develop in sheep, goats, yaks, and cattle [1622]. Contrary to D. everestianus ticks, H. qinghaiensis mostly performs its activity at low altitudes. Arizha, Changxgma, and Derongma are located in the subfrigid zone, whereas Maga village is located in the cold temperate zone. Due to the significant difference in altitude between Maga and the other three villages, H. qinghaiensis was only found in Maga.

All types of ticks were found to contain Bartonella DNA, although in varying percentages and locations. A survey regarding ticks from 16 states of the United States revealed that the overall prevalence of B. henselae in Ixodes ticks was 2.5% [23]. In Austria, Bartonella spp. (B. henselae, B. doshiae, and B. grahamii) were detected in 2.1% of I. ricinus, with the highest rate in ticks from Vienna (with an infection rate of 7.5%), and the prevalence was higher in adult ticks than in other life stages [24]. Furthermore, a recent One Health perspective review on Bartonella indicated that the overall presence of Bartonella in ticks (combining evidence from multiple surveillance studies) was approximately 15% [25]. In our study, a total prevalence of 30.1% in ticks (especially in Maga, 76.8%) was observed, indicating the severity in Shiqu County.

B. melophagi, a human bacterial pathogen, was first isolated from sheep blood in 2007 [26], and the same bacteria were isolated from blood samples of two female patients with pericarditis and skin lesions in the United States of America [27]. Recently, B. melophagi was isolated from domestic sheep blood and sheep keds (Melophagus ovinus) from the southwestern United States [28], indicating that domestic sheep are a natural host reservoir for B. melophagi and that sheep ked is its main vector. The sheep ked (M. ovinus) is the most studied ked due to its veterinary importance and because of the economic losses caused by its infestation. In contrast to ticks, the whole life stages of sheep ked occur on the host, being strictly host dependent. In Shiqu, in addition to yak, which has the largest population among local livestock (approximately 600,000), Tibetan sheep (approximately 52,000) is the main source of income for local residents; Tibetan sheep are mainly raised for meat and fur. Due to the traditional lifestyle of Shiqu County, Tibetan sheep are in close contact with local residents (especially ranchers), and severe sheep ked infection is often observed. Therefore, in the future, we believe that more in-depth studies are necessary to determine the precise role of sheep ked and Tibet sheep in the transmission of Bartonella in Shiqu County.

In this study, the first DNA of B. melophagi detected in D. everestianus and H. qinghaiensis was reported; this is the first molecular evidence of B. melophagi in Shiqu County. However, there is no current evidence supporting the ability of these ticks to transmit B. melophagi to livestock or humans. To address this issue, experiments should be performed to assess the ability of D. everestianus and H. qinghaiensis to transmit B. melophagi in the future.

Bartonella infection has been mostly reported in Rodentia [2938], and few cases have been reported in Lagomorpha. Until now, there has been only one report of Bartonella infection in plateau pikas, with a positive rate of 18.99% [39]. A total of 15 Bartonella strains have been obtained, and most of them are closely related to B. taylorii and B. grahamii [39]. Based on our research, B. grahamii, a pathogenic strain in humans, was detected in all four villages, while B. queenslandensis was detected only in Maga. In Shiqu, plateau pikas, which has largest population of local small rodents, are in close contact with local people and livestock and can be infested with fleas and ticks, implicating them in the transmission of Bartonella spp. In China, Bartonella infections among humans have been mainly reported in the central plain area, including Jiangsu, Zhejiang, Anhui, and Hubei provinces. No cases or suspected cases have been reported in the Qinghai-Tibetan Plateau. Therefore, the relationship between plateau pikas and the transmission of Bartonella should be further studied. A thorough analysis with controlled experiments should be conducted to determine the exact routes of transmission between plateau pikas, transmission between plateau pikas and their vectors, and transmission from plateau pikas to humans and livestock.

