Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations

Alyson Sujkowski; Anna Gretzinger; Nicolette Soave; Sokol V Todi; Robert Wessells

doi:10.1371/journal.pgen.1008778

. 2020 Jun 24;16(6):e1008778. doi: 10.1371/journal.pgen.1008778

Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations

Alyson Sujkowski ¹, Anna Gretzinger ², Nicolette Soave ¹, Sokol V Todi ², Robert Wessells ^1,^*

Editor: Hua Bai³

PMCID: PMC7351206 PMID: 32579604

Abstract

Endurance exercise has broadly protective effects across organisms, increasing metabolic fitness and reducing incidence of several age-related diseases. Drosophila has emerged as a useful model for studying changes induced by chronic endurance exercise, as exercising flies experience improvements to various aspects of fitness at the cellular, organ and organismal level. The activity of octopaminergic neurons is sufficient to induce the conserved cellular and physiological changes seen following endurance training. All 4 octopamine receptors are required in at least one target tissue, but only one, Octβ1R, is required for all of them. Here, we perform tissue- and adult-specific knockdown of alpha- and beta-adrenergic octopamine receptors in several target tissues. We find that reduced expression of Octβ1R in adult muscles abolishes exercise-induced improvements in endurance, climbing speed, flight, cardiac performance and fat-body catabolism in male Drosophila. Importantly, Octβ1R and OAMB expression in the heart is also required cell-nonautonomously for adaptations in other tissues, such as skeletal muscles in legs and adult fat body. These findings indicate that activation of distinct octopamine receptors in skeletal and cardiac muscle are required for Drosophila exercise adaptations, and suggest that cell non-autonomous factors downstream of octopaminergic activation play a key role.

Author summary

Repeated endurance exercise produces gradual adaptations in animals and humans that improve many aspects of health. One important component of the exercise response is adrenergic signaling. Norepinephrine secretion is known to be upregulated during an exercise bout, and affects multiple organ systems. We previously demonstrated that activation of neurons that secrete the invertebrate version of norepinephrine, octopamine, are necessary for fruit flies to respond to chronic exercise by increasing their endurance, speed and cardiac performance. Here, we use tissue-specific genetics to show which octopamine receptors are required in each tissue for exercise to exert its positive effects on long-term health. We find that all the various receptors are required in at least one organ system, and that one receptor, Octβ1R, is required in all of them. We also report that, despite the high similarity between the various receptors, they have distinct responses, and cannot always substitute for one another. We also find that activation of octopamine receptors in skeletal or cardiac muscle have tissue-non-autonomous effects on adaptations in other tissues. These results help to further understand the complex interplay between neuronal signaling and responses in various organs during chronic exercise.

Introduction

Endurance exercise is a potent, low-cost intervention with broad healthspan-extending effects [1]. Chronic endurance training simultaneously promotes healthy physiology and prevents disease, improving function in heart, skeletal muscle and brain while reducing obesity, heart disease and cognitive decline [2–4]. These benefits are associated with adaptive changes to gene expression and metabolism [2,5–8].

Nonetheless, these benefits are inaccessible to much of the population that are unable to perform an endurance exercise regimen because of injury, illness, advanced age, or lifestyle. Dissecting the mechanisms underlying exercise adaptations in order to identify exercise mimetics remains a prominent research goal. Until recently, studies of life-long exercise effects were limited to rodent models and retroactive comparisons of human cohorts, making controlled, longitudinal analysis and large-scale genetic studies difficult. We and others have developed endurance training programs for Drosophila, taking advantage of their innate instinct for negative geotaxis, allowing for controlled training of large, genetically identical cohorts [9,10]. After our 3 week training protocol, male flies increase climbing speed, cardiac stress resistance [11], endurance [12], flight performance [5], and lysosomal activity in their fat body [7]. Trained male flies have increased mitophagy in cardiac and skeletal muscle [13], increased mitochondrial enzyme activity [11,14] and changes in transcript expression similar to those found in long-lived flies [5]. These genetic and physiological adaptations closely resemble benefits seen in both rodent models [15] and humans [1].

We have previously found that increased activity of octopaminergic neurons is both necessary and sufficient for exercise adaptations in Drosophila, even in sedentary flies where mobility is restricted by a foam stopper placed low in the vial [8]. Octopamine signals through conserved α and β-adrenergic receptors [16,17], similar to those that bind vertebrate norepinephrine. Both norepinephrine and octopamine have been associated strongly with the fight-or-flight response. In addition to increasing the drive to exercise, octopamine and norepinephrine are known to facilitate transient increases in endurance, lipolysis, and fatty acid metabolism [18–23]. As either daily exercise or daily short-term activation of octopaminergic neurons is sufficient to provide the benefits of endurance exercise in Drosophila [8], and chronic exercise stimulates increased norepinephrine secretion in humans [24], these mechanisms appear to be conserved.

Norepinephrine is produced neuronally and also released into circulation from the adrenal gland [25,26]. Its signal can be received by a family of alpha- and beta- adrenergic receptors that are expressed in complementary patterns [27]. The specific requirements for each of these receptors in various tissues in driving the response to chronic exercise is incompletely understood in any organism. While Drosophila do not have an adrenal gland, neuronally produced octopamine can signal to neighboring cells or be released into circulation, where it can potentially bind receptors in a variety of tissues [17]. Here, we utilize the Drosophila system to uncover tissue-specific requirements for each receptor in executing the adaptive response to chronic exercise.

Drosophila have one α-adrenergic octopamine receptor, OAMB, and 3 dedicated β-adrenergic octopamine receptors, Octβ1R, Octβ2R, and Octβ3R [17]. We have previously established that all 4 are required for at least some aspect of exercise adaptation in Drosophila, but only one, Octβ2R, was required for all of the characteristic adaptations when knocked down using global, inducible RNAi [8]. These results are consistent with studies in which β-blockers tend to inhibit exercise performance and adaptation in humans [28,29].

Here, we separately map receptor requirements for exercise adaptations using the UAS-Gal4 system and Gene Switch Gal4 to reduce adrenergic receptor expression in heart, adult fat body and adult skeletal muscle. We find that Octβ2R expression is required in skeletal muscle for improvements to endurance and speed, but also cardiac performance and fat-body autophagy, suggesting tissue non-autonomous effects. OAMB and Octβ3R have tissue-specific effects on exercise adaptations, with OAMB being more important for cardiac improvements and Octβ3R essential for flight. Intriguingly, we also find cell non-autonomous effects resulting from reductions in cardiac-specific OAMB and Octβ1R knockdown, as well as muscle-specific OAMB and Octβ1R knockdown.

Results

Octopamine receptor expression is tissue-specific

OAMB, Octβ1R, Octβ2R and Octβ3R transcript expression was measured in heart, muscle and fat body using qRT-PCR, in agreement with previously published reports [17] (S1A–S1C Fig). All 4 receptors were detected in adult muscle (S1B Fig), while only Octβ3R transcript expression was found in adult fat body (S1C Fig). We also detected for the first time OAMB and Octβ1R in hearts, supported by RT-PCR and subsequent physiological analyses. Octβ2R and Octβ3R transcripts were not detected in heart tissue (S1A Fig). Because skeletal muscle, heart and adipose tissue are the primary tissues where we have characterized changes following chronic exercise, and because OA receptors are expressed in each of these tissues, we set out to map which receptors are required in each of these key tissues to execute the effects of chronic exercise training.

We first tested knockdown efficiencies for each RNAi construct used with each driver, separately testing at 72 hours after induction by addition of RU486 (see methods), and again at 25 days after induction (S1A–S1C Fig). Unexercised and exercised cohorts were also separately measured. Knockdowns ranged from 50% to 95% and in most cases were more efficient at 25 days then at 72 hours. There was no consistent effect of exercise on knockdown efficiency.

OAMB is required in muscle and heart for improved climbing speed, endurance and cardioprotection with exercise

Runspan, a measure of endurance in which Drosophila time to fatigue is scored in real time and plotted similarly to a survival curve (see methods), was scored on day 5 post-eclosion, 72 hours after induction of RNAi expression through RU486 feeding. RNAi against OAMB (Fig 1) in neither adult muscles (MHC GS RU+, Fig 1A) nor adult hearts (hand GS RU+, Fig 1G) altered baseline endurance. The same cohort of flies was given 3 weeks of exercise training and assessed again for endurance on day 25. Typically, exercise-trained wild-type flies run longer than genetically identical, untrained siblings that have been placed on the machine on each day, but with a foam stopper to prevent climbing as a control for the exercise environment [9]. Genetic background controls were genetically identical but lacked the inducing drug for the RNAi (RU-). Flies with muscle- or heart- specific OAMB RNAi failed to increase endurance with exercise, while control flies responded to exercise with increased endurance as normal (Fig 1B and 1H).

Fig 1 — **(A)** Baseline endurance was not affected by knockdown of *OAMB* in muscle (log-rank, p = 0.6994). **(B)** *MHC GS>OAMB* RNAi RU+ flies do not improve endurance after exercise training (log-rank, p = 0.2845) and have similar endurance to RU- untrained flies (log-rank, p = 0.1508). *MHC GS>OAMB* RNAi RU- exercised have significantly better endurance than untrained RU- siblings (log-rank, p = 0.0034). **(C)** *MHC GS>OAMB* RNAi RU+ flies do not improve climbing speed with exercise training (2-way ANOVA, exercise effect, p≥0.0620) but have statistically higher climbing index than trained RU- controls at week 3 (2-way ANOVA, genotype effect, p = 0.0002). *MHC GS>OAMB* RNAi RU- flies respond to exercise with increased climbing speed at weeks 2–4 (2-way ANOVA, exercise effect, p≤0.0489). **(D)** Uninduced RU- *MHC GS>OAMB* RNAi control flies respond to exercise with enhanced flight performance (ANOVA with Tukey post-hoc, p<0.0001), as do *MHC GS>OAMB* RNAi RU+ flies (ANOVA with Tukey post-hoc, p = 0.0264). **(E)** *MHC GS>OAMB* RNAi RU+ flies have higher cardiac failure in response to external electrical pacing compared to untrained RU- controls whether exercised or not (Chi-squared, p≤0.0203). RU- background controls improve cardiac performance with exercise with reduced failure rate (Chi-squared, p = 0.0004). **(F)** Both RU+ and RU- *MHC GS>OAMB* RNAi flies increase fat body lysosomal activity after exercise training compared to unexercised cohorts (ANOVA with Tukey post-hoc, p = 0.0291, p<0.0001). **(G)** *hand GS>OAMB* RNAi RU+ and RU- flies have similar endurance at adult day 5 (log-rank, p = 0.8611). **(H)** *hand GS>OAMB* RNAi RU+ flies do not improve endurance after exercise training (log-rank, p = 0.1624) while exercised uninduced RU- controls have better endurance than untrained siblings (log-rank, p = 0.0209). **(I)** Untrained *hand GS>OAMB* RNAi RU+ flies have similar climbing speed to untrained, uninduced RU- controls (2-way ANOVA, genotype effect, p≥ 0.1648) but have reduced climbing speed across ages with exercise (2-way ANOVA, exercise effect, p<0.0001 after week 2). RU- controls improve climbing speed with exercise training (2-way ANOVA, exercise effect, p<0.0001 after week 1). **(J)** Both *hand GS>OAMB* RNAi RU+ flies and RU- controls improve flight performance, measured by landing height, after exercise training (ANOVA, p<0.001). **(K)** *hand GS>OAMB* RNAi RU- control flies respond to endurance exercise with lower cardiac failure in response to external electrical pacing, but RU+ flies do not (Chi-squared test, p = 0.005, p = 0.7169). **(L)** Exercised *hand GS>OAMB* RNAi RU+ flies have increased fat body LysoTracker staining compared to untrained, uninduced RU- controls, although levels are not significantly increased in comparison to untrained RU+ cohorts (ANOVA with Tukey multiple comparisons, p = 0.0167, p = 0.1537, respectively).

Wild-type exercise-trained males retain greater negative geotaxis climbing speed across ages than age-matched control siblings [11]. We assessed negative geotaxis speed 5 times per week prior to the start of daily training, as described [30]. RNAi against OAMB in adult muscles prevented adaptation in trained flies, while RU- controls improved normally with exercise (Fig 1C). Heart-specific OAMB knockdown more severely impaired climbing speed, with exercised flies actually climbing slower than unexercised siblings. RU- control flies responded to exercise normally (Fig 1I).

Exercise training is cardio-protective in wild-type males, as measured by response to external electrical pacing stress [31]. Both muscle- and heart-specific OAMB knockdown prevented cardioprotective benefits of exercise training, while RU- controls responded normally to exercise (Fig 1E and 1K).

Exercise-trained wild-type male flies also have better flight performance as measured by recording landing height after ejection from a platform [8], and wild-type male flies increase autophagy in the fat body [8] during chronic exercise. Knockdown of OAMB in muscle or heart did not prevent exercise from increasing flight ability (Fig 1D and 1J) and fat body LysoTracker staining (Fig 1F and 1L and S9A and S9B Fig).

