Cloning and characterization of the rat Slo3 (K_Ca5.1) channel: From biophysics to pharmacology

Abstract

Background and Purpose

The Slo3 potassium (K_Ca5.1) channel, which is specifically expressed in the testis and sperm, is essential for mammalian male fertilization. The sequence divergence of the bovine, mouse and human Slo3 α‐subunit revealed a rapid evolution rate across different species. The rat Slo3 (rSlo3) channel has not been cloned and characterized previously.

Experimental Approach

We used molecular cloning, electrophysiology (inside‐out patches and outside‐out patches) and mutagenesis to investigate the biophysical properties and pharmacological characteristics of the rSlo3 channel.

Key Results

The rat Slo3 channel (rSlo3) is gated by voltage and cytosolic pH rather than intracellular calcium. The characteristics of voltage‐dependent, pH‐sensitivity and activation kinetics of the rSlo3 channel differ from the characteristics of other Slo3 orthologues. In terms of pharmacology, the 4‐AP blockade of the rSlo3 channel also shows properties distinct from its blockade of the mSlo3 channel. Iberiotoxin and progesterone weakly inhibit the rSlo3 channel. Finally, we found that propofol, one of the widely used general anaesthetics, blocks the rSlo3 channel from both intracellular and extracellular sides, whereas ketamine only blocks the rSlo3 channel at the extracellular side.

Conclusion and Implications

Our findings suggest that the rSlo3 channel possesses unique biophysical and pharmacological properties. Our results provide new insights into the diversities of the Slo3 family of channels, which are valuable for estimating the effects of the use of these drugs to improve sperm quality.

Abbreviations

4‐AP

4‐aminopyridine

iberiotoxin

Ibtx

Ksper

pH‐sensitive K⁺ current that controls sperm membrane potential

rSlo3

rat Slo3

What is already known

• Previous studies established that Slo3 orthologues evolved quickly and exhibit divergence.

What this study adds

• We cloned the rSlo3 channel and characterized its biophysical and pharmacological properties.

What is the clinical significance

• Our results provide valuable information for estimating the effects of general anaesthetics on sperm quality.

1. INTRODUCTION

The Slo3 (K_Ca5.1) channel is the potassium channel expressed explicitly in the sperm and testis considered as the molecular basis of the pH‐sensitive sperm potassium current (Ksper) (Navarro, Kirichok, & Clapham, 2007; Salkoff, Butler, Ferreira, Santi, & Wei, 2006; Schreiber et al., 1998; Zeng, Yang, Xia, Liu, & Lingle, 2015). As a unique member of the Slo channel family, the Slo3 channel plays a critical role in male fertilization (Salkoff et al., 2006). Slo3‐null mice are male infertile (Santi et al., 2010; Zeng, Yang, Kim, Lingle, & Xia, 2011). Hitherto, three orthologues of the Slo3 channel have been cloned and functionally expressed. They are the mouse Slo3 channel, the bovine Slo3 channel and the human Slo3 channel (Brenker et al., 2014; Santi, Butler, Kuhn, Wei, & Salkoff, 2009; Schreiber et al., 1998). However, due to their quick evolution rates, the amino acid sequences of orthologues of the Slo3 channel are more divergent than the sequences of orthologues of the Slo1 (K_Na1.1) channel, suggesting that each orthologue of the Slo3 channel may possess distinct biophysical properties. The mouse and bovine Slo3 channels are gated by cytosolic pH and depolarization, whereas the human Slo3 channel is gated by pH, Ca²⁺ binding and membrane voltage (Chavez et al., 2014; Geng et al., 2017). Conversely, it has been proposed that human pH‐sensitive K⁺ current that controls sperm membrane potential currents result from the activation of Slo1 channels rather than the activation of Slo3 channels (Mannowetz, Naidoo, Choo, Smith, & Lishko, 2013). Thus, further research on the biophysical and pharmacological properties of Slo3 orthologues is needed for the identification of the evolutionary route of Slo3 channels.

Thus far, the biophysical and pharmacological properties of the mouse Slo3 channel (mSlo3) have been carefully described (Tang, Zhang, Xia, & Lingle, 2010; Wrighton, Muench, & Lippiat, 2015; Zhang, Zeng, & Lingle, 2006; Zhang, Zeng, Xia, & Lingle, 2006). The biophysical properties of the bovine Slo3 channel have also been well‐studied, but its pharmacological characteristics require further investigation (Santi et al., 2009). More studies have been performed on the human Slo3 channel, not only the unique gating characteristics and the crystalline structure of the C‐terminus of the hSlo3 channel have been investigated (Brenker et al., 2014; Leonetti, Yuan, Hsiung, & Mackinnon, 2012) but also the pharmacological properties in response to TEA, quinidine, anuroctoxin toxin (KTx) and iberiotoxin (Ibtx) have also been investigated (Sanchez‐Carranza, Torres‐Rodriguez, Darszon, Trevino, & Lopez‐Gonzalez, 2015). However, other mammalian orthologues of the Slo3 channel have not been cloned and characterized, despite their importance in the identification of the evolutionary route of Slo3 channels. In the meantime, as analgesia and anaesthesia are usually required for assisted reproductive technology, the effects of general anaesthetic on sperm quality have also been studied (Batista, Vilar, Rosario, & Terradas, 2016; He et al., 2016; Vlahos, Giannakikou, Vlachos, & Vitoratos, 2009). But whether general anaesthetics alter sperm quality through the Slo3 channel has not been addressed.

Here, we report the cloning and characterization of the rSlo3 channel. We found that the biophysical properties of the rSlo3 channel, such as the voltage‐ and pH‐dependent gating characteristics, the activation and deactivation kinetics and the gating characteristics altered by co‐expression of α + γ subunits differ from the corresponding properties of other Slo3 orthologues. We also examined the sensitivity of the rSlo3 channel to quinine, quinidine, 4‐aminopyridine (4‐AP), propofol, ketamine, progesterone and iberiotoxin from both the intracellular and extracellular sides, by inside‐out and outside‐out patching. The pharmacological characteristics of the rSlo3 channel were also found to show some differences from the mSlo3 channel. Overall, our results demonstrate that the rSlo3 channel possesses unique biophysical and pharmacological properties.