Conclusion

In summary, we have shown, for the first time, a high prevalence of Bartonella spp. in D. everestianus and H. qinghaiensis ticks sampled from yaks in Shiqu County. In this region, key mammalian tick hosts are domesticated yaks and wild mammals such as rodents and plateau pikas. A more comprehensive study of Bartonella pathogens to further assess the prevalence of Rickettsia spp. in other livestock and wildlife hosts from Shiqu County should be performed in the future.

Methods

Study sites

This study was conducted in Shiqu County (longitude, 98.102; latitude, 32.978), Sichuan Province, China (Fig. 1). Ticks and pikas were collected from the following villages: Arizha (longitude, 98.532; latitude, 32.995; altitude, 4010 m), Maga (longitude, 98.138; latitude, 32.419; altitude, 3799 m), Derongma (longitude, 97.972; latitude, 33.069; altitude, 4182 m), and Changxgma (longitude, 99.006; latitude, 32.754; altitude, 3814 m). All samples were collected deep in grasslands far from settlements (> 5 km), and people and livestock did not travel through these areas.

Sample collection

A total of 818 ticks were collected by blanket dragging between June and August 2018; of these ticks, 168, 224, 192, and 234 were collected from Arizha, Maga, Derongma, and Changxgma, respectively (Fig. 1 C). In the same time period, a total of 286 pikas were captured: 72 from Arizha, 81 from Maga, 65 from Derongma, and 68 from Changxgma. Plateau pikas were captured using mouse snap traps. Then, plateau pika spleens were collected under sterile conditions and stored in liquid nitrogen until use. The body of each pika was deeply buried to avoid being eaten by dogs, cats, or other wild carnivores.

Identification of tick species

Ticks were carefully removed from the blanket and stored in 70% ethanol at 4 °C. The specimens were morphologically identified according to the guidelines for tick identification [40]. Then, molecular identification of tick species was performed by targeting the mitochondrial 16S rRNA gene [41].

DNA extraction, PCR, and sequence analysis

Ticks were sectioned longitudinally; one section was used for DNA extraction. For all spleen samples, an average of 30 mg of tissue was used. The total DNA of all samples was extracted using the TIANamp Genomic DNA Kit (TIANGEN Biotech Co., Ltd., Beijing, China; Cat No: DP304) for tick molecular identification and characterization of Bartonella spp. All samples were subjected to PCR assays targeting the gltA gene (379 bp) as previously described [42]. All gltA-positive samples were further analyzed with PCR targeting rpoB (379 bp) [43]. All primers are listed in Table 3. PCR amplifications were conducted in a 25 μl reaction mixture consisting of 1 μl of genomic DNA (2–3 ng), 1 μl of each primer (10 μM), 12.5 μl of PCR Supermix (Transgen Co., Ltd., Beijing, China; Cat No: AS111–11), and 9.5 μl of nuclease-free water. Each PCR included a positive control (DNA of B. henselae preserved in the laboratory) and a negative control (nuclease-free water). The observed bands were purified using the QIAquick Gel Extraction Kit and sent for sequencing (Sangon Biotech Shanghai Co., Ltd.). The obtained sequences were analyzed by employing Bioedit v.7.0.2 and were subjected to nucleotide BLAST search through the NCBI database. Sequences with ≥95% quality cover and identity were considered positive for Bartonella spp. and were compared with validated Bartonella species in GenBank/EMBL/DDBJ through the Clustal X program (http://www.clustal.org/clustal2/). Clones with gltA and rpoB sequences that shared ≥96.0% and ≥ 95.4% similarity with the validated species, respectively, were considered the same species [9].

Table 3.