Octopamine β1 receptor is specifically required in muscle for adaptive response to chronic exercise

Muscle-specific knockdown of Octβ1R (MHC GS Octβ1R RU+) reduced baseline endurance in comparison to uninduced controls (Fig 2A). Importantly, Octβ1R reduction did not prevent repetitive climbing exceeding 400 minutes, meaning that it did not preclude these flies from performing our exercise regimen. Muscle-specific Octβ1R RNAi completely prevented exercise from increasing endurance, and Octβ1R RNAi flies ran shorter than untrained RU- controls whether exercised or not (Fig 2B). Octβ1R was also required in muscles for exercise-dependent improvements in climbing speed, flight, and cardiac performance (Fig 2C–2E). Fat body LysoTracker staining was abnormal in muscle-specific Octβ1R RNAi flies, with high lysosomal activity whether exercised or not, and unexercised flies actually showing higher activity (Fig 2F, S9C Fig). Heart-specific knockdown of Octβ1R (hand GS Octβ1R RU+) had similar detrimental effects on baseline and post-training runspan, climbing speed, and LysoTracker staining, with exercised RU+ flies all performing similar to or worse than untrained, uninduced RU- controls (Fig 2G–2I and 2L, S9D Fig). Octβ1R reduction in adult hearts did not affect adaptations in landing height or cardiac stress resistance, however (Fig 2J and 2K).

Octopamine β2 and β3 receptor expression in muscle separately coordinate exercise adaptations

Adult-specific reduction of neither Octβ2R nor Octβ3R significantly affected baseline endurance (Fig 3A and 3G). In contrast, knockdown of either receptor prevented adaptation to chronic exercise (Fig 3B and 3H). RNAi against Octβ2R in adult muscle caused unusual climbing phenotypes, with unexercised knockdown flies climbing faster than controls, but actually becoming slower when exercise-trained (Fig 3C). Muscle-specific Octβ3R knockdown flies had normal baseline performance, but exercise training significantly worsened their climbing speed (Fig 3I). Knockdown of Octβ2R or Octβ3R in adult muscle also reduced normal increases in LysoTracker staining in trained RU+ flies, (Fig 3F and 3L S9E and S9F Fig) while exercised RU- flies adapted with exercise normally in all assessments (Fig 3, RU- EX). Muscle specific Octβ2R RNAi did not block adaptations to flight performance (Fig 3D), but Octβ2R was required in muscles for the cardioprotective effect of exercise (Fig 3E). In contrast, muscle–specific Octβ3R RNAi did not block exercise-induced cardiac improvements (Fig 3K), but did prevent improvements to flight (Fig 3J).

Octopamine β3 receptor is important for fat body homeostasis

All 4 octopamine receptors tested here are known to be present in adult brain, with developmental and tissue-specific activities that are context dependent [17]. Among tissues tested here, Octβ3R transcript was only detected in adult fat body, and has been previously reported to be present at low levels in hindgut and Malpighian tubules [17]. Octβ3R RNAi in adult fat body had no effect on baseline or post-training endurance, exercise-induced climbing improvement, or resistance to pacing-induced cardiac stress (Fig 4A, 4B, 4C and 4E). The major effect of Octβ3R knockdown in adult fat body was a cell-autonomous block of LysoTracker staining accumulation after exercise (Fig 4F and 4G). Perhaps surprisingly, Octβ3R expression was also required in adult fat body for exercise-dependent increases in flight performance (Fig 4D).

Fig 4 — **(A)** *S106 GS>Oct β3R* RNAi RU+ flies have endurance that is similar to RU- control siblings (log-rank, p = 0.8497). **(B)** Both trained *S106 GS>Octβ3R* RNAi RU+ and trained uninduced RU- controls have better endurance after exercise training compared to unexercised cohorts (log-rank, p = 0.0258, p = 0.0187). **(C)** Both *S106GS>Octβ3R* RNAi RU- and RU+ flies respond to exercise with increased climbing speed in weeks 2–4 compared to untrained cohorts (2-way ANOVA, exercise effect, p<0.0001). **(D)** Exercise training does not improve flight performance in *S106 GS>Octβ3R* RNAi RU+ flies, which have similar landing height to untrained RU- controls (ANOVA with Tukey post hoc, p = 0.9756). *S106 GS>Octβ3R* RNAi RU- flies have increased landing height after exercise (p<0.0001). **(E)** Exercise-trained *S106 GS>Octβ3R* RNAi RU+ and RU- flies improve cardiac performance after pacing stress with lower failure rate (Chi-squared, p = 0.0002, p = 0.0397). **(F)** Exercised and unexercised *S106 GS>Octβ3R* RNAi RU+ flies have low levels of lysosomal activity in adult fat body, while RU- control flies have increased fat body LysoTracker staining in exercised groups in comparison to age-matched, unexercised siblings (ANOVA with Tukey post-hoc, p<0.0001). **(G)** Representative 40X confocal image of fat-body lysotracker staining. Scale bar = 20μm. **(H)** Whole exercise-trained flies of indicated strains were analyzed through immunoblotting of dAtg8 proteins. Direct blue was used for loading. Lanes for exercised groups are indicated in red, unexercised in black. Lane abbreviations: “WT”: w¹¹¹⁸, “(-)”:*S106 GS>Oct β3R* RNAi RU+, “(+)”: w¹¹¹⁸ + OA feeding. **(I)** Relative levels of unprocessed (dAtg8-I) and processed (dAtg8-II) dAtg8 proteins were quantified by densitometry. The total volume of each band was quantified using ImageLab (Bio-Rad) and the amount of dAtg8-II was divided by the total signal from both dAtg8 bands in its respective lane. Bar graphs represent ratio metric change in 15kDa (dAtg8-II) band relative to matched, untrained cohorts (paired t-test, n = 3, means ± SEM).

Given that exercised male flies increase lysosomal activity and mitochondrial turnover in the fat body [8,13] and flies with defects in fatty acid metabolism increase lipolysis following exercise [7], we tested whether flies with reduced Octβ3R expression in adult fat body also failed to upregulate autophagy by examining dAtg8-II/I ratio via Western blot. Autophagy downregulation is observed by a decrease in the dAtg8-II/I ratio, indicating a reduction in activated dAtg8-II, while restoration or upregulation is represented by an increase in the activated form [32]. We also tested exercise trained octopamine-fed flies, as both exercise and octopamine have been previously shown to increase autophagy and lipolysis in multiple flying insect species [20,33]. dAtg8-II/I ratios trend toward an increase in exercise-trained flies and were significantly higher in OA-fed whole flies, and this effect was blocked when Octβ3R was knocked down in adipose tissue (Fig 4H and 4I).

OA feeding rescues phenotypes of some, but not all, octopamine receptor knockdowns

Either 5μM octopamine (OA) feeding or intermittent OA-ergic neuron activation is sufficient to replicate exercise adaptations in sedentary Drosophila [8]. To test whether surplus OA could overcome the effects of tissue-specific octopamine receptor depletion, we repeated the RNAi experiments above but fed OA to half the flies. We selected MHC GS>Octβ2R and MHC GS>Octβ3R RNAi flies for feeding tests since these lines were directly comparable (same driver) but blocked distinct and separable exercise adaptations. Runspan was tested on day 5 post-eclosion, after 3 days of feeding with 5μM OA or vehicle and/or RU486 if Gene-Switch Gal4 was employed. Drug/vehicle feeding continued until the end of experimentation. A summary of OA-feeding+exercise results is in S1 Table. As in the first repetition, knockdown of Octβ2R in skeletal muscle prevented exercise-induced improvements. OA-fed control flies had performance characteristic of exercised flies, as previously observed [Figs 8] (S8B Fig). (Compare 5A to S1B RU-EX). However, OA-feeding did not restore the exercise response to flies lacking Octβ2R in muscle, as measured by endurance (compare Fig 5A RU+ OA-fed flies to S8B RU+) or climbing speed (Fig 5B, S8C Fig).

Fig 5 — **(A)** 5 μM OA-feeding in trained and untrained RU- *MHC GS>Octβ2R* RNAi flies increases endurance in comparison to RU+ flies (log-rank, p = 0.0298), with untrained, *MHC GS>Octβ2R* RNAi RU- flies receiving the most statistically significant benefit from OA-feeding (p = 0.0156, n = 8 vials of 20 flies for each cohort). **(B)** Similarly, OA feeding increases longitudinal climbing speed across ages in *MHC GS>Octβ2R* RNAi RU- untrained flies with the highest effectiveness (2-way ANOVA, genotype effect, p≤0.0023, n≥100 flies for each cohort, error bars = SEM), while RU+ do not increase climbing index with OA feeding or exercise. **(C)** In contrast, both OA-feeding and exercise improve landing height in *MHC GS>Octβ2R* RNAi RU- and RU+ flies, although exercise causes a slight but significant decrease in landing height in trained *MHC GS>Octβ2R* RNAi RU+, OA-fed flies (ANOVA with Tukey-post hoc, p = 0.0205, n≥139 flies, error bars = SD). **(D)** Exercise and OA-feeding confer lower failure rate in *MHC GS>Octβ2R* RNAi RU- flies when compared to *MHC GS>Octβ2R* RNAi RU+ siblings fed 5μM OA whether exercised or not (Chi-squared, p = 0.006, n≥97, error bars = SEM). **(E)** Lysosomal activity remains low in the fat body *MHC GS>Octβ2R* RNAi RU+ flies independent of exercise or OA-feeding, but is increased in the fat body of OA-fed or exercised, OA-fed *MHC GS>Octβ2R* RNAi RU- siblings (ANOVA with Tukey post-hoc, p≤0.0003, n = 10, error bars = SEM). **(F)** Representative 40X confocal image of fat-body lysotracker staining. Scale bar = 20μm.

As above, improvements to flight performance after exercise did not require Octβ2R in adult muscles (S8D Fig, Fig 3D). Both exercise training and OA feeding were able to improve flight to levels that were similar to trained control flies (Fig 5C, compare to S8D Fig). Confirming results shown above, Octβ2R was required in muscle for cardio-protective effects of exercise, and for increased adipose lysosomal activity (S8E and S8F Fig) OA-feeding was completely unable to rescue these effects, although it successfully mimics exercise in OA-fed RU- controls (Fig 5D–5F). These results indicate that Octβ2R is absolutely required in muscle for chronic exercise to increase endurance, cardiac performance and lysosomal activity, even if exogenous OA is supplied.

Octβ3R

Muscle-specific Octβ3R knockdown does not alter baseline endurance (S8G Fig). Following endurance training, Octβ3R knockdown flies again failed to increase endurance. However, they did increase performance when supplemented with OA, in both exercised and unexercised cohorts, suggesting that the requirement for Octβ3R can be partially circumvented by other receptors, if exogenous OA is present (Compare Fig 6A RU+ to S8H Fig RU+).

Fig 6 — **(A)** Endurance is improved in OA-fed *MHC GS>Octβ3R* RNAi RU- flies whether exercised or not, and RU+ OA-fed siblings have endurance that is not significantly different (log-rank, p = 0.3329, n = 8 vials of 20 flies for each cohort). **(B)** Climbing speed is similarly enhanced in OA-fed *MHC GS>Octβ3R* RNAi RU- EX and RU+ flies independent of training, although RU- UN flies fed 5μM OA receive significantly greater benefits across ages (2-way ANOVA, genotype effect, p≤0.0149, n≥100 flies for each cohort, error bars = SEM). **(C)** *MHC GS>Octβ3R* RNAi RU+ flies have lower landing height than *MHC GS>Octβ3R* RNAi RU- flies independent of OA-feeding or exercise training plus OA-feeding (ANOVA with Tukey post-hoc, p<0.0001, p = 0.0125, n≥106, error bars = SD). **(D)** *MHC GS>Octβ3R* RNAi RU+ flies, however, have equally low failure rate to *MHC GS>Octβ3R* RNAi RU- flies that are exercise trained and/or OA-fed (Chi-squared, p = 0.6264, n≥87). **(E)** Trained and untrained OA-fed *MHC GS>Octβ3R* RNAi RU- flies have high fat-body LysoTracker staining, but LysoTracker staining is low in trained and untrained *MHC GS>Octβ3R* RNAi RU+ flies (ANOVA with Tukey post-hoc, p<0.0001, n = 10, error bars = SEM). **(F)** Representative 40X confocal image of fat-body lysotracker staining. Scale bar = 20μm. For endurance tests, n = 8 vials of ≥20 flies, all experiments performed in duplicate or triplicate. Runspan graphs indicate representative repetition. For climbing speed, n≥100 flies for all climbing experiments, performed in duplicate or triplicate. Error bars indicate SEM, climbing graphs indicate representative repetition. In acute flight performance assay, n≥121 flies unless otherwise indicated in legend. Experiments performed in duplicate or triplicate, error bars indicate SD, flight graphs indicate representative repetition. n≥71 for all external electrical pacing experiments. Each performed in duplicate or triplicate. Pacing graphs are representative repetitions, error bars = SEM. LysoTracker experiments performed with n of 5–10, in duplicate or triplicate. LysoTracker graphs are representative repetitions, error bars = SEM.