2. METHODS

2.1. Cloning the rat Slo3 channel and RNA injection

Total RNA was extracted from the testicular tissues of Sprague–Dawley rats (SD rats) with a TRIzol Kit (TIANGEN, DP405) according to the manufacturer's protocol. First‐Strand cDNA synthesis was performed using the SuperScript™ First‐Strand Synthesis System for RT‐PCR (Invitrogen, 11904018) with an oligo d(T) primer. The rSLO3 gene was amplified by PCR using the cDNA of SD rat testis as a template. The primers used for cloning the rSLO3 gene were: rSLO3 F1: 5′‐AATTAACCCGGGATGTCTCAAACATTGCTAGAC‐3′ (the XmaI cleavage site is underlined); rSLO3 R1: 5′‐AATTAATCTAGACTAAGCGATCGGTAGGAAAAGAGC‐3′ (the XbaI cleavage site is underlined). After digesting with XmaI and XbaI, the PCR product was inserted into the pGEMHE vector between XmaI and XbaI sites under the control of the T7 promoter for transcription. The sequence was subsequently confirmed by DNA sequencing. The human LRRC55 and LRRC52 cDNA were synthesized and cloned into the pGemsh vector between BamHI and EcoRI sites by Genewiz Biology Incorporation in Nanjing, China. These sequences were confirmed by DNA sequencing. When rSlo3 RNA was co‐expressed with γ subunits, the injection cRNA volume ratio of rSlo3 to accessory proteins was 1:2. For the production of cRNA, these constructs were linearized using NheI endonuclease and capped mRNA was produced by in vitro transcription using the mMessage mMachine RNA Kit (Ambion, USA). mRNA was purified by lithium chloride precipitation according to a standard protocol, then dissolved in DEPC‐treated water. The rat Slo3 cRNA, LRRC55 cRNA and LRRC52 cRNA (50 ng·μl⁻¹) were typically injected at a volume of 18–40 nl. Oocytes were used 3–10 days after injection. Stage IV Xenopus laevis oocytes were prepared according to protocols used in this laboratory, as previously described (Tang et al., 2016; Tang, Kolanos, De Felice, & Glennon, 2015). The surgery protocol complied the Institutional Animal Care and Use Committee (IACUC) of Xuzhou Medical University guidelines. Before surgery, adult female Xenopus laevis frogs were anaesthetized by tricaine at a concentration of 10 g·m⁻³ in a tank for 10 min. Subsequently, frogs were removed from the tank and placed on ice. Under aseptic conditions, a small incision was made on one side of the abdomen to remove several ovarian lobes. The lobes were immersed in sterile OR2 solution (85‐mM NaCI, 5‐mM KCI, 5‐mM HEPES‐NaOH, 1‐mM MgCl₂, pH 7.0) supplemented with tetracycline (0.05 g·L⁻¹; Sigma). Oocytes were defolliculated by shaking in OR2 solution containing 2 mg·ml⁻¹ collagenase (type II; Boehringer) at room temperature for 1 to 2 h and washed in ND96 solution (in mM, NaCl 96, KCl 2, MgCl₂ 1, HEPES 5, pH 7.5) at room temperature for another hour on a rotator (30 rpm).

2.2. Electrophysiology

All currents were recorded using either an inside‐out patch configuration or an outside‐out patch configuration with an A&M 2400 amplifier (Molecular Devices, USA) or a PC2C amplifier (Yibo, Wuhan, China). Data were transferred and stored in a computer by Axon Digidata 1550 (Molecular Devices) or a PUDA Acquisition system (Yibo). Gigaohm seals were formed in frog Ringer's solution (in mM, 115 NaCl, 2.5 KCl, 1.8 CaCl₂, 10 HEPES, pH 7.4). In the inside‐out patch configuration, excised patches were perfused with test solutions bathing the cytosolic side. The standard pipette/extracellular solution includes (in mM) 140 K‐methanesulfonate, 20 KOH, 10 HEPES and 2 MgCl₂, at pH 7.0. The composition of solutions bathing the cytoplasmic side of the patch membrane was (in mM) 140 K‐methanesulfonate, 20 KOH, 10 HEPES and 5 EGTA at different pH values. In the outside‐out patch configuration, the pipette solution contained 140 K‐methanesulfonate, 20 KOH, 10 HEPES, 2 MgCl₂ and 5 EGTA at pH 8.5. The perfusion solution bathing the extracellular side of the membrane contained (in mM) 140 K‐methanesulfonate, 20 KOH, 10 HEPES and 2 MgCl₂ at pH 7.0. Drugs were dissolved in the solution in which the pH value was titrated to 7.0. Patch clamp recording pipettes were made from borosilicate capillary tubes (Drummond Microcaps, 100 μl). Typical pipette resistance is 1–3 MΩ. Pipette tips were fire‐polished. Data were collected from five to seven patches of each construct tested either in the inside‐out patch configuration or the outside‐out patch configuration (n = 5–7). The number of replicates (n) is also shown in the results.

2.3. Data and analysis

Data were analysed either with Clampfit (Molecular Devices) or Origin software (RRID:SCR_014212). G/V curves were generally constructed from measurements of steady‐state current except that the G/V curves of α + γ2 subunits were constructed from measurements of peak current because of the incomplete inactivation. For families of G/V curves obtained within a patch, the conductance was normalized to the estimated value of the maximal conductance obtained at pH 9.0.