Primer sequences used for tick and Bartonella spp. identification

Target gene Primer sequence(5′-3′) Product (bp) References
16S rRNA

16S + 1: CTGCTCAATGATTTTTTAAATTGCGG

16S-1: CCGGTCTGACAGATCAAGT

460 [41]
gltA

bart781: ATGGCGAATATTTCTCCAAAA

bart1137: AGTGCAGCATTCGCTCCCCCT

379 [42]
rpoB

rpoF: GCACGATTYGCATCATCATTTTCC

rpoR: CGCATTATGGTCGTATTTGTCC

379 [43]

Phylogenetic analysis and statistics

For phylogenetic analysis, neighbor-joining phylogenetic trees were constructed based on the gltA and rpoB sequences of Bartonella using the Kimura two-parameter model with partial gap deletion and a cutoff of 95% site coverage. The evolutionary distance was calculated, and bootstrap analysis with 1000 iterations was carried out with MEGA6 [44]. SPSS19.0 (Pearson Chi-square test) was applied to compare the differences in Bartonella spp. prevalence between different sampling locations, plateau pikas, and tick species. A p-value of < 0.05 was considered significant.

Supplementary information

12917_2020_2452_MOESM1_ESM.txt (2.4KB, txt)

Additional file 1. Sequences of the gltA gene.

12917_2020_2452_MOESM2_ESM.txt (3.2KB, txt)

Additional file 2. Sequences of the rpoB gene.

12917_2020_2452_MOESM3_ESM.jpg (1.2MB, jpg)

Additional file 3. Adult specimen of H. qinghaiensis. A Dorsal view; B. Ventral view.

12917_2020_2452_MOESM4_ESM.jpg (2.1MB, jpg)

Additional file 4. Adult specimen of D. everestianus. A Dorsal view; B. Ventral view.

12917_2020_2452_MOESM5_ESM.txt (1.3KB, txt)

Additional file 5. Sequences of 16S rRNA (H. qinghaiensis).

12917_2020_2452_MOESM6_ESM.txt (1.3KB, txt)

Additional file 6. Sequences of 16S rRNA (D. everestianus).

12917_2020_2452_MOESM7_ESM.docx (13.9KB, docx)

Additional file 7. Tick collection information.

12917_2020_2452_MOESM8_ESM.txt (2.6KB, txt)

Additional file 8. Information of tick species and frequency of the sequences.

Acknowledgments

We thank our colleagues (Center for Animal Disease Control and Prevention in Sichuan Province, China) for their help with field research and tick/pika sample collection. We are grateful to the reviewers for their invaluable comments to improve this manuscript.

Abbreviations

gltA

Citrate synthase-encoding gene

rpoB

Beta subunit of RNA polymerase

LGT

Lateral gene transfer

Authors’ contributions

HLL and YD performed the experiments. LR and HLL designed the project, analyzed the data and drafted the manuscript together. YD, GL and YA collected the tick samples. HW, MX and YJ collected the pika samples. All authors read and approved the final manuscript.

Funding

This study was supported by Fundamental Research Funds for the Central Universities, Southwest Minzu University (2020PTJS29002), which provided financial support for this work.

Availability of data and materials

The sequences generated in this study were submitted to the GenBank database under the accession numbers MN056882- MN056888 and MN296286- MN296294 (see Supplementary files).

Ethics approval and consent to participate

This study was carried out in full compliance with the framework for the collection of wild species of biological diversity for purposes of noncommercial scientific research, authorized by the Sichuan Department of Agriculture and Rural Affairs. The study received approval from the Animal Ethics Committee of Southwest Minzhu University Plateau, and pikas were collected and inspected by qualified veterinary officers. In this study, no experiment was conducted on live animals.

Consent for publication

Not applicable.

Competing interests

The authors declare that there is no conflict of interest in this study.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information accompanies this paper at 10.1186/s12917-020-02452-x.