Exogenous OA was able to stimulate performance of muscle-specific Octβ3R RNAi flies, with both exercised and unexercised cohorts responding to OA feeding. OA feeding also improved heart performance in MHC GS>Octβ3R RNAi flies, with exercised and unexercised RU+ groups receiving as much cardioprotection as RU- controls (Fig 6D). By contrast, OA feeding did not alter the effect of muscle-specific Octβ3R knockdown on flight performance or lysosomal activity (Fig 6C, 6E and 6F; S8J–S8L Fig).

Thus, in general, exercise adaptations that were unaffected by a specific knockdown responded to OA feeding as normal, but adaptations that required a particular receptor were not rescued by OA feeding. This strongly suggests that some receptors are specifically required for particular exercise adaptations, and not all OA receptors are interchangeable in this context.

Discussion

Octopamine signaling is a vital mediator of behavior and metabolism, and is critical for exercise adaptation in Drosophila [8,30]. OA directly affects muscle contractility in larval body wall muscle [34,35], metabolism [36], mobility in response to starvation [37] and fat storage [36], all of which may be important mechanisms modulating exercise adaptations. OA signals through various receptors that have been found to regulate essential processes from egg-laying to sleep, metabolism, learning and memory, and social aggression [38–42].

Octopamine is analogous to vertebrate norepinephrine, and noradrenergic signaling is known to be important in the human exercise response. While transient increases in OA-ergic signaling are sufficient to replicate exercise adaptation in sedentary Drosophila [8], prolonged effects of increased catecholaminergic signaling in humans would have adverse effects on blood pressure and heart rate [43,44]. Indeed, in our studies combining OA-feeding and endurance exercise, we often see less benefit than OA-feeding or exercise alone, suggesting that activation of OA-receptors may become deleterious if activated at too high a level even in invertebrate systems. Here, we demonstrate that OA acts during exercise to stimulate autophagic flux in Drosophila. Taken together, our observations suggest that adrenergic signaling is an important mechanistic part of the conserved adaptive response to endurance exercise.

Although OA-receptors are thought to act through highly conserved canonical signaling pathways [45–47], we find strong evidence that their activity is not interchangeable in the context of exercise, as has been previously demonstrated in the context of female reproduction (41). Knockdown of any of the four receptors tested here (a recently discovered receptor that responds to both OA and serotonin was not examined here [48]) eliminates some portion of the response to chronic exercise, and, in most cases, the response cannot be rescued by stimulating other receptors with OA feeding. This is true even when knockdown takes place in tissues that express multiple receptors, strongly implying that downstream effects of these receptors are not identical.

Another key finding here is that several receptor knockdowns produced clear tissue-non-autonomous effects, particularly knockdowns in skeletal or cardiac muscle. These effects could result from improved muscle and heart performance that alters the overall metabolic environment during chronic exercise; for example, improved cardiac performance could improve circulation to other tissues. An intriguing alternative, albeit non-mutually exclusive hypothesis would be that OA-receptors promote release of circulating factors from muscle or heart that affect metabolism in the fat body. These hypotheses are currently under further investigation. These results are consistent with the prior observations that restoration of exercise adaptations to female flies required masculinization of all Tdc2-expressing neurons, no smaller subset was capable of this effect (8). This strongly implies that the effect of OA is not solely mediated by a particular circuit, but at least in part requires release of OA into circulation, where it can then be received by receptors in various tissues.

An unexpected finding was the requirement for OAMB in the heart, where it has not previously been reported to be expressed. Here, OAMB reduction in heart and muscle prevented exercise-dependent adaptations in endurance, climbing speed and heart performance but did not negatively affect flight or fat body lysosomal activity. OAMB has been implicated in reward signaling [49], but more recently has been directly linked to behavior and metabolism via insulin like signaling [50] and sugar overconsumption studies [51]. Taken together, those studies and ours suggest that OAMB is modulating exercise adaptations by responding to energy needs via cell- and non-cell autonomous mechanisms. In the myocardium, OAMB may also mediate increases in heart rate during a bout of exercise itself, as adrenergic signaling increases heart rate in multiple species, including humans [26], and OA can increase larval heart rate in Drosophila [52]. It is possible that increased stimulation of heart rate may have secondary effects in other tissues by changing the rate of circulation of nutrients, hormones, or OA itself.

We find that Octβ2R and Octβ3R are important in adult Drosophila muscle for exercise adaptations to endurance and climbing speed. Both muscle-specific knockdowns also have tissue non-autonomous effects on the fat body. When we combine OA-feeding with exercise, we see a partial rescue of both climbing and endurance in Octβ3R knockdowns, an improvement that is not seen during exercise alone. This suggests that, unlike the other receptors tested here, Octβ3R activity is partially redundant and can be supplemented by other receptors if ligand dose is high enough.

Adding further complexity to mapping the specific roles of each receptor, there are several cases where tissue-specific knockdowns produce effects that are not predicted by the results of ubiquitous knockdown. For example, we find that fat-specific knockdown of Octβ3R blocks increased Lysotracker activity during exercise, which is surprising because we previously reported that ubiquitous knockdown of Octβ3R does not (8). Under wild-type conditions, Octβ3R is the primary OA receptor in adipose tissue. It could be that disruption of Octβ3R in both muscle and fat induces compensatory effects to maintain lysosomal activity in the absence of Octβ3R. Alternately, it is possible that the highly efficient and consistent knockdown provided by the ubiquitous Tub5-Gal4 induces a compensatory response that is not induced by the gradually accumulating knockdown driven by S106-Gal4 (S1 Fig). This phenomenon was not limited to Octβ3R knockdown, as muscle-specific Octβ1R knockdown unexpectedly reduced endurance more than ubiquitous Octβ1R knockdown. Whereas the role of OA in stimulating lipolysis is thought to involve signaling through PKA/cAMP, OA also regulates muscle contractility through its effects on Ca²⁺/IP3/CaMK signaling [53]. It may be that knockdowns of different strength or in different tissue combinations affect signaling through these pathways differentially. Alternately, tissue-non-autonomous effects of OA receptors may contribute to differences in these phenotypes in complex ways. Further investigation of downstream factors activated through OA-ergic signaling in different tissues during exercise and how those change during various manipulations will be necessary to resolve these questions unambiguously.

Octβ1R reduction in muscle or heart produced the most broadly deleterious phenotypes of all, reducing endurance as early as day 5, and negatively affecting all parameters of exercise adaptation. It is worth noting that Octβ1R transcript was previously found to be upregulated in both endurance-exercised and longevity selected flies, indicating its importance in the preservation of healthy physiology [5].

We have successfully mapped several specific adrenergic receptor requirements for endurance exercise adaptations in Drosophila (Fig 7). Further understanding of tissue-specific requirements for adrenergic signaling moves us closer to comprehensive mechanisms that govern exercise responses and potentially contribute to genetic differences in individual exercise responses.

Materials and methods

Fly stocks and maintenance

All fly lines were reared and aged at 25°C; 50% humidity with a 12-hour light-dark cycle and provided with a standard 10% yeast/10% sucrose diet unless otherwise indicated. All RNAi lines were validated in combination with each driver before and after exercise. All Drosophila lines were from the Bloomington Drosophila Stock Center or Vienna Drosophila RNAi Center with the following exceptions: hand GS Gal4 and MHC GS were obtained from Rolf Bodmer (Sanford Burnham Medical Research Institute) and S106 GS was obtained from Marc Tatar (Brown University). BDSC lines were w¹¹¹⁸ (BDSC3605) and OAMB RNAi (BS31171). VDRC lines were Octβ1R RNAi (v47895), Octβ2R RNAi (v8486) and Octβ3R RNAi (v101189). All driver lines have been previously characterized [54–56]. All experiments were performed using Gene-switch Gal4. For Gene-switch experiments, genetic background effects were controlled for by using RU- flies of the same background as the negative control. Raw data from all experiments throughout the manuscript is provided in S10 Fig.

Drug treatment

For gene-switch experiments, adult progeny were age-matched by collecting within 2 hours of eclosion over a 72 hour time period and immediately transferred into vials containing 5mL standard medium. Populations were split into control RU- and experimental RU+ groups on the 2^nd day and transferred into vials containing 5mL medium containing either 70% ethanol vehicle or 100 μM mifepristone (RU486) (Cayman Chemical, Ann Arbor, MI), respectively. Experimental and control flies were then housed at 25ºC on either RU486 or vehicle until experimentation.

Flies fed octopamine were treated similarly to gene-switch experiments but were collected within a single 24-hour window immediately after eclosion and housed on SY10 food containing 5 μg/mL octopamine (Sigma-Aldrich, St. Louis, MO), or an equal volume of ddH₂O vehicle.

Exercise training

Cohorts of at least 800 flies were collected under light CO₂ anesthesia within 2 hours of eclosion and separated into vials of 20. Flies were then further separated into 2 large cohorts of at least 400 flies divided into exercised and unexercised groups. If OA-feeding was employed, cohort size was doubled, and flies were divided into 4 cohorts: OA/UN, OA/EX, Vehicle/UN, Vehicle/EX. The unexercised groups were placed on the exercise training device but were prevented from running by the placement of a foam stopper low in the vial. The stopper is returned to the top of the vial at the conclusion of daily training. The exercise device drops the vials of flies every 15 seconds, inducing a repetitive negative geotaxis response. Exercised flies are free to run to the top of the vial. Daily time of exercise followed the previously described ramped program [11].

All exercised and unexercised cohorts were assessed for speed, endurance, cardiac performance, flight, and fat body Lysotracker.

Endurance

Climbing endurance was measured using the fatigue assay described previously [9]. Eight or sixteen vials of flies from each cohort were subjected to the fatigue assay at two time points: once on day 5 and once on day 25 of adulthood. For each assessment, the flies were placed on the Power Tower exercise machine and made to climb until they were fatigued. Monitored at 15 min intervals, a vial of flies was visually determined to be fatigued when 20% or fewer flies could climb higher than 1 cm after four consecutive drops. A minimum of 8 vials containing 20 flies each was used for each fatigue assessment with each vial plotted as a single datum. Each experiment was performed in duplicate or triplicate, and runspans were scored blindly when possible. The time from the start of the assay to the time of fatigue was recorded for each vial, and the data analyzed using log-rank analysis in GraphPad Prism (San Diego, CA, USA).

Climbing speed

Adult flies were collected with light CO₂ anesthesia within 2 hours of eclosion and housed in appropriate fresh food vials. Negative geotaxis was assessed in Rapid Negative Geotaxis (RING) assays in groups of 100 flies as described [9]. Flies were transferred to individual polypropylene vials in a RING apparatus and allowed to equilibrate for 1 minute. Negative geotaxis was elicited by sharply rapping the RING apparatus four times in rapid succession. The positions of the flies were captured in digital images taken 2s after stimulus. Images were analyzed using ImageJ (Bethesda, MD). The distance climbed by each fly was converted into quadrants using Microsoft Excel. The performance of each vial of 20 flies was calculated as the average of four consecutive trials to generate a single datum. Flies were longitudinally tested 5 times per week for 4–5 weeks to assess decline in negative geotaxis speed with age. Data were further consolidated into weekly performance. Between assessments, flies were returned to food vials and housed until the following RING test. Negative geotaxis results were analyzed using two-way ANOVA analysis with post hoc Tukey multiple comparison tests in GraphPad Prism (San Diego, CA, USA). All negative geotaxis experiments were performed in duplicate or triplicate.

Flight performance

Flight was analyzed as in Sujkowski et al. 2017 [8]. Duplicate or triplicate cohorts of at least 50 flies were exercise trained in narrow vials housing groups of 20 age-matched siblings. Acrylic sheeting with paintable adhesive was placed in the flight tube, and fly cohorts were ejected into the apparatus to record flight performance and subsequent landing height after release. Fly cohorts were introduced to the flight tester one vial at a time using a gravity-dependent drop tube in order to reduce variability. After a full cohort of flies was captured on the adhesive, the sheeting was removed to a white surface in order to digitally record the landing height of each fly. Flies with damaged wings were censored from final analysis to control for mechanical stress not related to training performance. Images were analyzed using ImageJ. Landing height was averaged and compared in Prism using ANOVA with Tukey post-hoc comparison.

Cardiac pacing

25-day old flies were removed from appropriate experimental cohorts and subjected to electrical pacing as in Wessells et al. [57]. The percentage of fly hearts that responded to pacing with either fibrillation or arrest were recorded as “% failure”. Pacing-induced failure rate is a marker for stress sensitivity and characteristically declines with age [31,58]. Endurance exercise reduces cardiac failure rate across ages in trained male Drosophila [7,11,31]. Failing hearts are scored as “1” and hearts that respond to pacing stress with normal beating are scored as “0”. Averages are analyzed by Chi-squared test for binary variables.