Individual G/V curves were fitted with a single‐component Boltzmann function of the following form:

$$f\left(v\right)=\frac{G_{\mathit{max}}}{1+e^{\frac{\left(V_{\mathit{mid}}-V\right)}{V_c}}}+C.$$ (1)

G/V curves were fitted with a two‐component Boltzmann function of the following form:

$$f\left(\mathrm{v}\right)=\frac{G_s}{1+e^{\frac{\left(V_{\mathit{mid}1}-V\right)}{V_{c1}}}}+\frac{G_u}{1+e^{\frac{\left(V_{\mathit{mid}2}-V\right)}{V_{c2}}}}+C.$$ (2)

G _s and G _u are the fitted values of the maximal conductance of each component with a two‐component Boltzmann fit. Since the second Boltzmann component is over the range of measurable voltages, we normalized the G _s + G _u as the maximal conductance that we measured at pH 9. V _mid1 and V _mid2 are the voltages of half‐maximal activation of each component conductance.

Activation time courses and deactivation time courses of the rSlo3 channel were fitted by either a single‐component exponential function or a two‐component exponential function. The standard exponential function is the following form:

$$f\left(t\right)={\sum }_{i=1}^n{A}_i{e}^{-t/{\tau }_i}+C.$$ (3)

Amplitude ratios for slow and fast components of current relaxation were determined as A1/(A1 + A2). Typically, four sweeps were averaged to generate traces used for the analysis of activation time course or deactivation time course.

The dose–response curves of the blocking effect of each drug on the rSlo3 channel were fitted by the Hill equation:

$$I=\frac{I_{\mathit{max}}}{1+{\left(\frac{{\mathit{IC}}_{50}}{A}\right)}^{n.}}$$ (4)

A is the drug concentration. IC₅₀ is the drug concentration that produces a 50% maximal inhibition. All analyses used independent values from each patch. The data and statistical analysis comply with the recommendations of the British Journal of Pharmacology on experimental design and analysis in pharmacology (Curtis et al., 2015; Guo et al., 2018; McGrath, McLachlan, & Zeller, 2015).

2.4. Drugs

Quinidine was purchased from Alfa Aesar Company (Cat. No. A12559). 4‐AP was purchased from Sigma (St. Louis, USA, Cat. No. A‐0152). Quinine was produced from Acros (Cat. No. 16371‐0‐100). Propofol was purchased from TCI (Cat. No. D0617). The method for calculating the ratio of the protonated form/unprotonated form of drugs was described previously (Tang et al., 2010).

2.5. Nomenclature of targets and ligands

Key protein targets and ligands in this article are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Harding et al., 2018) and are permanently archived in the Concise Guide to PHARMACOLOGY 2019/20 (Alexander et al., 2019). The information of Slo3 and Slo1 channels were referred to the Concise Guide to PHARMACOLOGY 2019/20: Ion channels (Alexander et al., 2019).

3. RESULTS

3.1.1. Cloning and functional expression of the rSlo3 channel in Xenopus oocytes

The rSlo3 cDNA was isolated from the rat testicular cDNA library by RT‐PCR (see Section 2). The RT‐PCR primers were designed based on a predicted rSlo3 gene from Genebank (accession number XP_0062533). The rat Slo3 channel is named as rSlo3 channel (the “r” prefix referring to rat derivation). The full‐length of the rSlo3 α‐subunit contains 1,113 amino acids while the full‐length mSlo3 and hSlo3 α‐subunits include 1,121 and 1,149 amino acids respectively (Figure 1a). The alignment shows the amino acid sequence of the rSlo3 α‐subunit is 84.5% identical with that sequence of the mSlo3 α‐subunit and 65.6% identical with the hSlo3 α‐subunit, respectively. The identity rates among orthologues of Slo3 channels are much lower than the identity rates among orthologues of Slo1 channels, which provides the molecular basis for unique biophysical properties possessed by Slo3 channel orthologues. The activation of the rSlo3 channel responded to depolarization and intracellular alkalization when the channel was expressed in Xenopus oocytes. The rSlo3 channel currents were sharply enhanced at any given voltage when the intracellular pH was increased from 7.0 to 9.0 (Figure 1b–d). However, the macroscopic currents were not enhanced when the cytosolic Ca²⁺ concentration was increased from 0 to 300 μM (Figure 1e–g). The normalized G/V curves could not be fitted well by either a single Boltzmann function with a fixed maximal conductance that was obtained at the highest voltage with intracellular pH 9.0 or by a single Boltzmann function with a maximal conductance that was not restricted (data averaged from six patches, n = 6). The poorly fitted parts are shown in the purple circles (Figure 2a,b, n = 6). This result is inconsistent with the similar fit that was observed in another study of mSlo3 channel, whose G/V curves were best described by single‐component Boltzmann function (Zhang, Zeng, & Lingle, 2006). However, the full set of G/V curves for the rSlo3 channel was best described by two Boltzmann components, with V_h of the first component within the range of the tested voltage step and V_h of the second component over the range of the reached voltage step (Figure 2c). The pH‐dependent V_h change obtained by the single Boltzmann function fits with the fixed G_max was larger than the V_h change obtained from the fits without the constrained G_max, whereas the V_h change derived from two‐component Boltzmann fit only exhibited slight pH dependence (Figure 2d–f, n = 6). No apparent endogenous currents could be recorded from mock injected oocytes under both inside‐out and outside‐out patch configuration conditions, which indicated that endogenous currents contributed little to the currents that were used for G/V analysis (Figure S1A–D). The conductance of the rSlo3 channel did not reach saturation even when the depolarization voltage was increased to 300 mV (Figure S1E,F). Normalized conductance values in different [pH]_i showed statistically significant differences (Figure S2A–F).

FIGURE 1.