References

  • 1.Breitschwerdt EB. Bartonellosis. One health and all creatures great and small. Vet Dermatol. 2017;28:96–e21. doi: 10.1111/vde.12413. [DOI] [PubMed] [Google Scholar]
  • 2.Breitschwerdt EB, Maggi RG, Duncan AW, Nicholson WL, Hegarty BC, Woods CW. Bartonella species in blood of immunocompetent persons with animal and arthropod contact. Emerg Infect Dis. 2007;13:938–941. doi: 10.3201/eid1306.061337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chomel BB, Boulouis HJ, Maruyama S, Breitschwerdt EB. Bartonella spp. in pets and effect on human health. Emerg Infect Dis. 2006;12:389–394. doi: 10.3201/eid1203.050931. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Eremeeva ME, Gerns HL, Lydy SL, Goo JS, Ryan ET, Mathew SS, Ferraro MJ, Holden JM, Nicholson WL, Dasch GA, et al. Bacteremia, fever, and splenomegaly caused by a newly recognized bartonella species. N Engl J Med. 2007;356:2381–2387. doi: 10.1056/NEJMoa065987. [DOI] [PubMed] [Google Scholar]
  • 5.Fenollar F, Sire S, Raoult D. Bartonella vinsonii subsp. arupensis as an agent of blood culture-negative endocarditis in a human. J Clin Microbiol. 2005;43:945–947. doi: 10.1128/JCM.43.2.945-947.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kosoy M, Morway C, Sheff KW, Bai Y, Colborn J, Chalcraft L, Dowell SF, Peruski LF, Maloney SA, Baggett H, et al. Bartonella tamiae sp. nov., a newly recognized pathogen isolated from three human patients from Thailand. J Clin Microbiol. 2008;46:772–775. doi: 10.1128/JCM.02120-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kosoy M, Murray M, Gilmore RD, Jr, Bai Y, Gage KL. Bartonella strains from ground squirrels are identical to Bartonella washoensis isolated from a human patient. J Clin Microbiol. 2003;41:645–650. doi: 10.1128/JCM.41.2.645-650.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Raoult D, Roblot F, Rolain JM, Besnier JM, Loulergue J, Bastides F, Choutet P. First isolation of Bartonella alsatica from a valve of a patient with endocarditis. J Clin Microbiol. 2006;44:278–279.9. doi: 10.1128/JCM.44.1.278-279.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.La Scola B, Zeaiter Z, Khamis A, Raoult D. Gene-sequence-based criteria for species definition in bacteriology: the Bartonella paradigm. Trends Microbiol. 2003;11:318–321. doi: 10.1016/s0966-842x(03)00143-4. [DOI] [PubMed] [Google Scholar]
  • 10.Chen Z, Li Y, Ren Q, Luo J, Liu Z, Zhou X, Liu G, Luo J, Yin H. Dermacentor everestianus Hirst, 1926 (Acari: Ixodidae): phylogenetic status inferred from molecular characteristics. Parasitol Res. 2014;113:3773–3779. doi: 10.1007/s00436-014-4043-1. [DOI] [PubMed] [Google Scholar]
  • 11.Apanaskevich DA, Duan W, Apanaskevich MA, Filippova NA, Chen J. Redescription of Dermacentor everestianus Hirst (Acari: Ixodidae), a parasite of mammals in mountains of China and Nepal with synonymization of D. abaensis Teng and D. birulai Olenev. J Parasitol. 2014;100:268–278. doi: 10.1645/13-369.1. [DOI] [PubMed] [Google Scholar]
  • 12.Gao J, Luo J, Fan R, Fingerle V, Guan G, Liu Z, Li Y, Zhao H, Ma M, Liu J. Cloning and characterization of a cDNA clone encoding calreticulin from Haemaphysalis qinghaiensis (Acari: Ixodidae) Parasitol Res. 2008;102:737–746. doi: 10.1007/s00436-007-0826-y. [DOI] [PubMed] [Google Scholar]
  • 13.Gao J, Luo J, Fan R, Guan G, Ren Q, Ma M, Sugimoto C, Bai Q, Yin H. Molecular characterization of a myosin alkali light chain-like protein, a “concealed” antigen from the hard tick Haemaphysalis qinghaiensis. Vet Parasitol. 2007;147:140–149. doi: 10.1016/j.vetpar.2007.03.007. [DOI] [PubMed] [Google Scholar]
  • 14.Gao J, Luo J, Fan R, Schulte-Spechtel UC, Fingerle V, Guan G, Zhao H, Li Y, Ren Q, Ma M, et al. Characterization of a concealed antigen Hq05 from the hard tick Haemaphysalis qinghaiensis and its effect as a vaccine against tick infestation in sheep. Vaccine. 2009;27:483–490. doi: 10.1016/j.vaccine.2008.10.067. [DOI] [PubMed] [Google Scholar]