Lysotracker

Lysotracker staining of adult fat bodies was performed as in Sujkowski et al. [8]. Adult flies separated by age, genotype, and or treatment were dissected, ventral side up, in room temperature PBS. Having exposed fat bodies, partially dissected flies were rinsed 1X in fresh PBS. Lysotracker green (Molecular Probes, Eugene, OR) was diluted to 0.01μM in PBS and applied to dissected preps for 30 seconds. Samples were washed 3 times in fresh PBS. Stained fat bodies were subsequently removed and mounted in Vectashield reagent (Vector Laboratories, Burlingame, CA, USA). Confocal imaging was done in the Department of Physiology Confocal Microscopy Core at Wayne State School of Medicine on a Leica DMI 6000 with a Crest X-light spinning disc confocal using a 63X oil immersion objective or widefield fluorescent 40X objective. Images were analyzed using ImageJ. A minimum of 10 samples were analyzed for each sample and duplicate or triplicate biological cohorts were assessed for each group. Data were subjected to ANOVA with Tukey post-hoc.

Western Blotting

Triplicate biological cohorts of 3 whole flies per genotype/treatment were homogenized in boiling lysis buffer (50 mM Tris pH 6.8, 2% SDS, 10% glycerol, 100 mM dithiothreitol), sonicated for 15 seconds, boiled for 10 min, and centrifuged at 13,300 × g at room temperature for 10 min. Samples were electrophoresed on 4–20% gradient gels (Bio-Rad). Western blots were developed using the ChemiDoc system (Bio-Rad). Direct blue staining was used for total protein loading: PVDF membranes were submerged for 5 min in 0.008% Direct Blue 71 (Sigma-Aldrich) in 40% ethanol and 10% acetic acid. PVDF membranes were then rinsed briefly in 40% ethanol and 10% acetic acid solvent, then ultrapure water, air dried, and imaged using the ChemiDoc system. Anti-dAtg8a antibody (ab109364) was from obtained from Abcam. Blots were quantified using ImageLab software (Bio-Rad).

qRT PCR

RNAi efficacy was confirmed tissue-specifically pre- and post-exercise for all Gal4-UAS RNAi combinations tested (S1A–S1C Fig). To control for non-specific effects of RNAi, physiological assessments for Gal4-UAS RNAi combinations in absence of receptor expression are included as S2–S7 Figs. cDNA was prepared using a Cells to CT Kit (Invitrogen) from 20 adult fly hearts, or indirect flight muscle (IFM) or fat body from 5 adult flies. Two independent cDNA extractions were prepared for each sample. Differences between genotypes were assessed by ANOVA. Primer sequences are listed below.

5’ OAMB- CGGTTAACGCCAGCAAGTG

3’ OAMB- AAGCTGCACGAAATAGCTGC

5’Octβ1R GGCAACGAGTAACGGTTTGG

3’ Octβ1R TCATGGTAATGGTCACGGGC

5’Octβ2R TTAGTGTGCAAGTAACTGGGC

3’ Octβ2R TGAGAAGTAGACATCGAGGCTG

5’Octβ3R TGTGGTCAACAAGGCCTACG

3’ Octβ3R GTGTTCGGCGCTGTTAAGGA

5’ act5C GGCGCAGAGCAAGCGTGGTA

3’ act5C GGGTGCCACACGCAGCTCAT

Relative message abundance was determined by amplification and staining with SYBR Green I using an ABI 7300 Real Time PCR System (Applied Biosystems). Expression of Actin5c and corresponding RU- control flies were used for normalization.

Supporting information

S1 Fig. Confirmation of RNAi efficacy in target tissues.

Bars represent triplicate samples consisting of (A) 20 hearts, or samples from 5 flies consisting of (B) IFM or (C) adult fat body. Samples were assigned to exercised and unexercised groups and collected at 72 hours, prior to the first endurance test, and 25 days, after the conclusion of exercise training. qRT-PCR was performed after cDNA isolation from aforementioned tissues. Relative expression is calculated as ΔΔCT and analyzed using ANOVA with Tukey post-hoc. Gene expression is expressed in relation to uninduced RU- controls. See methods for primer sequences, isolation, purification and reaction conditions.

(TIFF)

Click here for additional data file.^{(348.4KB, tiff)}

S2 Fig. Baseline endurance is unaffected by non-specific RNAi effects.

Neither Octβ2R nor Octβ3R were detected in adult Drosophila heart (A, B), and OAMB, Octβ1R and Octβ2R (C-E) transcripts were not detectable in adult fat body. Day 5 endurance in RU+ flies of each of the aforementioned genotypes were not statistically different from their RU- control flies of the same age.

(TIFF)

Click here for additional data file.^{(886.1KB, tiff)}

S3 Fig. Post-training endurance is unaffected by non-specific RNAi effects.

hand GS>Octβ2R RNAi and hand GS>Octβ3R RNAi RU+ flies respond to exercise with improved endurance (A, B) as do S106 GS>OAMB RNAi, S106 GS>Octβ1R RNAi and S106 GS>Octβ2R RNAi flies (C-E). (log-rank, p-values indicated in panels).

(TIFF)

Click here for additional data file.^{(1.2MB, tiff)}

S4 Fig. Negative RNAi controls adapt to exercise with increases in climbing speed.

Both RU+ flies and uninduced RU- controls respond to exercise training with faster climbing speed across ages in (A) hand GS>Octβ2R RNAi, (B) hand GS>Octβ3R RNAi (C) S106 GS>OAMB RNAi, (D) S106 GS>Octβ1R RNAi and (E) S106 GS>Octβ2R RNAi groups. (2-way ANOVA, exercise effect, p<0.0001 after week 2, all groups).

(TIFF)

Click here for additional data file.^{(928.5KB, tiff)}

S5 Fig. Flight performance is increased in exercise-trained RNAi negative control flies.

Landing height is higher in exercise trained RU- and RU+ A) hand GS>Octβ2R RNAi, (B) hand GS>Octβ3R RNAi (C) S106 GS>OAMB RNAi, (D) S106 GS>Octβ1R RNAi and (E) S106 GS>Octβ2R RNAi flies. (ANOVA with Tukey multiple comparisons, p values indicated in panels).

(TIFF)

Click here for additional data file.^{(1.1MB, tiff)}

S6 Fig. No non-specific RNAi effects on post-training adaptations to cardiac stress resistance.

hand GS>Octβ2R RNAi and hand GS>Octβ3R RNAi RU+ flies respond to exercise with improved tolerance to external cardiac pacing (A, B) as do S106 GS>OAMB RNAi, S106 GS>Octβ1R RNAi and S106 GS>Octβ2R RNAi flies (C-E). (Chi-squared, p values indicated in panels).

(TIFF)

Click here for additional data file.^{(1.3MB, tiff)}

S7 Fig. Fat body LysoTracker staining is increased exercise-trained RNAi negative control flies.

LysoTracker staining is higher in exercise trained RU- and RU+ A) hand GS>Octβ2R RNAi, (B) hand GS>Octβ3R RNAi (C) S106 GS>OAMB RNAi, (D) S106 GS>Octβ1R RNAi and (E) S106 GS>Octβ2R RNAi flies. (ANOVA with Tukey multiple comparisons, p values indicated in panels).

(TIFF)

Click here for additional data file.^{(1.3MB, tiff)}

S8 Fig. Vehicle-fed MHC GS>OctR RNAi flies have reductions in endurance, speed, cardiac stress resistance and fat body LysoTracker staining.

(A) MHC GS>Octβ2R RNAi RU- and RU+ flies fed 5μM OA or vehicle for 72 hours have equivalent endurance at day 5-post eclosion (log-rank, p = 0.2790, n = 16 vials of 20 flies for each cohort). (B) OA-fed MHC GS>Octβ2R RNAi RU+ flies have endurance similar to untrained, vehicle-fed RU- flies whether exercised or not (log-rank, p≥0.2558). Uninduced, vehicle-fed exercised controls retain better endurance than unexercised siblings (log-rank, p = 0.0439, n = 8 vials of 20 flies for all cohorts). (C) Exercise-trained, vehicle-fed MHC GS>Octβ2R RNAi RU- flies have faster climbing than unexercised, vehicle-fed siblings across ages (2-way ANOVA, exercise effect, p<0.0001). Both exercised and unexercised vehicle-fed MHC GS>Octβ2R RNAi have reduced climbing speed in comparison to RU- groups up to the second week of training (2-way ANOVA, genotype effect, p<0.0001) and do not improve with training or vehicle feeding, having similar climbing speed to untrained, RU- vehicle-fed groups in later weeks (n≥100 for all cohorts, error bars = SEM). (D) Vehicle feeding does not affect adaptation to flight performance after exercise in either MHC GS>Octβ2R RNAi RU- or MHC GS>Octβ2R RNAi RU+ flies, as both increase landing height in comparison to unexercised siblings (ANOVA with Tukey post-hoc, p<0.0001, n≥119, error bars = SD). (E) Cardiac failure rate in response to external electrical pacing is lower in exercise-trained, vehicle-fed MHC GS>Octβ2R RNAi RU- flies compared to age-matched, untrained siblings (Chi-squared, p = 0.0396). Vehicle-fed MHC GS>Octβ2R RNAi RU+ flies do not improve cardiac stress response after training (Chi-squared, p = 0.5367, n≥95, error bars = SEM). (F) Lysosomal activity remains similar to untrained siblings in the fat body of vehicle-fed, exercise-trained MHC GS>Octβ2R RNAi RU+ flies, but is increased in vehicle-fed, exercised RU- flies (ANOVA with Tukey post-hoc, p≤0.0304, n = 10, error bars = SEM). (G) MHC GS>Octβ3R RNAi RU- and RU+ flies fed 5μM OA or vehicle for 72 hours have equivalent endurance at day 5-post eclosion (log-rank, p = 0.9092, n = 16 vials of 20 flies for each cohort). (H) OA-fed MHC GS>Octβ3R RNAi RU+ flies have endurance similar to untrained, vehicle-fed RU- flies whether exercised or not (log-rank, p≥0.2204). Uninduced, vehicle-fed exercised controls retain better endurance than unexercised siblings (log-rank, p = 0.0401, n = 8 vials of 20 flies for all cohorts). (I) Exercise-trained, vehicle-fed MHC GS>Octβ3R RNAi RU- flies have faster climbing than unexercised, vehicle-fed siblings across ages (2-way ANOVA, exercise effect, p<0.0001). Both exercised and unexercised vehicle-fed MHC GS>Octβ3R RNAi have reduced climbing speed in comparison to RU- groups in the first week of training (2-way ANOVA, genotype effect, p<0.0001) and do not improve with training or vehicle feeding, having similar or worse climbing speed than untrained, RU- vehicle-fed groups in later weeks (n≥100 for all cohorts, error bars = SEM). (J) Vehicle feeding does not affect adaptation to flight performance after exercise in MHC GS>Octβ3R RNAi RU- flies, but MHC GS>Octβ3R RNAi RU+ flies have flight performance similar to vehicle-fed, untrained RU- flies whether exercised or not (ANOVA with Tukey post-hoc, p = 0.0001,, p≥0.2216), n≥117, error bars = SD). (K) Exercise adaptations to cardiac stress resistance in response to external electrical pacing are not affected by vehicle feeding in MHC GS>Octβ3R RNAi RU- or RU+ flies compared to age-matched, untrained siblings, and both trained groups have lower failure rates after training (Chi-squared, p = 0.0373, RU- EX, p = 0.0003, RU+EX, n≥100, error bars = SEM). (L) Lysosomal activity remains similar to untrained siblings in the fat body of vehicle-fed, exercise-trained MHC GS>Octβ3R RNAi RU+ flies, but is increased in vehicle-fed, exercised RU- flies (ANOVA with Tukey post-hoc, p≤0.0001, n = 10, error bars = SEM).

(TIFF)

Click here for additional data file.^{(1.9MB, tiff)}

S9 Fig. Representative 40X Fat Body Lysotracker Images.

Accompanying confocal images for lysotracker quantifications in main Figs 1–3. Scale bars = 20μm.

(TIFF)

Click here for additional data file.^{(6.6MB, tiff)}

S10 Fig. Raw Data file.

Raw data is presented as a spreadsheet with one page for each main figure and supplemental figure. Within each page, experimental data is labelled by subheadings for assessment and genotype.

(XLSX)

Click here for additional data file.^{(230.4KB, xlsx)}

S1 Table. Summary Statistics of combinatorial treatment of 5μM OA feeding plus exercise training in selected RNAi lines.

(DOCX)

Click here for additional data file.^{(18.1KB, docx)}

Acknowledgments

We acknowledge the Bloomington Stock Center for providing fly lines and FlyBase for sequence and genome information.

Data Availability

All relevant data are within the manuscript and its supporting information files.