Alignment of the amino acid sequences of the Slo3 channel orthologues (rat, mouse and human) and functional expression of the rSlo3 channel in Xenopus oocytes. (a) Identical residues are labelled in yellow colour, while conserved residues between only two species are shown in cyan colour. Non‐conserved residues among three different species are indicated in purple colour. The comparison of the Slo3 orthologues reveals that amino acids identities among Slo3 channels (84.5% identity between the rat Slo3 channel and the mouse Slo3 channel, 65.6% identity between the rSlo3 channel and the hSlo3 channel) are much lower than the identities among the Slo1 orthologues (99.7% identity between the rSlo1 channel and the mSlo1 channel, 98.7% identity between the rSlo1 channel and the hSlo1 channel), suggesting the possibility that Slo3 orthologues possess distinct biophysical properties. (b–d) Typical macroscopic currents of the rSlo3 channel recorded by inside‐out patch clamp configuration from Xenopus oocytes are shown. The pH values of perfusion solutions applied intracellularly were 7.0, 8.2 and 9.0, respectively. The voltage steps were from −140 to 230 mV. (e–g) Typical macroscopic currents of the rat Slo3 channel are shown. Currents were recorded in inside‐out patch clamp configuration from Xenopus oocytes when Ca²⁺ concentrations of perfusion solution applied intracellularly were 0, 10 and 300 μM, respectively. The pH value of perfusion solution was 7.0. The membrane voltages were stepped from −140 to 200 mV

FIGURE 2.

The G/V curves of the rSlo3 channel are best described by a two‐component Boltzmann equation. (a–c) A set of steady‐state currents in inside‐out configuration at different pH (from pH 6.5–9.0) were measured and converted to relative conductance by normalizing conductance to maximal conductance measured at pH 9.0 with highest voltage (averaged from six patches). The curves fitted by Boltzmann equations are shown in red lines. The poorly fitted parts are labelled in purple circles. (a) G/V curves of the rSlo3 channel were fitted by a single‐component Boltzmann equation with a fixed maximal conductance measured at highest voltage in pH 9.0. (b) G/V curves of therSlo3 channel were fitted by a single‐component Boltzmann equation with a free maximal conductance without restriction. (c) The G/V curves of the rSlo3 channel were best fitted by a two‐component Boltzmann equation. (d) The voltage of half activation (V_h) was plotted as a function of pH value. The V_h values were calculated based on Boltzmann fits in which G _max was restricted to maximal conductance measured at pH 9.0. (e) V_h values were plotted as a function of pH values. The V_h values were calculated by a single‐component Boltzmann equation fit in which the G_max was not constrained. (f) V_h values estimated by two Boltzmann components fits were plotted as functions of pH values

Since the pH dependence of the conductance of the rSlo3 channel is quite different from the mSlo3 channel, we tested whether the rSlo3 channel possesses an additional pH‐sensitive site. Since histidine residues might be involved in proton ion binding, we investigated the differences in histidine residues between the rat Slo3 channel and the mouse Slo3 channel. By comparing the amino acid sequence of the rSlo3 channel with the sequence of the mSlo3 channel, we found the rSlo3 channel possessed two additional histidine residues, H551 and H722, which corresponded to N551 and Q722 residues of the mSlo3 channel. But the rSlo3 channel lacked the H417 residue of the mSlo3 channel, which corresponded to P417 in the rat Slo3 channel. Thus, we measured currents of H551A, H772A and P417H mutants of the rSlo3 channel. While a two‐component Boltzmann equation best described the G/Vs of H551A and H722A mutants of the rat Slo3 channel, the G/Vs of the P417H mutant were best described by a single Boltzmann equation, especially when the intracellular pH was above 8.2 (Figure 3a–c, n = 7). This result indicated that the P417H mutant altered the G/Vs of the rat Slo3 channel. The V_h of the P417H mutant only showed slight pH dependence (Figure 3d, n = 7). To show how the P417H mutant altered pH dependence of the rSlo3 G/Vs, the conductance values of rSlo3 and P417H were replotted to show the effect of H⁺ concentrations on the conductance of the rSlo3 channel at different voltages (Figure 3e, n = 5 and f, n = 7). The Hill equation fits indicated that the half activation of conductance values (AC₅₀) of the WT rSlo3 channel and the P417H mutant at any tested voltages were at [H⁺]_i concentrations of 18–36 nM (corresponding to pH values of 7.4–7.7) and of 42–168 nM (corresponding to pH values of 6.8–7.4), respectively. The Hill coefficient ranges for WT Slo3 and P417H mutants were 0.5–1 and 0.5–0.6, respectively. These results suggest that P417H did alter the pH dependence of the rSlo3 current, probably by strengthening or adding a proton binding site that inhibited the rSlo3 current when a proton occupied it. However, there is also a possibility that the P417H altered the flexibility of the RCK1 domain. Thus, we tested whether the mutant P417A also altered the pH dependence of the rSlo3 current. The result showed the AC₅₀ of P417A were at [H⁺]_i concentrations of 47–74 nM (corresponding to pH values of 7.1–7.3). The Hill coefficient ranged from 0.4 to 0.6 (Figure S3A,B). The V_h of P417A dropped from 163 to 84 mV, while intracellular pH increased from 7 to 9 (Figure S3C). This result showed both P417H and P417A mutants altered pH dependence of V_h values of the rSlo3 channel, but the P417A mutant just shifted the pH dependence of V_h values of the rSlo3 channel in parallel, whereas P417H removed the pH dependence of V_h values (Figure S3C). The statistical differences among V_h values of the WT rSlo3 channel, P417H and P417A mutants are shown in Figure S3D,E.

FIGURE 3.