  • 15.Gao J, Luo J, Li Y, Fan R, Zhao H, Guan G, Liu J, Wiske B, Sugimoto C, Yin H. Cloning and characterization of a ribosomal protein L23a from Haemaphysalis qinghaiensis eggs by immuno screening of a cDNA expression library. Exp Appl Acarol. 2007;41:289–303. doi: 10.1007/s10493-007-9065-2. [DOI] [PubMed] [Google Scholar]
  • 16.Li Y, Luo J, Liu Z, Guan G, Gao J, Ma M, Dang Z, Liu A, Ren Q, Lu B, et al. Experimental transmission of Theileria sp. (China 1) infective for small ruminants by Haemaphysalis longicornis and Haemaphysalis qinghaiensis. Parasitol Res. 2007;101:533–538. doi: 10.1007/s00436-007-0509-8. [DOI] [PubMed] [Google Scholar]
  • 17.Yin H, Luo J, Guan G, Lu B, Ma M, Zhang Q, Lu W, Lu C, Ahmed J. Experiments on transmission of an unidentified Theileria sp. to small ruminants with Haemaphysalis qinghaiensis and Hyalomma anatolicum anatolicum. Vet Parasitol. 2002;108:21–30. doi: 10.1016/s0304-4017(02)00166-8. [DOI] [PubMed] [Google Scholar]
  • 18.Yin H, Luo J, Guan G, Gao Y, Lu B, Zhang Q, Ma M, Lu W, Lu C, Yuan Z, et al. Transmission of an unidentified Theileria species to small ruminants by Haemaphysalis qinghaiensis ticks collected in the field. Parasitol Res. 2002;88:S25–S27. doi: 10.1007/s00436-001-0565-4. [DOI] [PubMed] [Google Scholar]
  • 19.Yin H, Guan G, Ma M, Luo J, Lu B, Yuan G, Bai Q, Lu C, Yuan Z, Preston P. Haemaphysalis qinghaiensis ticks transmit at least two different Theileria species: one is infective to yaks, one is infective to sheep. Vet Parasitol. 2002;107:29–35. doi: 10.1016/s0304-4017(02)00096-1. [DOI] [PubMed] [Google Scholar]
  • 20.Li Y, Luo J, Guan G, Ma M, Liu A, Liu J, Ren Q, Niu Q, Lu B, Gao J, et al. Experimental transmission of Theileria uilenbergi infective for small ruminants by Haemaphysalis longicornis and Haemaphysalis qinghaiensis. Parasitol Res. 2009;104:1227–1231. doi: 10.1007/s00436-009-1347-7. [DOI] [PubMed] [Google Scholar]
  • 21.Guan GQ, Yin H, Luo JX, Lu WS, Zhang QC, Gao YL, Lu BY. Transmission of Babesia sp to sheep with field-collected Haemaphysalis qinghaiensis. Parasitol Res. 2002;88:S22–S24. doi: 10.1007/s00436-001-0564-5. [DOI] [PubMed] [Google Scholar]
  • 22.Guan G, Moreau E, Liu J, Hao X, Ma M, Luo J, Chauvin A, Yin H. Babesia sp. BQ1 (Lintan): molecular evidence of experimental transmission to sheep by Haemaphysalis qinghaiensis and Haemaphysalis longicornis. Parasitol Int. 2010;59:265–267. doi: 10.1016/j.parint.2009.12.002. [DOI] [PubMed] [Google Scholar]
  • 23.Maggi RG, Toliver M, Richardson T, Mather T, Breitschwerdt EB. Regional prevalences of Borrelia burgdorferi, Borrelia bissettiae, and Bartonella henselae in Ixodes affinis, Ixodes pacificus and Ixodes scapularis in the USA. Ticks Tick Borne Dis. 2019;10:360–364. doi: 10.1016/j.ttbdis.2018.11.015. [DOI] [PubMed] [Google Scholar]
  • 24.Muller A, Reiter M, Schotta AM, Stockinger H, Stanek G. Detection of Bartonella spp. in Ixodes ricinus ticks and Bartonella seroprevalence in human populations. Ticks Tick Borne Dis. 2016;7:763–767. doi: 10.1016/j.ttbdis.2016.03.009. [DOI] [PubMed] [Google Scholar]
  • 25.Regier Y, Rourke FO, Kempf VA. Bartonella spp - a chance to establish One Health concepts in veterinary and human medicine. Parasit Vectors. 2016;9:261. doi: 10.1186/s13071-016-1546-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bemis DA, Kania SA. Isolation of Bartonella sp. from sheep blood. Emerg Infect Dis. 2007;13:1565–1567. doi: 10.3201/eid1310.070570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Maggi RG, Kosoy M, Mintzer M, Breitschwerdt EB. Isolation of Candidatus Bartonella melophagi from human blood. Emerg Infect Dis. 2009;15:66–68. doi: 10.3201/eid1501.081080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kosoy M, Bai Y, Enscore R, Rizzo MR, Bender S, Popov V, Albayrak L, Fofanov Y, Chomel B. Bartonella melophagi in blood of domestic sheep (Ovis aries) and sheep keds (Melophagus ovinus) from the southwestern US: cultures, genetic characterization, and ecological connections. Vet Microbiol. 2016;190:43–49. doi: 10.1016/j.vetmic.2016.05.009. [DOI] [PubMed] [Google Scholar]