Funding Statement

Funding for this work was provided by R01NS086778 to SVT, NIH 1RO1AG059683 to R.W. and by a Physiology Department Summer Research Fellowship Award to N.S www.med.wayne.edu/physiology/SURF. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Topp R, Fahlman M, Boardley D. Healthy aging: health promotion and disease prevention. Nurs Clin North Am. 2004;39(2):411–22. 10.1016/j.cnur.2004.01.007 . [DOI] [PubMed] [Google Scholar]
2.Booth FW, Roberts CK, Laye MJ. Lack of exercise is a major cause of chronic diseases. Compr Physiol. 2012;2(2):1143–211. 10.1002/cphy.c110025 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Strasser B. Physical activity in obesity and metabolic syndrome. Ann N Y Acad Sci. 2013;1281:141–59. 10.1111/j.1749-6632.2012.06785.x [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Wilmot EG, Edwardson CL, Achana FA, Davies MJ, Gorely T, Gray LJ, et al. Sedentary time in adults and the association with diabetes, cardiovascular disease and death: systematic review and meta-analysis. Diabetologia. 2012;55(11):2895–905. 10.1007/s00125-012-2677-z . [DOI] [PubMed] [Google Scholar]
5.Sujkowski A, Bazzell B, Carpenter K, Arking R, Wessells RJ. Endurance exercise and selective breeding for longevity extend Drosophila healthspan by overlapping mechanisms. Aging (Albany NY). 2015;7(8):535–52. 10.18632/aging.100789 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Coffey VG, Hawley JA. The molecular bases of training adaptation. Sports medicine. 2007;37(9):737–63. Epub 2007/08/29. 3791 [pii]. 10.2165/00007256-200737090-00001 . [DOI] [PubMed] [Google Scholar]
7.Sujkowski A, Saunders S, Tinkerhess M, Piazza N, Jennens J, Healy L, et al. dFatp regulates nutrient distribution and long-term physiology in Drosophila. Aging cell. 2012;11(6):921–32. 10.1111/j.1474-9726.2012.00864.x [DOI] [PMC free article] [PubMed] [Google Scholar]
8.Sujkowski A, Ramesh D, Brockmann A, Wessells R. Octopamine Drives Endurance Exercise Adaptations in Drosophila. Cell reports. 2017;21(7):1809–23. 10.1016/j.celrep.2017.10.065 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Damschroder D, Cobb T, Sujkowski A, Wessells R. Drosophila Endurance Training and Assessment and Its Effects on Systemic Adaptations. BioProtocols. 2017. 10.21769/BioProtoc.3037 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Mendez S, Watanabe L, Hill R, Owens M, Moraczewski J, Rowe GC, et al. The TreadWheel: A Novel Apparatus to Measure Genetic Variation in Response to Gently Induced Exercise for Drosophila. PLoS One. 2016;11(10):e0164706 10.1371/journal.pone.0164706 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Piazza N, Gosangi B, Devilla S, Arking R, Wessells R. Exercise-training in young Drosophila melanogaster reduces age-related decline in mobility and cardiac performance. PLoS One. 2009;4(6):e5886 Epub 2009/06/12. 10.1371/journal.pone.0005886 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Tinkerhess MJ, Ginzberg S, Piazza N, Wessells RJ. Endurance training protocol and longitudinal performance assays for Drosophila melanogaster. J Vis Exp. 2012;(61). Epub 2012/04/05. 10.3791/37863786 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Laker RC, Xu P, Ryall KA, Sujkowski A, Kenwood BM, Chain KH, et al. A novel MitoTimer reporter gene for mitochondrial content, structure, stress, and damage in vivo. J Biol Chem. 2014;289(17):12005–15. 10.1074/jbc.M113.530527 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Sujkowski A, Spierer AN, Rajagopalan T, Bazzell B, Safdar M, Imsirovic D, et al. Mito-nuclear interactions modify Drosophila exercise performance. Mitochondrion. 2019;47:188–205. 10.1016/j.mito.2018.11.005 . [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Fluck M., Functional structural and molecular plasticity of mammalian skeletal muscle in response to exercise stimuli. J Exp Biol. 2006;209(Pt 12):2239–48. 10.1242/jeb.02149 . [DOI] [PubMed] [Google Scholar]
16.Han KA, Millar NS, Davis RL. A novel octopamine receptor with preferential expression in Drosophila mushroom bodies. J Neurosci. 1998;18(10):3650–8. 10.1523/JNEUROSCI.18-10-03650.1998 . [DOI] [PMC free article] [PubMed] [Google Scholar]
17.El-Kholy S, Stephano F, Li Y, Bhandari A, Fink C, Roeder T. Expression analysis of octopamine and tyramine receptors in Drosophila. Cell Tissue Res. 2015;361(3):669–84. 10.1007/s00441-015-2137-4 . [DOI] [PubMed] [Google Scholar]
18.Hirashima A, Sukhanova M, Rauschenbach I. Genetic control of biogenic-amine systems in Drosophila under normal and stress conditions. Biochem Genet. 2000;38(5–6):167–80. . [PubMed] [Google Scholar]
19.Adamo SA, Linn CE, Hoy RR. The Role of Neurohormonal Octopamine during Fight or Flight Behavior in the Field Cricket Gryllus-Bimaculatus. Journal of Experimental Biology. 1995;198(8):1691–700. WOS:A1995RM22400007. [DOI] [PubMed] [Google Scholar]
20.Orchard I, Ramirez JM, Lange AB. A Multifunctional Role for Octopamine in Locust Flight. Annual Review of Entomology. 1993;38:227–49. 10.1146/annurev.en.38.010193.001303 WOS:A1993KF69700011. [DOI] [Google Scholar]
21.Vanheusden MC, Vanderhorst DJ, Beenakkers AMT. Invitro Studies on Hormone-Stimulated Lipid Mobilization from Fat-Body and Interconversion of Hemolymph Lipoproteins of Locusta-Migratoria. Journal of Insect Physiology. 1984;30(8):685–&. 10.1016/0022-1910(84)90054-4 WOS:A1984TG34500012. [DOI] [Google Scholar]
22.Bukowiecki L, Lupien J, Follea N, Paradis A, Richard D, LeBlanc J. Mechanism of enhanced lipolysis in adipose tissue of exercise-trained rats. Am J Physiol. 1980;239(6):E422–9. 10.1152/ajpendo.1980.239.6.E422 . [DOI] [PubMed] [Google Scholar]
23.Hedrington MS, Davis SN. Sexual Dimorphism in Glucose and Lipid Metabolism during Fasting, Hypoglycemia, and Exercise. Front Endocrinol (Lausanne). 2015;6:61 10.3389/fendo.2015.00061 [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Zouhal H, Jacob C, Delamarche P, Gratas-Delamarche A. Catecholamines and the effects of exercise, training and gender. Sports medicine. 2008;38(5):401–23. 10.2165/00007256-200838050-00004 . [DOI] [PubMed] [Google Scholar]
25.Shepherd JT. Circulatory response to exercise in health. Circulation. 1987;76(6 Pt 2):VI3–10. . [PubMed] [Google Scholar]
26.Tank AW, Lee Wong D. Peripheral and central effects of circulating catecholamines. Comprehensive Physiology. 2015;5(1):1–15. 10.1002/cphy.c140007 . [DOI] [PubMed] [Google Scholar]
27.Ahles A, Engelhardt S. Polymorphic variants of adrenoceptors: pharmacology, physiology, and role in disease. Pharmacological reviews. 2014;66(3):598–637. 10.1124/pr.113.008219 . [DOI] [PubMed] [Google Scholar]
28.Chick TW, Halperin AK, Gacek EM. The effect of antihypertensive medications on exercise performance: a review. Medicine and science in sports and exercise. 1988;20(5):447–54. . [PubMed] [Google Scholar]
29.Davis E, Loiacono R, Summers RJ. The rush to adrenaline: drugs in sport acting on the beta-adrenergic system. British journal of pharmacology. 2008;154(3):584–97. 10.1038/bjp.2008.164 [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Sujkowski A, Wessells R. Using Drosophila to Understand Biochemical and Behavioral Responses to Exercise. Exercise and sport sciences reviews. 2018;46(2):112–20. 10.1249/JES.0000000000000139 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Sujkowski A, Wessells R. Drosphila Models of Cardiac Aging and Disease. In: Vaiserman A, Moskalev A, Pasyukova J, editors. Life Extension: Lessons from Drosophila. Healthy Ageing and Longevity. Switzerland: Springer; 2015. p. 127–50. [Google Scholar]
32.Kim JS, Ro SH, Kim M, Park HW, Semple IA, Park H, et al. Sestrin2 inhibits mTORC1 through modulation of GATOR complexes. Sci Rep. 2015;5:9502 Epub 2015/03/31. 10.1038/srep09502 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Li Y, Hoffmann J, Li Y, Stephano F, Bruchhaus I, Fink C, et al. Octopamine controls starvation resistance, life span and metabolic traits in Drosophila. Sci Rep. 2016;6:35359 10.1038/srep35359 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Saraswati S, Fox LE, Soll DR, Wu CF. Tyramine and octopamine have opposite effects on the locomotion of Drosophila larvae. Journal of neurobiology. 2004;58(4):425–41. 10.1002/neu.10298 . [DOI] [PubMed] [Google Scholar]
35.Selcho M, Pauls D, El Jundi B, Stocker RF, Thum AS. The role of octopamine and tyramine in Drosophila larval locomotion. J Comp Neurol. 2012;520(16):3764–85. 10.1002/cne.23152 . [DOI] [PubMed] [Google Scholar]
36.Li Y, Tiedemann L, von Frieling J, Nolte S, El-Kholy S, Stephano F, et al. The Role of Monoaminergic Neurotransmission for Metabolic Control in the Fruit Fly Drosophila Melanogaster. Front Syst Neurosci. 2017;11:60 10.3389/fnsys.2017.00060 [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Yang Z, Yu Y, Zhang V, Tian Y, Qi W, Wang L. Octopamine mediates starvation-induced hyperactivity in adult Drosophila. Proc Natl Acad Sci U S A. 2015;112(16):5219–24. 10.1073/pnas.1417838112 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Watanabe K, Chiu H, Pfeiffer BD, Wong AM, Hoopfer ED, Rubin GM, et al. A Circuit Node that Integrates Convergent Input from Neuromodulatory and Social Behavior-Promoting Neurons to Control Aggression in Drosophila. Neuron. 2017;95(5):1112–+. 10.1016/j.neuron.2017.08.017 WOS:000408687900017. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Wu CL, Shih MF, Lee PT, Chiang AS. An octopamine-mushroom body circuit modulates the formation of anesthesia-resistant memory in Drosophila. Current biology: CB. 2013;23(23):2346–54. 10.1016/j.cub.2013.09.056 . [DOI] [PubMed] [Google Scholar]
40.Li Y, Fink C, El-Kholy S, Roeder T. The octopamine receptor octss2R is essential for ovulation and fertilization in the fruit fly Drosophila melanogaster. Archives of insect biochemistry and physiology. 2015;88(3):168–78. 10.1002/arch.21211 . [DOI] [PubMed] [Google Scholar]
41.Lim J, Sabandal PR, Fernandez A, Sabandal JM, Lee HG, Evans P, et al. The octopamine receptor Octbeta2R regulates ovulation in Drosophila melanogaster. PloS one. 2014;9(8):e104441 10.1371/journal.pone.0104441 [DOI] [PMC free article] [PubMed] [Google Scholar]
42.Erion R, DiAngelo JR, Crocker A, Sehgal A. Interaction between sleep and metabolism in Drosophila with altered octopamine signaling. The Journal of biological chemistry. 2012;287(39):32406–14. 10.1074/jbc.M112.360875 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Brum PC, Rolim NP, Bacurau AV, Medeiros A. Neurohumoral activation in heart failure: the role of adrenergic receptors. An Acad Bras Cienc. 2006;78(3):485–503. 10.1590/s0001-37652006000300009 . [DOI] [PubMed] [Google Scholar]
44.Leosco D, Parisi V, Femminella GD, Formisano R, Petraglia L, Allocca E, et al. Effects of exercise training on cardiovascular adrenergic system. Front Physiol. 2013;4:348 10.3389/fphys.2013.00348 [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Nall A, Sehgal A. Monoamines and sleep in Drosophila. Behav Neurosci. 2014;128(3):264–72. 10.1037/a0036209 . [DOI] [PubMed] [Google Scholar]
46.Roeder T. Tyramine and octopamine: ruling behavior and metabolism. Annu Rev Entomol. 2005;50:447–77. 10.1146/annurev.ento.50.071803.130404 . [DOI] [PubMed] [Google Scholar]
47.Hoff M, Balfanz S, Ehling P, Gensch T, Baumann A. A single amino acid residue controls Ca2+ signaling by an octopamine receptor from Drosophila melanogaster. FASEB J. 2011;25(7):2484–91. 10.1096/fj.11-180703 [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Qi YX, Xu G, Gu GX, Mao F, Ye GY, Liu W, et al. A new Drosophila octopamine receptor responds to serotonin. Insect Biochem Mol Biol. 2017;90:61–70. Epub 2017/09/26. 10.1016/j.ibmb.2017.09.010 . [DOI] [PubMed] [Google Scholar]
49.Burke CJ, Huetteroth W, Owald D, Perisse E, Krashes MJ, Das G, et al. Layered reward signalling through octopamine and dopamine in Drosophila. Nature. 2012;492(7429):433–+. 10.1038/nature11614 WOS:000312488200057. [DOI] [PMC free article] [PubMed] [Google Scholar]
50.Luo J, Lushchak OV, Goergen P, Williams MJ, Nassel DR. Drosophila insulin-producing cells are differentially modulated by serotonin and octopamine receptors and affect social behavior. PloS one. 2014;9(6):e99732 10.1371/journal.pone.0099732 [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Branch A, Zhang Y, Shen P. Genetic and Neurobiological Analyses of the Noradrenergic-like System in Vulnerability to Sugar Overconsumption Using a Drosophila Model. Scientific reports. 2017;7(1):17642 10.1038/s41598-017-17760-w [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Johnson E, Ringo J, Dowse H. Modulation of Drosophila heartbeat by neurotransmitters. Journal of comparative physiology B, Biochemical, systemic, and environmental physiology. 1997;167(2):89–97. 10.1007/s003600050051 . [DOI] [PubMed] [Google Scholar]
53.Wang ZW, Hayakawa Y, Downer RGH. Factors Influencing Cyclic-Amp and Diacylglycerol Levels in Fat-Body of Locusta-Migratoria. Insect Biochemistry. 1990;20(4):325–30. WOS:A1990DQ56200001. [Google Scholar]
54.Viswanathan MC, Blice-Baum AC, Schmidt W, Foster DB, Cammarato A. Pseudo-acetylation of K326 and K328 of actin disrupts Drosophila melanogaster indirect flight muscle structure and performance. Front Physiol. 2015;6:116 Epub 2015/05/15. 10.3389/fphys.2015.00116 [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Hwangbo DS, Gershman B, Tu MP, Palmer M, Tatar M. Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature. 2004;429(6991):562–6. Epub 2004/06/04. 10.1038/nature02549 . [DOI] [PubMed] [Google Scholar]
56.Monnier V, Iche-Torres M, Rera M, Contremoulins V, Guichard C, Lalevee N, et al. dJun and Vri/dNFIL3 are major regulators of cardiac aging in Drosophila. PLoS Genet. 2012;8(11):e1003081 Epub 2012/12/05. 10.1371/journal.pgen.1003081 [DOI] [PMC free article] [PubMed] [Google Scholar]
57.Wessells RJ, Fitzgerald E, Cypser JR, Tatar M, Bodmer R. Insulin regulation of heart function in aging fruit flies. Nat Genet. 2004;36(12):1275–81. Epub 2004/11/27. ng1476 [pii] 10.1038/ng1476 . [DOI] [PubMed] [Google Scholar]
58.Wessells RJ, Bodmer R. Screening assays for heart function mutants in Drosophila. BioTechniques. 2004;37(1):58–60, 2, 4 passim. Epub 2004/07/31. 10.2144/04371ST01 . [DOI] [PubMed] [Google Scholar]