The P417H mutant alters best fit of G/Vs of the rSlo3 channel to single‐component Boltzmann equation. (a–c) G/V curves of H722A, H551A and P417H mutants of the rSlo3 channel at different intracellular pH. The G/V curves of H722A and H551A mutants were best described by two Boltzmann components. G/V curves of P417H mutant were best fitted by single‐component Boltzmann function. (d) V_h values of P417H mutant were obtained by single‐component Boltzmann function fit and were plotted as functions of pH. (e) The normalized conductance of the rSlo3 channel was plotted as a function of [H⁺]_i ranged from 70 to 230 mV. Solid lines show the best fits of the Hill equation. The range of AC₅₀ was 18–36 nM corresponding to pH from 7.4–7.7. (f) The normalized conductance of P417H mutant was plotted as a function of [H⁺]_i ranged from 70 to 230 mV. Solid lines show the best fits of the Hill equation. The range of AC₅₀ was 42–168 nM corresponding to pH from 6.8–7.4

We further measured the activation time courses of the rat Slo3 currents and its dependence on pH and depolarization voltage (Figure S4, n = 5). Over the pH range (7.0–9.0) that produced the primary shifts in G/V curves, the activation behaviour was best described by a single exponential function (Figure S4A,B, n = 5). A two‐component exponential function could not describe activation behaviour of the rSlo3 channel better than a single‐component exponential function (Figure S4C, n = 5), because although two exponential components could approximately describe the activation traces, a two‐component exponential fit could not obtain a reasonable and consistent slow activation time course (τ_s). The single and double component exponential fitted values of the activation time courses at intracellular pH 9.0 are shown (Figure S5A–C). This finding is another biophysical characteristic of the rSlo3 channel that differs from the characteristics of the mSlo3 channel, where the activation behaviour was best described by a two‐component exponential function fit (Zhang, Zeng, & Lingle, 2006). In contrast, two exponential components were required for the best description of the deactivation behaviour of the rSlo3 channel (Figure S6, n = 5). Based on the single‐component exponential fit of the activation time course under different conditions, the τ values were obtained and plotted as a function of voltage in different pH values (Figure S7A,B, n = 5). Interestingly, when the intracellular pH was increased from 7.0 to 7.4, the activation τ values of the rat Slo3 channel were decreased from around 1.6 ms to approximately 0.6 ms, which represents a 55% decrease. However, when the intracellular pH was increased from 7.4 to 9.0, the activation time course at any given voltage was not further decreased (Figure S7A,B, n = 5). The decrease activation time course of the rSlo3 channel when intracellular pH is above 7.4 probably suggests a proton binding site is vacant when the intracellular pH is above 7.4. Subsequently, we continued analysing the voltage and pH dependence of the rSlo3 channel deactivation time courses. Within the range of pH 7.0 to 9.0, both τ_f (τ_f = 87–94 μs) and τ_s (τ_s = 0.67–0.79 ms) of the deactivation time courses of the rSlo3 channel were not voltage‐ or pH‐dependent. (Figure S7C–E, n = 5). However, the fast exponential component of the deactivation time course (τ = 38 μs) of mSlo3 was voltage‐dependent, whereas the slow component (τ = 0.79 ms) of the mSlo3 channel was not voltage‐dependent (Zhang, Zeng, & Lingle, 2006).

Since the rSlo3 channel may function together with auxiliary subunits, we further investigated the effect of the LRRC52 and LRRC55 proteins on the gating of the rSlo3 channel. When co‐expressed with LRRC52, the traces of the rSlo3 channel showed voltage‐dependent incomplete inactivation at voltages higher than 150 mV (Figure 4a–c). The G/V curves generated from steady‐state currents of the rSlo3 channel in the presence of LRRC55 were well‐described by a single‐component Boltzmann equation without constraining the maximum conductance, while the G/V curves obtained by analysing peak currents of the rSlo3 channel in the presence of LRRC52 were also well‐fitted by a single‐component Boltzmann function (Figure 4d,e, n = 6). In the presence of the LRRC52 protein, the V_h values for α + LRRC52 were lower than V_h values for α alone at all intracellular pH values. However, the LRRC55 protein did not affect the shift of the V_h of the rSlo3 channel at any pH values (Figure 4f, n = 6). The statistical results are shown in Figure S8.

FIGURE 4.

Co‐expression of α + γ2 subunit (LRRC52) rather than co‐expression of α + γ3 subunit (LRRC55) leftward shifts voltage‐dependent gating of the rSlo3 channel. (a–c) Current traces show voltage‐dependent activation of co‐expression of α + γ2 subunit of the rSlo3 channel with voltage‐dependent incomplete inactivation at indicated pH. (d) G/Vs generated from the steady‐state currents of co‐expression of α + γ₃ (LRRC55) subunits are shown. (e) G/Vs generated from the peak currents of co‐expression of α + γ₂ (LRRC52) subunit of the rSLO3 channel are shown. (f) Plots of V_h versus [pH]_i of the α alone, α + γ₂ and α + γ₃ are shown

Next, we investigated the pharmacological properties of the rSlo3 channel. With a series of depolarization voltages up to 200 mV, which is over the physiological range, the G/Vs of the rSlo3 channel still could be described approximately by a single‐component Boltzmann function. First, when the intracellular pH was 8.5, the cytosolic application of 2‐ to 50‐mM 4‐AP produced a dose‐dependent blockade (Figure 5a,b, n = 5). The Hill equation estimated the IC₅₀ value as 7.67 mM at 180 mV, which was weaker than the 4‐AP blockade of the mSlo3 channel (Figure 5c, n = 5) (Tang et al., 2010). Further analysis showed the blockade was weakly decreased, with enhanced voltages (Figure 5f, n = 5). Extracellular application of 4‐AP poorly blocked the rSlo3 channel (Figure 5d,e, n = 5).

FIGURE 5.