  • 29.Inoue K, Maruyama S, Kabeya H, Yamada N, Ohashi N, Sato Y, Yukawa M, Masuzawa T, Kawamori F, Kadosaka T, et al. Prevalence and genetic diversity of Bartonella species isolated from wild rodents in Japan. Appl Environ Microbiol. 2008;74:5086–5092. doi: 10.1128/AEM.00071-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kamani J, Morick D, Mumcuoglu KY, Harrus S. Prevalence and diversity of Bartonella species in commensal rodents and ectoparasites from Nigeria, West Africa. PLoS Negl Trop Dis. 2013;7:e2246. doi: 10.1371/journal.pntd.0002246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Liu Q, Sun J, Lu L, Fu G, Ding G, Song X, Meng F, Wu H, Yang T, Ren Z, et al. Detection of bartonella species in small mammals from Zhejiang Province, China. J Wildl Dis. 2010;46:179–185. doi: 10.7589/0090-3558-46.1.179. [DOI] [PubMed] [Google Scholar]
  • 32.Malania L, Bai Y, Osikowicz LM, Tsertsvadze N, Katsitadze G, Imnadze P, Kosoy M. Prevalence and diversity of Bartonella species in rodents from Georgia (Caucasus) Am J Trop Med Hyg. 2016;95:466–471. doi: 10.4269/ajtmh.16-0041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Spitalska E, Minichova L, Kocianova E, Skultety L, Mahrikova L, Hamsikova Z, Slovak M, Kazimirova M. Diversity and prevalence of Bartonella species in small mammals from Slovakia, Central Europe. Parasitol Res. 2017;116:3087–3095. doi: 10.1007/s00436-017-5620-x. [DOI] [PubMed] [Google Scholar]
  • 34.Blasdell KR, Perera D, Firth C. High prevalence of rodent-borne Bartonella spp. in urbanizing environments in Sarawak, Malaysian Borneo. Am J Trop Med Hyg. 2019;100:506–509. doi: 10.4269/ajtmh.18-0616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Dybing NA, Jacobson C, Irwin P, Algar D, Adams PJ. Bartonella species identified in rodent and feline hosts from island and mainland Western Australia. Vector Borne Zoonotic Dis. 2016;16:238–244. doi: 10.1089/vbz.2015.1902. [DOI] [PubMed] [Google Scholar]
  • 36.Li DM, Hou Y, Song XP, Fu YQ, Li GC, Li M, Eremeeva ME, Wu HX, Pang B, Yue YJ, et al. High prevalence and genetic heterogeneity of rodent-borne Bartonella species on Heixiazi Island. China Appl Environ Microbiol. 2015;81:7981–7992. doi: 10.1128/AEM.02041-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Fernandez-Gonzalez AM, Kosoy MY, Rubio AV, Graham CB, Montenieri JA, Osikowicz LM, Bai Y, Acosta-Gutierrez R, Avila-Flores R, Gage KL, et al. Molecular Survey of Bartonella Species and Yersinia pestis in Rodent Fleas (Siphonaptera) From Chihuahua, Mexico. J Med Entomol. 2016;53:199–205. doi: 10.1093/jme/tjv181. [DOI] [PubMed] [Google Scholar]
  • 38.Qin XR, Liu JW, Yu H, Yu XJ. Bartonella Species Detected in Rodents from Eastern China. Vector Borne Zoonotic Dis. 2019;19:810–14. [DOI] [PubMed]
  • 39.Rao HX, Yu J, Guo P, Ma YC, Liu QY, Jiao M, Ma ZW, Ge H, Wang CX, Song XP, et al. Bartonella species detected in the plateau Pikas (Ochotona curzoiae) from Qinghai plateau in China. Biomed Environ Sci. 2015;28:674–678. doi: 10.3967/bes2015.094. [DOI] [PubMed] [Google Scholar]
  • 40.Deng GF, Jiang ZJ. Economic insect Fauna of China. Ixodes [M] Beijing: Science Press; 1991. [Google Scholar]
  • 41.Black WC, Piesman J. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences. Proc Natl Acad Sci U S A. 1994;91:10034–10038. doi: 10.1073/pnas.91.21.10034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Norman AF, Regnery R, Jameson P, Greene C, Krause DC. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J Clin Microbiol. 1995;33:1797–1803. doi: 10.1128/jcm.33.7.1797-1803.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Paziewska A, Harris PD, Zwolinska L, Bajer A, Sinski E. Recombination within and between species of the alpha proteobacterium Bartonella infecting rodents. Microb Ecol. 2011;61:134–145. doi: 10.1007/s00248-010-9735-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12917_2020_2452_MOESM1_ESM.txt (2.4KB, txt)