PLoS Genet. doi: 10.1371/journal.pgen.1008778.r001

Decision Letter 0

Gregory P Copenhaver, Hua Bai

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present.

16 Sep 2019

Dear Dr Wessells,

Thank you very much for submitting your Research Article entitled 'Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review again a much-revised version. We anticipate that the revision will require additional experimentation (see below). We cannot, of course, promise publication at that time.

Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

Please carefully and thoroughly address all reviewer comments, especially the serious concerns listed below.

Description and verification of the Gal4 lines (Reviewer #1). Discuss the mechanistic insights on how octopamine receptors regulate exercise response (Reviewer #1 & #3). Provide rationale for each experiment (Reviewer #2). Tissue-specificity of the Gal4 lines (Reviewer #2). Verification of RNAi knockdown efficacy (Reviewer #2 & #3). Several conclusions need to be revised to match to the results (Reviewer #2). Use other autophagy markers to verify lysotracker results (Reviewer #3).

If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see our guidelines.

Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission.

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.

To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.

Yours sincerely,

Hua Bai, Ph.D.

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: In this manuscript, Sujkowski et al. build upon previous work demonstrating OA is necessary for exercise adaptations following endurance training in Drosophila by identifying which octopamine receptors are required for these adaptations. They found that OAb2R is required in adult muscle while OAMB is necessary in the heart. The authors demonstrate adrenergic signaling is key to the adaptive response to endurance exercise which is a finding that has potential to be significant and applicable in other systems and in individuals who are at risk for inactivity-related disorders. The large datasets for every paradigm is impressive and the behavioral data is rigorous and well done. The figures are constructed in a creative and easy-to-interpret manner considering the amount of data and the fairly cumbersome genotypes for each graph. In addition, the use of the Gene Switch system alleviates potential developmental issues related to reductions in OARs.

My enthusiasm is dampened by the lack of images and description of the Gal4 lines as the validity of the results weighs heavily on the tissue-restricted expression of these lines. Secondly, I realize there is an immense amount of time invested in the clear and solid behavioral experiments, however the manuscript stops short of providing a mechanism to explain how individual OARs govern exercise response. This is likely underway or will be incorporated into the next publication but it is a weakness in this manuscript.

Corrections and comments:

1. The verification of OAR transcript expression should be described earlier as these results are critical. I found myself often wondering if an individual receptor is even found in the fat body for example.

2. A short sentence or two describing Runspan, etc., should be provided at the start of the relevant sections so a reader does not have to look up the reference to understand the assay.

2. A fifth receptor that is activated by OA has been described - https://www.ncbi.nlm.nih.gov/pubmed/28942992

3. Are the Gal4 lines thoroughly characterized and do not drive expression in any other tissue? In the Materials and Methods, the hand-Gal4 and MHC-GS-Gal4 lines are listed without references and as gifts. Even if the lines are characterized, it would be useful to show the expression patterns by crossing the Gal4 lines to stinger-GFP or His2A-GFP.

4. In the OAb2R negative geotaxis assays on page 5, it looks like the climbing phenotypes of the experimental males are not statistically different than controls. If this is correct than the sentence (line 103) should be rewritten. Currently it says the experimental flies climb faster than controls.

5. At the end of page 7, a summary sentence describing the results should be provided.

6. The UAS-RNAi lines and BDSC numbers are not provided.

Typos, etc.

1. page 4, line 92. Figure instead of Figures.

2. Statistics should be added to Figure 3G and the spacing fixed.

3. There is only one * in Fig. 4D but the p-value indicates p<0.0001 as in Fig. 4A.

4. Fig. 5F has Octb1R

5. line 160, pg. 7 there are words missing in the sentence.

Reviewer #2: The manuscript by Sujkowski et al. is a follow-up of their work published in Cell Report 2017 and describes the roles of each of four known octopamine receptors in three different tissues (skeletal muscle, heart and adipocytes) in various exercise responses. There are several interesting findings such as the effects of combined OA treatment and exercise training. However, the work in the manuscript seems largely incomplete, the experiments are overall not rigorous and lack rationale (for example, there is no rationale on why the three tissues were examined), and conclusions are not supported by the presented data, offering limited significance and impact. Specific points are as follows.

Major points:

1. The authors used three GAL4 lines – MHC-, hand- and S106-GAL4 for skeletal muscle, heart muscle and fat body, respectively. However, their expression patterns are not specific - for example, MHC-GAL4 is expressed in all muscle types including skeletal and cardiac muscles and Hand-GAL4 in all cardiac cells including muscle and non-muscle cells, and S106-GAL4 in the digestive system as well. Additional GAL4 lines with more restricted expression patterns would be needed to make solid conclusions on the tissue-specific roles of each receptor.

2. RNAi efficacy is not documented. The authors note that each RNAi line was tested in the previous study. However, the previous study was done using da-GAL4, which is a strong driver (i.e. high expression level and ubiquitous). GAL drivers have different expression levels in different tissues, and more importantly RNAi efficacy varies depending on a tissue type. Thus, each driver on each receptor knockdown, particularly temporal knockdowns induced by 72 hrs RU486 feeding, would need to be confirmed by q-RT-PCR or in situ hybridization in the tissue type under study.

3. There are genetic mutants available for each octopamine receptor. It would be of great importance to examine the genetic mutants and tissue-specific rescues to verify the noted roles of each receptor in a particular tissue.

4. In all result sections/figures, the following receptor knockdowns/GAL4 driver are missing.

MHC-GS-GAL4: Octb1R alone

Hand-GAL4: Octb2R, Octb3R alone

S106: Octb1R, Octb2R and OAMB

4.1. When Octb3R/1R knockdown causes a phenotype, the conclusion cannot be made as to whether Octb3R or Octb1R alone, or combined actions of Octb1r and Octb3r are important in the absence of individual Octb1R and Octb3R knockdowns.

4.2. There is no rationale for knocking down Octb1R and Octb3R together. If the goal is to examine the effects of multiple receptor knockdowns, other receptor combinations are missing.

4. 3. For MHC and S106, GS-GAL4 is used for adult stage-specific knockdown. While Hand-GS-GAL4 is available, Hand-GAL4 is used in the study and no rationale is provided for it.

5. In the study on adaptation to chronic exercise, the duration of RU486 treatment is not noted. Regardless whether RU486 was treated for 3 days or throughout chronic exercise training (25 days), the endurance test on “acute” exercise should be done on Day 25 with the same RU486 treatment regime since the levels of octopamine receptor knockdowns are likely different on Day 5 (acute) and Day 25 (chronic). Otherwise the role of the receptors on acute and chronic exercise cannot be compared.

6. The experiments on the combined OA treatment and chronic exercise training are interesting. However, there is no rationale (or underlying hypothesis) for the study, the data are difficult to see and understand, and the interpretation and discussion are superficial.

7. The qRT-PCR study is not well described. For example, it is unclear whether the Ex analysis was done after acute or chronic exercise, which is important but not noted. Also the analyses were noted to be done on duplicate samples but 6 sample symbols shown in the graphs (duplicate biological replica and triplicate on each replica?). There are large variations in the data and it seems that additional sample size would be helpful to support the conclusion. Also, complete qRT-PCR analyses on all knockdowns in all tissue types used for behavioral experiments (only subsets were done) would be needed to make solid conclusions.

8. Discussion on the data obtained using global (TubGS RNAi in the previous paper) versus tissue-specific (this paper) knockdowns of individual octopamine receptors would be helpful.

Minor points:

1. Materials and methods

1.1. The authors note that the behaviors are scored blindly when possible. It is important to note which behaviors are scored blindly and which behaviors are unable to score blindly.

1.2. Information on most fly strains used in the study is missing

1.3. Inconsistent formatting in materials and method for product info (i.e. the city and state information is noted in some but not all)

2. Writing/figures/tables

2.1. Non-italicized Drosophila (P2 L39); Fig S1C, S2A, S2C - genotypes are not italicized

2.2. mislabeling in Fig 2E: it appears hand>OctB1R for both red solid line and red dashed line – missing UN and EX

2.3. In P4 L89-91, it states “Neither heart specific Octβ1R RNAi nor adult fat-body specific RNAi against Octβ3/β1R reduced exercise dependent improvements in endurance (Figures 2E, H).” but Fig 2H depicts B3 knockdown only.

2.4. “Crowded” labeling in figures, especially genotype labels (see fig 4E, 4F, 5E, 5F, etc.)

2.5. In P7 L89-91, it states “…knockdown of OAMB, OctB3R or OctB1R in muscle…” but Fig 6C only depicts OAMB knockdown.

2.6. Statistical analyses are missing in several places (e.g. figure 3)

2.7. Table 1 - mixed symbols (asterisk and minus sign) and letters make the content difficult to understand.

2.8. Table 2 – incomplete and not so informative

Reviewer #3: A previous work by Sujkowski et al. showed that increased activity of octopaminergic neurons is both necessary and sufficient for exercise adaptations in Drosophila. This manuscript is a follow up on that work and here the authors examined the requirements for each of the 4 octopamine receptors in different tissues on the exercise response. They found that each of the octopamine receptors is required for parts of the exercise response in a tissue-specific way and specific to particular phenotypic outputs within the broad suite of exercise responses. They also identify that octopamine signaling in one tissue can affect other tissue phenotypes. While the findings showing the detailed dissection of the input of each octopamine receptor on exercise response is appreciated, the primary concern is that this work is largely descriptive and has not carried things far enough forward, in terms of scope/mechanism and novelty, that would elicit strong general interest from the general readership of the journal here. The study at this stage may be more appropriate for a more specialized journal.

Concerns:

1) Figure 1 – The extent of RNAi knockdown of the 4 octopamine receptors using MHC GS, Hand, and S106 should be determined by QRT-PCR or muscle/heart immunostaining. Even though these RNAi efficiencies have been previously confirmed, as stated.

2) Figure 6 – The impact on autophagy/lysosomal activity by the various tissue knockdowns of the octopamine receptors has to be studied in more detail using more indicators/markers of autophagy/lysosome, not just Lysotracker.