4‐AP blocks the rSlo3 channel intracellularly. (a) Typical traces at +180‐mV depolarization with indicated concentrations of 4‐AP applied intracellularly in pH 8.5 solution. (b) G/Vs of inside‐out patches with different concentrations of 4‐AP were plotted and fitted with Boltzmann equation. (c) IC₅₀ value obtained by the Hill equation fit shows the blockade of intracellularly applied 4‐AP at 180‐mV depolarization. (d) Sample traces of outside‐out patches with 4‐AP at indicated concentrations applied extracellularly. (e) G/Vs of the rSlo3 channel in outside‐out patch configuration with different concentrations of 4‐AP were plotted against voltages and were fitted with the Boltzmann equation. (f) IC₅₀ values of 4‐AP blockade of the rSlo3 channel recorded by inside‐out patch configuration were plotted and fitted with linear function

Subsequently, the quinine blockade of the rSlo3 channel was also examined. Intracellular application of 1–100 μM quinine effectively inhibited Slo3 channel currents in a dose‐dependent manner (Figure 6a, n = 5). While quinine was applied extracellularly with the outside‐out patch configuration, it also blocked Slo3 channel currents in a dose‐dependent manner but with a higher IC₅₀ (Figure 6b, n = 5). The normalized G/Vs with different concentrations of quinine obtained from the inside‐out patch configuration and the outside‐out patch configuration were plotted and described by the Boltzmann equation (Figure 6c,d, n = 5). Estimated by the Hill equation, the IC₅₀ of the intracellular blockade by quinine was 9.98 ± 2.1 μM, while the IC₅₀ of the extracellular blockade by quinine was 75.7 ± 5.04 μM (Figure 6e,f, n = 5). Although IC₅₀ values at different voltages showed some variations, no voltage‐dependent tendency could be observed (Figure 6g,h, n = 5).

FIGURE 6.

Intracellular quinine blockade of the rSlo3 channel is stronger than extracellular quinine blockade. (a) Typical current traces of inside‐out patches of the rSlo3 channel with indicated concentrations of quinine applied intracellularly. (b) Sample traces of outside‐out patches of the rSlo3 channel with indicated concentrations of quinine applied extracellularly. (c) G/Vs of inside‐out patches with different concentrations of intracellular quinine were plotted and fitted by the Boltzmann equation. (d) G/Vs of outside‐out patches with different concentrations of quinine as indicated were plotted against voltages. (e) IC₅₀ value of intracellular quinine blocking effect at 180 mV was calculated by the Hill equation fit. (f) IC₅₀ value of extracellular quinine blocking effect at 180 mV was calculated by the Hill equation fit. (g) IC₅₀ values of intracellular quinine blocking effect at different voltages were plotted and fitted by a linear equation. (h) IC₅₀ values of extracellular quinine blockade at indicated voltages were plotted and fitted by a linear equation

Similar experiments were also performed to examine the quinidine blockade of the rSlo3 channel. Quinidine also blocked the rSlo3 channel both intracellularly and extracellularly (Figure 7a–d). The IC₅₀ values of the intracellular and extracellular blockade by quinidine at 180 mV were 5.4 ± 0.72 μM and 20.16 ± 3 μM, respectively (Figure 7e,f, n = 6). The IC₅₀ values at different membrane depolarization voltages indicated both the intracellular and extracellular blocking effects of quinidine were voltage‐dependent (Figure 7g,h, n = 6).

FIGURE 7.

Quinidine blocks the rat Slo3 channel intracellularly and extracellularly. (a) Typical current traces of inside‐out patches of the rat Slo3 channels with indicated concentrations of quinidine applied intracellularly. (b) Sample traces of outside‐out patches of the rSlo3 channel with indicated concentrations of quinidine applied extracellularly. (c) G/Vs of inside‐out patches with different concentrations of quinidine were plotted and fitted by the Boltzmann equation. (d) G/Vs of outside‐out patches with different concentrations of quinidine are indicated. (e) IC₅₀ value of intracellular quinidine blockade at 180 mV was estimated by the Hill equation fit. (f) IC₅₀ value of extracellular quinidine blockade at 180 mV was estimated by the Hill equation fit. (g) IC₅₀ values of intracellular quinidine blockade at different voltages were plotted and fitted by a linear equation. (h) IC₅₀ values of extracellular quinidine blockade at indicated voltages were plotted and fitted by a linear equation

The V_h values after the application of different concentrations of 4‐AP, quinine and quinidine are summarized and plotted (Figure S9). In the meantime, we tested iberiotoxin and progesterone blockade of the rSlo3 channel. The results showed that the rSlo3 channel was not sensitive to the iberiotoxin blockade from the extracellular side (Figure S10). Progesterone intracellularly blocked the rSlo3 channel in a dose‐dependent manner (Figure S11A,B), whereas progesterone did not block the rSlo3 channel extracellularly (Figure S11E,F). At 200‐mV depolarization, the Hill equation estimated IC₅₀ value with cytosolic progesterone was approximately 26 μM (Figure S11C). The IC₅₀ values showed strong voltage dependence in a narrow field from 130 to 160 mV (Figure S11D).

Since propofol could influence sperm quality, we also tested propofol blockade of the rSlo3 channel. Propofol is used in emulation form as a general anaesthetic because its water‐soluble concentration is low. The water‐soluble saturated concentration of propofol is 700 μM, which was the highest concentration we tested. Intracellular application of 700‐μM propofol blocked nearly all outward currents at 180‐mV depolarization at pH 8.5, while extracellular application of 700‐μM propofol blocked less than half of the outward current under the same conditions (Figure 8a–d, n = 5). The IC₅₀ of intracellular propofol blockade at +180 mV was 284 ± 10.2 μM, while the IC₅₀ of extracellular blocking effect was 847 ± 37 μM (n = 5), as estimated by Hill equation fitting. This result suggested that propofol blocked the rSlo3 channel intracellularly more effectively than extracellularly. The plot of the propofol blockade IC₅₀ values from the cytosol side indicated that the propofol blockade was slightly increased with an increased depolarization voltage (Figure 8g, n = 5). In contrast, the extracellular propofol blockade IC₅₀ values was gradually decreased with increasing voltage (Figure 8h, n = 5).

FIGURE 8.