Additional file 1. Sequences of the gltA gene.

12917_2020_2452_MOESM2_ESM.txt (3.2KB, txt)

Additional file 2. Sequences of the rpoB gene.

12917_2020_2452_MOESM3_ESM.jpg (1.2MB, jpg)

Additional file 3. Adult specimen of H. qinghaiensis. A Dorsal view; B. Ventral view.

12917_2020_2452_MOESM4_ESM.jpg (2.1MB, jpg)

Additional file 4. Adult specimen of D. everestianus. A Dorsal view; B. Ventral view.

12917_2020_2452_MOESM5_ESM.txt (1.3KB, txt)

Additional file 5. Sequences of 16S rRNA (H. qinghaiensis).

12917_2020_2452_MOESM6_ESM.txt (1.3KB, txt)

Additional file 6. Sequences of 16S rRNA (D. everestianus).

12917_2020_2452_MOESM7_ESM.docx (13.9KB, docx)

Additional file 7. Tick collection information.

12917_2020_2452_MOESM8_ESM.txt (2.6KB, txt)

Additional file 8. Information of tick species and frequency of the sequences.

Data Availability Statement

The sequences generated in this study were submitted to the GenBank database under the accession numbers MN056882- MN056888 and MN296286- MN296294 (see Supplementary files).


Articles from BMC Veterinary Research are provided here courtesy of BMC

RESOURCES