3) All the inhibitory manipulations were performed using genetic knockdowns, not knockouts. Therefore the genetic backgrounds are not “clean” (i.e. there are residual proteins) which could confound the interpretations. For eg., when knocking down one octopamine receptor in one tissue does not affect runspan while knocking down the same/another receptor in another tissue does, is it really because one is dispensable while the other is not, or because one is more depleted than the other?

4) Some mechanistic insights on the tissue non-autonomous effects of cardiac OAMB knockdown would heighten the enthusiasm for the work, especially given that OAMB reduction in the heart produces profound cell-autonomous effects of receptor activation during endurance exercise.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS Genet. 2020 Jun 24;16(6):e1008778. doi: 10.1371/journal.pgen.1008778.r002

Author response to Decision Letter 0

14 Feb 2020

Attachment

Submitted filename: 20_02_13_Response to Reviewers.docx

Click here for additional data file.^{(23.7KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1008778.r003

Decision Letter 1

Gregory P Copenhaver, Hua Bai

10 Mar 2020

* Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. *

Dear Dr Wessells,

We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer.

In addition we ask that you:

1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.

2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images.

We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org.

If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist.

To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.

[LINK]

Please let us know if you have any questions while making these revisions.

Yours sincerely,

Hua Bai, Ph.D.

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

Your manuscript PGENETICS-D-19-01309R1 has now been reviewed. Please find enclosed the review comments. Most of the concerns raised by previous reviewers have been adequately addressed, although there are several minor issues remained. In light of these comments, we cannot accept the manuscript for publication. However, we would be interested in reconsidering a revised version that addresses these concerns. Please carefully address the new comments from Reviewer #3 and #4. Please provide thorough discussion on the different phenotypes observed between ubiquitous and tissue-specific KD, and carefully describe the knockdown efficiencies in the text accordingly.

We hope you find the reviewers' comments useful as you decide how to proceed and we are looking forward to your revised manuscript.

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: The authors have done an excellent job addressing the concerns I raised. The addition of Figure 7 is helpful. Minor note, in the response to reviewers it is really helpful to provide line numbers of the corrections and new figure numbers instead of “new figure” to help the reviewer quickly identify the change and the text context of the change.

However, congratulations on this exciting paper.

Reviewer #3: Review uploaded as an attachment

Reviewer #4: Summary

The revised manuscript by Sujkowski et. al. extends their investigation on the role of the octopamine (OA) system in exercise adaptations and here, they detail the tissue types where the individual OA receptors function. This rigorous characterization yielded novel insights, especially for the invertebrate exercise field. The sizeable datasets are impressive, logically organized and well presented in the figures. Where the manuscript falls short, in my opinion and as the previous reviewers pointed out, is its limited scope (~ solely focused on the identification of receptor functional roles) and the lack of information on downstream mechanisms. The authors point out that this notion is beyond the scope of this manuscript, and that their finding that the OA receptors cannot functionally substitute for each other is an important novel mechanistic insight, is sufficient for publication. With all of this in mind, there are several points that should be clarified prior to consideration for publication (listed below).

Comments

The authors have addressed almost all of the major points brought up by the three reviewers, however, there is one comment that in my opinion was insufficiently addressed. On reviewer 2 comment 8, the authors should elaborate further on the discrepancies between the phenotypes observed using global KD (Cell reports 2017) versus tissue specific KD (this revised manuscript) of individual OA receptors. For example, address questions including:

A. Why ubiquitous Octb3R KD versus fat body Octb3R KD yielded different results in the lysosomal activity? This is especially important since it is one of the major findings attributed to Octb3R function in exercise adaptation.

B. Why ubiquitous Octb1R KD versus either muscle or fat body Octb1R KD have different effects on endurance, as measured by runspan? The authors only address flight.

C. Why ubiquitous Octb2R KD affects all exercise adaptations (Cell reports 2017) yet in this was not the case for tissue specific Octb2R KD? Especially address the discrepancy on flight.

This section in the discussion can touch on the the known signaling pathways that the different OA receptors trigger (for example: OAMB—Ca2+--CaMKII) that may help explain discrepancies in phenotype expression and begin to describe possible molecular mechanisms downstream of OA receptors affected by exercise. This, in part, may address the similar concerns expressed by the other reviewers.

The experiment using with OA feeding in the flies with OA receptor KD (Octb2R and Octb3R) in muscle are great. These results indeed facilitated the identification of receptor requirement or functional substitution for exercise responses. The data shown is on the Octb2R and Octb3R in muscle tissue, a great proof of concept. However, in lines 228-231, this statement in my opinion, is too bold. This generalized statement can be easily misinterpreted to encompass all OA receptors in different tissue types (e.g. OAMB and Octb1R). Unless, there are OA feeding data on all individual OA receptor KDs, the authors should amend this statement.

In line with the previous comment, the authors argue the novel mechanism that “…OA receptors cannot substitute for each other, even in the same tissue…” is indeed true for exercise adaptations. This concept, however, has been demonstrated in the female reproductive system epithelium in Lim et. al., 2014 (ref 41), where the OAMB could not functionally substitute for Octb2R in the to restore fecundity yet OAMB can partially substitute for Octb2R to restore the ovulation phenotype of the Octb2R mutant females. Both OAMB and Octb2R are expressed in the female oviduct epithelium and are important for female reproduction. The authors may reference this to support their findings and hypothesis on the similar phenomenon observed for exercise adaptations.

Are the specific OA neurons required for exercise adaptations known or mapped? If so, does it involve all or subset (e.g. Tdc2+, VUM, VPM or APL)? Do these OA neurons send axonal projections to the different tissue types (muscle, heart or fat body) tested? Alternatively, is OA released into the fly circulation? The authors can add this information in the discussion.

In lines 186-188, the statement “…trends toward lower levels…”, in my opinion, is misleading. There is no statistics information presented to suggest the “lowering” trend. The authors should rephrase this sentence.

Lines 197-198 state, “summary of OA-feeding+exercise results is in Table 1”, there is no Table 1 either the manuscript doc, pdf, or supplemental doc. This should be clarified.

Lines 268-269 state, “OAMB, the only Drosophila α-adrenergic OA-receptor…” is incorrect. There is another one, the Octα2R that the authors reference – Qi et. al. 2017 (ref 48). This sentence needs to be revised.

In line 681, missing close parenthesis after “(K”.

The statistics information for the cardiac pacing experiment is missing in the methods section.

The information for S106 GS is missing from the fly stocks section.

The labeling in Figure 4G is not easy to follow especially the “WT(-)(+)” on top of the blot image – an explanation in the figure legend would be helpful.

The Figure 7 legend states, “…Cell non-autonomous effects…indicated by colored arrows.”, but there three sets of colored arrows in the summary: (1) denoting increased OA, (2) arrows denoting OA binding to different OA receptors and (3) cell non-autonomous effects. This should be clarified.

The first two sentences of the abstract are identical to the authors’ previous publication on Cell reports 2017. The authors should rephrase/reword these sentences.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: No

Reviewer #4: No

Attachment

Submitted filename: Reviewer 3.docx

Click here for additional data file.^{(11.4KB, docx)}

PLoS Genet. 2020 Jun 24;16(6):e1008778. doi: 10.1371/journal.pgen.1008778.r004

Author response to Decision Letter 1

20 Mar 2020

Attachment

Submitted filename: Response To Reviewers 3-20.docx

Click here for additional data file.^{(17.5KB, docx)}

PLoS Genet. doi: 10.1371/journal.pgen.1008778.r005

Decision Letter 2

Gregory P Copenhaver, Hua Bai

15 Apr 2020

Dear Dr Wessells,

We are pleased to inform you that your manuscript entitled "Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations" has been editorially accepted for publication in PLOS Genetics. Congratulations!

Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made.

Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org.

In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.

If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!

Yours sincerely,

Hua Bai, Ph.D.

Guest Editor

PLOS Genetics

Gregory P. Copenhaver

Editor-in-Chief

PLOS Genetics

www.plosgenetics.org

Twitter: @PLOSGenetics

----------------------------------------------------

Comments from the reviewers (if applicable):

Reviewer's Responses to Questions

Comments to the Authors:

Please note here if the review is uploaded as an attachment.

Reviewer #1: My concerns have been well-addressed.

Reviewer #3: The authors have responded satisfactorily to my concerns.

Reviewer #4: Summary

Sujkowski et. al. expands our understanding on the octopamine system’s role in exercise adaptations by detailing the individual octopamine receptors' function in different exercise-relevant tissue types. The study serves as a significant entry point for further investigation on the comprehensive mechanism(s) governing exercise response in Drosophila.

Comments

The authors have addressed almost all my concerns and I would like to congratulate the authors on their exciting manuscript. The only thing that remains missing, as I could still not locate it in the submission, is the Table 1. Once this error is corrected, in my opinion, the manuscript should be ready for publication.

**********

Have all data underlying the figures and results presented in the manuscript been provided?

Reviewer #1: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #3: No

Reviewer #4: No

----------------------------------------------------

Data Deposition

If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website.

The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly:

http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01309R2

More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.

Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.

----------------------------------------------------

Press Queries

If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org.

PLoS Genet. doi: 10.1371/journal.pgen.1008778.r006

Acceptance letter

Gregory P Copenhaver, Hua Bai

9 Jun 2020

PGENETICS-D-19-01309R2

Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations

Dear Dr Wessells,

We are pleased to inform you that your manuscript entitled "Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.

Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work!

With kind regards,

Kaitlin Butler

PLOS Genetics

On behalf of:

The PLOS Genetics Team

Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom

plosgenetics@plos.org | +44 (0) 1223-442823

plosgenetics.org | Twitter: @PLOSGenetics

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Confirmation of RNAi efficacy in target tissues.

(TIFF)

Click here for additional data file.^{(348.4KB, tiff)}

S2 Fig. Baseline endurance is unaffected by non-specific RNAi effects.

(TIFF)

Click here for additional data file.^{(886.1KB, tiff)}

S3 Fig. Post-training endurance is unaffected by non-specific RNAi effects.

(TIFF)

Click here for additional data file.^{(1.2MB, tiff)}

S4 Fig. Negative RNAi controls adapt to exercise with increases in climbing speed.

(TIFF)

Click here for additional data file.^{(928.5KB, tiff)}

S5 Fig. Flight performance is increased in exercise-trained RNAi negative control flies.

(TIFF)

Click here for additional data file.^{(1.1MB, tiff)}

S6 Fig. No non-specific RNAi effects on post-training adaptations to cardiac stress resistance.

(TIFF)

Click here for additional data file.^{(1.3MB, tiff)}

S7 Fig. Fat body LysoTracker staining is increased exercise-trained RNAi negative control flies.

(TIFF)

Click here for additional data file.^{(1.3MB, tiff)}

S8 Fig. Vehicle-fed MHC GS>OctR RNAi flies have reductions in endurance, speed, cardiac stress resistance and fat body LysoTracker staining.

(TIFF)

Click here for additional data file.^{(1.9MB, tiff)}

S9 Fig. Representative 40X Fat Body Lysotracker Images.

Accompanying confocal images for lysotracker quantifications in main Figs 1–3. Scale bars = 20μm.

(TIFF)

Click here for additional data file.^{(6.6MB, tiff)}

S10 Fig. Raw Data file.

Raw data is presented as a spreadsheet with one page for each main figure and supplemental figure. Within each page, experimental data is labelled by subheadings for assessment and genotype.

(XLSX)

Click here for additional data file.^{(230.4KB, xlsx)}

S1 Table. Summary Statistics of combinatorial treatment of 5μM OA feeding plus exercise training in selected RNAi lines.

(DOCX)

Click here for additional data file.^{(18.1KB, docx)}

Attachment

Submitted filename: 20_02_13_Response to Reviewers.docx

Click here for additional data file.^{(23.7KB, docx)}

Attachment

Submitted filename: Reviewer 3.docx

Click here for additional data file.^{(11.4KB, docx)}

Attachment

Submitted filename: Response To Reviewers 3-20.docx

Click here for additional data file.^{(17.5KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its supporting information files.