Intracellular propofol blockade of the rSlo3 channel is stronger than the extracellular propofol blockade. (a) Sample current traces recorded by inside‐out patch configuration at 180‐mV depolarization of the rSlo3 channel with indicated concentrations of intracellular propofol. (b) Sample current traces recorded by outside‐out patch configuration of the rSlo3 channel with indicated concentrations of propofol applied extracellularly. (c) The G/Vs of patches recorded by inside‐out configuration with different concentrations of propofol were plotted and fitted by the Boltzmann equation. (d) The G/Vs of patches recorded by outside‐out configuration with different concentrations of extracellular propofol were plotted and fitted by the Boltzmann equation. (e) IC₅₀ value of intracellular propofol blockade at 180 mV was estimated by the Hill equation fit. (f) The IC₅₀ value of extracellular propofol blockade at 180 mV was estimated by the Hill equation fit. (g) The IC₅₀ values of inside‐out patches at different voltages were plotted and fitted by a linear equation. (h) The IC₅₀ values of outside‐out patches at indicated voltages were plotted and fitted by a linear equation

The blockade of the rSlo3 channel by general anaesthetic ketamine was also examined. When 500‐μM ketamine was applied intracellularly, almost no blockade of the rSlo3 channel was observed (Figure 9a,c, n = 7). In contrast, extracellular application of ketamine resulted in a dose‐dependent blockade of the rSlo3 channel (Figure 9b,d, n = 7). At 180‐mV depolarization with a pH 8.5 intracellular solution, the extracellular ketamine blockade IC₅₀ value was 91 ± 4.4 μM (Figure 9e, n = 7). Furthermore, the ketamine blockade IC₅₀ value was voltage‐dependent. The blockade by ketamine gradually decreased with an enhanced depolarization voltage (Figure 9f, n = 7).

FIGURE 9.

Ketamine blocks the rSlo3 channel extracellularly. (a) Typical traces of the rSlo3 channel currents recorded at +180‐mV depolarization with indicated concentrations of ketamine applied intracellularly in pH 8.5 solution. (b) Sample traces of the rSlo3 currents recorded by outside‐out patch configuration with extracellular ketamine at indicated concentrations in the pH 7.0 solution. (c) The G/V curves of inside‐out patches with different concentrations of ketamine were plotted and fitted by the Boltzmann equation. (d) The G/V curves of outside‐out patches with different concentrations of ketamine were plotted against voltages and fitted by the Boltzmann equation. (e) IC₅₀ value obtained by the Hill equation fit of extracellular ketamine blockade at 180 mV. (f) IC₅₀ values at different voltages were plotted and fitted with a linear function

4. DISCUSSION

In this study, we report the cloning and functional expression of the rSlo3 channel, which possesses unique biophysical and pharmacological characteristics that are distinct from other Slo3 orthologues.

The different biophysical properties between rSlo3 and mSlo3 channels are summarized as follows. First, the G/Vs of the rSlo3 channel are best described by two‐component Boltzmann functions, a unique characteristic among other Slo3 and Slo1 orthologues (Zhang, Zeng, & Lingle, 2006). That P417H and P417A mutants alter the best fit of G/Vs to a single‐component Boltzmann function reflects that the flexibility of the domain may contribute to this characteristic. However, since the P417A only produces parallel shifts in V_h values while the P417H removes pH dependence of the V_h values, we cannot exclude the possibility that P417H probably adds a pH‐sensitive site on the RCK1 domain. Second, the activation behaviour of the rSlo3 channel is best described by a single exponential function, which is inconsistent with the characteristics of activation of the mSlo3 channel.

Interestingly, the activation time course sharply decreases when the intracellular pH rises from 7.0 to 7.4, but the activation time course does not further decrease when intracellular pH is over 7.4. A hypothesis that can explain this phenomenon is that there is more than one pH‐sensitive site on the rSlo3 channel. One site probably can slow the activation process when it is occupied by a proton, whereas another pH‐sensitive site only decreases the Po of the rSlo3 but does not influence the activation time course when bound by a proton. However, the site that alters the activation time course has a low affinity for protons. Once the pH value is higher than pH 7.4, further proton binding seems to dissipate. The fact that the Hill coefficients of the pH dependence of rSlo3 current regulation are less than one is consistent with this hypothesis (Figure 3). Thus, a reasonable deduction is that the low affinity site promotes channel opening when it is occupied by a proton, while the high‐affinity site inhibits channel opening when it binds a proton. Thus, further mutagenesis research regarding this hypothesis is needed. The rSlo3 channel showing a one exponential component activation and a two exponential component deactivation process indicate that the conformational changes during channel closing are not a simple reversal of the conformational changes associated with channel opening. The rSlo3 channel closing process may experience more complicated conformational changes than the conformational changes during the channel opening process. Third, co‐expression of the rSlo3 α + γ2 (LRRC52) subunits demonstrates incomplete inactivation at a high depolarization voltage, which is also not observed with other orthologues of the Slo3 channel. Taken together, the rSlo3 channel shows unique biophysical properties such as pH dependence, kinetic processes and interaction with γ‐subunits. Thus, our work provides new insights into the characteristics of Slo3 orthologues.

It is probable that the pharmacological properties of the rSlo3 channel also differ from the properties of the mSlo3 channel. Since the gating properties of rSlo3 are different from those properties of mSlo3, we cannot use the same model to compare the 4‐AP blockade of the rSlo3 channel with blockade of the mSlo3 channel. However, from the G/Vs plots for cytosolic 4‐AP, we found that 50‐mM 4‐AP maintains about 20% conductance of the rSlo3 channel at 200 mV (Figure 5b), whereas application of 10‐mM cytosolic 4‐AP maintains the same percentage of conductance of the mSlo3 channel at 200 mV (fig. 6b of our previous study) (Tang et al., 2010). Thus, the rSlo3 channel is less sensitive to cytosolic 4‐AP than the mSlo3 channel. This result probably suggests the conformation of the 4‐AP interaction site for the rSlo3 channel is different from the conformation of the mSlo3 channel site. However, both channels are insensitive to extracellular 4‐AP.

In the meantime, the intracellular quinidine blockade of the rSlo3 channel is similar with its blockade of the mSlo3 channel. The G/V curves resulting from the cytosolic application of quinidine for the rSlo3 channel and the mSlo3 channel (Figure 6c) (fig. 9b, previous paper) (Tang et al., 2010). Another study using a two‐electrode voltage clamp produced consistent results and suggested a quinidine binding site at the mSlo3 channel (Wrighton et al., 2015). The hSlo3 channel probably is more sensitive to quinidine because the extracellular application of 100‐μM quinidine can inhibit 86% hSlo3 current whereas both the rSlo3 and mSlo3 channel need around 500‐μM extracellular quinidine to reach similar inhibition rates (Sanchez‐Carranza et al., 2015). Previous work also showed that quinidine in its protonated form blocks the mSlo3 channel intracellularly, which requires that extracellularly applied quinidine rapidly cross the cell membrane in its unprotonated form and accumulate at a sufficient concentration. Similarly, the blockade following the intracellular application of quinine to the rSlo3 channel is seven‐fold greater than the blockade following extracellular quinine application. The physiological significance of quinine blockade of the rSlo3 channel is apparent because the effective blocking concentration range following extracellular application of quinine matches the concentration range of quinine that alters sperm volume, motility, as well as its effective anti‐malarial concentration (1–4 mM) (Izaguirry et al., 2016; Petrunkina, Harrison, Hebel, Weitze, & Topfer‐Petersen, 2001; Yeung & Cooper, 2001).

In recent years, anaesthetic protocols used during reproduction assistance have attracted more concern regarding the quality of sperms (Batista et al., 2016; Vlahos et al., 2009). The inhibition of the Slo3 channel by anaesthetics has not been examined previously. We found that although propofol inhibits the rSlo3 channel when applied both intracellularly and extracellularly, the IC₅₀ of the blockade (intracellular application: 284 ± 10 μM, extracellular application: 847 ± 36 μM) is much higher than the typical concentration used clinically as an anti‐epileptic drug or as a general anaesthetic (plasma concentration 3.9–65.6 μM, 0.7–11.7 μg·ml⁻¹) (Khan et al., 2014; Ouchi & Sugiyama, 2015). Thus, propofol used clinically may not damage sperm quality through the inhibition of the Slo3 channel. Similarly, extracellularly applied ketamine also inhibits the rSlo3 channel at an IC₅₀ concentration that (IC₅₀ = 91.6 ± 4.4 μM) is much higher than the concentration range used as a clinical anaesthetic (plasma concentration 50–300 ng·ml⁻¹, 182.4 nM–1.09 μM) (Peltoniemi, Hagelberg, Olkkola, & Saari, 2016; Wang et al., 2019). Thus, ketamine also only minimally affects sperm quality via inhibition of the Slo3 channel. However, this clinical significance is limited because the Slo3 channels evolved quickly. The dose range at which these general anaesthetics inhibit the rSlo3 channel may not be the same as the dose range that these anaesthetics block the human Slo3 channel. The blockade of the rSlo3 channel by the drugs tested in this study is summarized in Table 1.

TABLE 1.

Summary of IC₅₀ and blockades of channel blockers on the rSlo3 channel

	Quinidine	Quinine	4‐AP	Propofol	Ketamine	Iberiotoxin	Progesterone
Inside‐out	5.39 ± 0.72 (μM)	9.98 ± 2.10 (μM)	7.67 ± 1.12 (mM)	284.04 ± 10.56 (μM)	No effect	Not tested	25.92 ± 0.77 (μM)
Outside‐out	20.16 ± 3.05 (μM)	75.72 ± 5.04 (μM)	No effect	847.16 ± 36.79 (μM)	91.06 ± 4.44 (μM)	No effect	No effect

In sum, this study not only defines the biophysical properties of the rSlo3 channel but also provides new insights into the diversity of Slo3 family channels. We also dissected the blockade of the rSlo3 channel by some specific drugs such as iberiotoxin, progesterone, two general anaesthetics and three potassium channel blockers, which provides valuable information for estimating the clinical effects on sperm quality of using these drugs.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS

G.‐M.W. and Q.G. performed electrophysiological experiments with all drugs. Z.‐G.Z. and X.‐R.D. and Y.L. performed electrophysiological experiments with WT type rSlo3 channel and its mutants. F.‐F.Z. cloned the rSlo3 channel. G.‐M.W. and Q.G. analysed some data. Q.‐Y.T. and Z.Z. supervised all experiments.

DECLARATION OF TRANSPARENCY AND SCIENTIFIC RIGOUR

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research as stated in the BJP guidelines for Design & Analysis and as recommended by funding agencies, publishers and other organisations engaged with supporting research.

Supporting information

Figure S1. Endogenous currents contribute little to both inside‐out and outside‐out patch potassium currents.

Figure S2. The statistical analysis of some normalized conductance values at 120–220 mV under different [H⁺]_i. A‐F.

Figure S3. The P417A mutant parallelly shifts the V_h of rSlo3 channel at different [H⁺]_i.

Figure S4. The activation behavior of the rat Slo3 channel is best described by single component exponential function.

Figure S5. Two component exponential function fit cannot get consistent and reasonable slow time course (τ_s) of rat Slo3 activation.

Figure S6. The deactivation behavior of the rat Slo3 channel is best described by two component exponential function fit.

Figure S7. Activation time course and deactivation time course of the rat Slo3 current.

Figure S8. Statistical analysis of V_h values of rSlo3 alone, rSlo3 + LRRC52 and rSlo3 + LRRC55.

Figure S9. V_h values of rSlo3 channel after application of channel modulators.

Figure S10. Iberiotoxin (Ibtx) cannot block the rat Slo3 channel.

Wang G‐M, Zhong Z‐G, Du X‐R, et al. Cloning and characterization of the rat Slo3 (K_Ca5.1) channel: From biophysics to pharmacology. Br J Pharmacol. 2020;177:3552–3567. 10.1111/bph.15078