[pgen.1008778.ref001] 1.Topp R, Fahlman M, Boardley D. Healthy aging: health promotion and disease prevention. Nurs Clin North Am. 2004;39(2):411–22. 10.1016/j.cnur.2004.01.007 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref002] 2.Booth FW, Roberts CK, Laye MJ. Lack of exercise is a major cause of chronic diseases. Compr Physiol. 2012;2(2):1143–211. 10.1002/cphy.c110025 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref003] 3.Strasser B. Physical activity in obesity and metabolic syndrome. Ann N Y Acad Sci. 2013;1281:141–59. 10.1111/j.1749-6632.2012.06785.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref004] 4.Wilmot EG, Edwardson CL, Achana FA, Davies MJ, Gorely T, Gray LJ, et al. Sedentary time in adults and the association with diabetes, cardiovascular disease and death: systematic review and meta-analysis. Diabetologia. 2012;55(11):2895–905. 10.1007/s00125-012-2677-z . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref005] 5.Sujkowski A, Bazzell B, Carpenter K, Arking R, Wessells RJ. Endurance exercise and selective breeding for longevity extend Drosophila healthspan by overlapping mechanisms. Aging (Albany NY). 2015;7(8):535–52. 10.18632/aging.100789 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref006] 6.Coffey VG, Hawley JA. The molecular bases of training adaptation. Sports medicine. 2007;37(9):737–63. Epub 2007/08/29. 3791 [pii]. 10.2165/00007256-200737090-00001 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref007] 7.Sujkowski A, Saunders S, Tinkerhess M, Piazza N, Jennens J, Healy L, et al. dFatp regulates nutrient distribution and long-term physiology in Drosophila. Aging cell. 2012;11(6):921–32. 10.1111/j.1474-9726.2012.00864.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref008] 8.Sujkowski A, Ramesh D, Brockmann A, Wessells R. Octopamine Drives Endurance Exercise Adaptations in Drosophila. Cell reports. 2017;21(7):1809–23. 10.1016/j.celrep.2017.10.065 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref009] 9.Damschroder D, Cobb T, Sujkowski A, Wessells R. Drosophila Endurance Training and Assessment and Its Effects on Systemic Adaptations. BioProtocols. 2017. 10.21769/BioProtoc.3037 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref010] 10.Mendez S, Watanabe L, Hill R, Owens M, Moraczewski J, Rowe GC, et al. The TreadWheel: A Novel Apparatus to Measure Genetic Variation in Response to Gently Induced Exercise for Drosophila. PLoS One. 2016;11(10):e0164706 10.1371/journal.pone.0164706 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref011] 11.Piazza N, Gosangi B, Devilla S, Arking R, Wessells R. Exercise-training in young Drosophila melanogaster reduces age-related decline in mobility and cardiac performance. PLoS One. 2009;4(6):e5886 Epub 2009/06/12. 10.1371/journal.pone.0005886 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref012] 12.Tinkerhess MJ, Ginzberg S, Piazza N, Wessells RJ. Endurance training protocol and longitudinal performance assays for Drosophila melanogaster. J Vis Exp. 2012;(61). Epub 2012/04/05. 10.3791/37863786 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref013] 13.Laker RC, Xu P, Ryall KA, Sujkowski A, Kenwood BM, Chain KH, et al. A novel MitoTimer reporter gene for mitochondrial content, structure, stress, and damage in vivo. J Biol Chem. 2014;289(17):12005–15. 10.1074/jbc.M113.530527 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref014] 14.Sujkowski A, Spierer AN, Rajagopalan T, Bazzell B, Safdar M, Imsirovic D, et al. Mito-nuclear interactions modify Drosophila exercise performance. Mitochondrion. 2019;47:188–205. 10.1016/j.mito.2018.11.005 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref015] 15.Fluck M., Functional structural and molecular plasticity of mammalian skeletal muscle in response to exercise stimuli. J Exp Biol. 2006;209(Pt 12):2239–48. 10.1242/jeb.02149 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref016] 16.Han KA, Millar NS, Davis RL. A novel octopamine receptor with preferential expression in Drosophila mushroom bodies. J Neurosci. 1998;18(10):3650–8. 10.1523/JNEUROSCI.18-10-03650.1998 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref017] 17.El-Kholy S, Stephano F, Li Y, Bhandari A, Fink C, Roeder T. Expression analysis of octopamine and tyramine receptors in Drosophila. Cell Tissue Res. 2015;361(3):669–84. 10.1007/s00441-015-2137-4 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref018] 18.Hirashima A, Sukhanova M, Rauschenbach I. Genetic control of biogenic-amine systems in Drosophila under normal and stress conditions. Biochem Genet. 2000;38(5–6):167–80. . [PubMed] [Google Scholar]

[pgen.1008778.ref019] 19.Adamo SA, Linn CE, Hoy RR. The Role of Neurohormonal Octopamine during Fight or Flight Behavior in the Field Cricket Gryllus-Bimaculatus. Journal of Experimental Biology. 1995;198(8):1691–700. WOS:A1995RM22400007. [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref020] 20.Orchard I, Ramirez JM, Lange AB. A Multifunctional Role for Octopamine in Locust Flight. Annual Review of Entomology. 1993;38:227–49. 10.1146/annurev.en.38.010193.001303 WOS:A1993KF69700011. [DOI] [Google Scholar]

[pgen.1008778.ref021] 21.Vanheusden MC, Vanderhorst DJ, Beenakkers AMT. Invitro Studies on Hormone-Stimulated Lipid Mobilization from Fat-Body and Interconversion of Hemolymph Lipoproteins of Locusta-Migratoria. Journal of Insect Physiology. 1984;30(8):685–&. 10.1016/0022-1910(84)90054-4 WOS:A1984TG34500012. [DOI] [Google Scholar]

[pgen.1008778.ref022] 22.Bukowiecki L, Lupien J, Follea N, Paradis A, Richard D, LeBlanc J. Mechanism of enhanced lipolysis in adipose tissue of exercise-trained rats. Am J Physiol. 1980;239(6):E422–9. 10.1152/ajpendo.1980.239.6.E422 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref023] 23.Hedrington MS, Davis SN. Sexual Dimorphism in Glucose and Lipid Metabolism during Fasting, Hypoglycemia, and Exercise. Front Endocrinol (Lausanne). 2015;6:61 10.3389/fendo.2015.00061 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref024] 24.Zouhal H, Jacob C, Delamarche P, Gratas-Delamarche A. Catecholamines and the effects of exercise, training and gender. Sports medicine. 2008;38(5):401–23. 10.2165/00007256-200838050-00004 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref025] 25.Shepherd JT. Circulatory response to exercise in health. Circulation. 1987;76(6 Pt 2):VI3–10. . [PubMed] [Google Scholar]

[pgen.1008778.ref026] 26.Tank AW, Lee Wong D. Peripheral and central effects of circulating catecholamines. Comprehensive Physiology. 2015;5(1):1–15. 10.1002/cphy.c140007 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref027] 27.Ahles A, Engelhardt S. Polymorphic variants of adrenoceptors: pharmacology, physiology, and role in disease. Pharmacological reviews. 2014;66(3):598–637. 10.1124/pr.113.008219 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref028] 28.Chick TW, Halperin AK, Gacek EM. The effect of antihypertensive medications on exercise performance: a review. Medicine and science in sports and exercise. 1988;20(5):447–54. . [PubMed] [Google Scholar]

[pgen.1008778.ref029] 29.Davis E, Loiacono R, Summers RJ. The rush to adrenaline: drugs in sport acting on the beta-adrenergic system. British journal of pharmacology. 2008;154(3):584–97. 10.1038/bjp.2008.164 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref030] 30.Sujkowski A, Wessells R. Using Drosophila to Understand Biochemical and Behavioral Responses to Exercise. Exercise and sport sciences reviews. 2018;46(2):112–20. 10.1249/JES.0000000000000139 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref031] 31.Sujkowski A, Wessells R. Drosphila Models of Cardiac Aging and Disease. In: Vaiserman A, Moskalev A, Pasyukova J, editors. Life Extension: Lessons from Drosophila. Healthy Ageing and Longevity. Switzerland: Springer; 2015. p. 127–50. [Google Scholar]

[pgen.1008778.ref032] 32.Kim JS, Ro SH, Kim M, Park HW, Semple IA, Park H, et al. Sestrin2 inhibits mTORC1 through modulation of GATOR complexes. Sci Rep. 2015;5:9502 Epub 2015/03/31. 10.1038/srep09502 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref033] 33.Li Y, Hoffmann J, Li Y, Stephano F, Bruchhaus I, Fink C, et al. Octopamine controls starvation resistance, life span and metabolic traits in Drosophila. Sci Rep. 2016;6:35359 10.1038/srep35359 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref034] 34.Saraswati S, Fox LE, Soll DR, Wu CF. Tyramine and octopamine have opposite effects on the locomotion of Drosophila larvae. Journal of neurobiology. 2004;58(4):425–41. 10.1002/neu.10298 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref035] 35.Selcho M, Pauls D, El Jundi B, Stocker RF, Thum AS. The role of octopamine and tyramine in Drosophila larval locomotion. J Comp Neurol. 2012;520(16):3764–85. 10.1002/cne.23152 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref036] 36.Li Y, Tiedemann L, von Frieling J, Nolte S, El-Kholy S, Stephano F, et al. The Role of Monoaminergic Neurotransmission for Metabolic Control in the Fruit Fly Drosophila Melanogaster. Front Syst Neurosci. 2017;11:60 10.3389/fnsys.2017.00060 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref037] 37.Yang Z, Yu Y, Zhang V, Tian Y, Qi W, Wang L. Octopamine mediates starvation-induced hyperactivity in adult Drosophila. Proc Natl Acad Sci U S A. 2015;112(16):5219–24. 10.1073/pnas.1417838112 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref038] 38.Watanabe K, Chiu H, Pfeiffer BD, Wong AM, Hoopfer ED, Rubin GM, et al. A Circuit Node that Integrates Convergent Input from Neuromodulatory and Social Behavior-Promoting Neurons to Control Aggression in Drosophila. Neuron. 2017;95(5):1112–+. 10.1016/j.neuron.2017.08.017 WOS:000408687900017. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref039] 39.Wu CL, Shih MF, Lee PT, Chiang AS. An octopamine-mushroom body circuit modulates the formation of anesthesia-resistant memory in Drosophila. Current biology: CB. 2013;23(23):2346–54. 10.1016/j.cub.2013.09.056 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref040] 40.Li Y, Fink C, El-Kholy S, Roeder T. The octopamine receptor octss2R is essential for ovulation and fertilization in the fruit fly Drosophila melanogaster. Archives of insect biochemistry and physiology. 2015;88(3):168–78. 10.1002/arch.21211 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref041] 41.Lim J, Sabandal PR, Fernandez A, Sabandal JM, Lee HG, Evans P, et al. The octopamine receptor Octbeta2R regulates ovulation in Drosophila melanogaster. PloS one. 2014;9(8):e104441 10.1371/journal.pone.0104441 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref042] 42.Erion R, DiAngelo JR, Crocker A, Sehgal A. Interaction between sleep and metabolism in Drosophila with altered octopamine signaling. The Journal of biological chemistry. 2012;287(39):32406–14. 10.1074/jbc.M112.360875 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref043] 43.Brum PC, Rolim NP, Bacurau AV, Medeiros A. Neurohumoral activation in heart failure: the role of adrenergic receptors. An Acad Bras Cienc. 2006;78(3):485–503. 10.1590/s0001-37652006000300009 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref044] 44.Leosco D, Parisi V, Femminella GD, Formisano R, Petraglia L, Allocca E, et al. Effects of exercise training on cardiovascular adrenergic system. Front Physiol. 2013;4:348 10.3389/fphys.2013.00348 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref045] 45.Nall A, Sehgal A. Monoamines and sleep in Drosophila. Behav Neurosci. 2014;128(3):264–72. 10.1037/a0036209 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref046] 46.Roeder T. Tyramine and octopamine: ruling behavior and metabolism. Annu Rev Entomol. 2005;50:447–77. 10.1146/annurev.ento.50.071803.130404 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref047] 47.Hoff M, Balfanz S, Ehling P, Gensch T, Baumann A. A single amino acid residue controls Ca2+ signaling by an octopamine receptor from Drosophila melanogaster. FASEB J. 2011;25(7):2484–91. 10.1096/fj.11-180703 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref048] 48.Qi YX, Xu G, Gu GX, Mao F, Ye GY, Liu W, et al. A new Drosophila octopamine receptor responds to serotonin. Insect Biochem Mol Biol. 2017;90:61–70. Epub 2017/09/26. 10.1016/j.ibmb.2017.09.010 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref049] 49.Burke CJ, Huetteroth W, Owald D, Perisse E, Krashes MJ, Das G, et al. Layered reward signalling through octopamine and dopamine in Drosophila. Nature. 2012;492(7429):433–+. 10.1038/nature11614 WOS:000312488200057. [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref050] 50.Luo J, Lushchak OV, Goergen P, Williams MJ, Nassel DR. Drosophila insulin-producing cells are differentially modulated by serotonin and octopamine receptors and affect social behavior. PloS one. 2014;9(6):e99732 10.1371/journal.pone.0099732 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref051] 51.Branch A, Zhang Y, Shen P. Genetic and Neurobiological Analyses of the Noradrenergic-like System in Vulnerability to Sugar Overconsumption Using a Drosophila Model. Scientific reports. 2017;7(1):17642 10.1038/s41598-017-17760-w [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref052] 52.Johnson E, Ringo J, Dowse H. Modulation of Drosophila heartbeat by neurotransmitters. Journal of comparative physiology B, Biochemical, systemic, and environmental physiology. 1997;167(2):89–97. 10.1007/s003600050051 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref053] 53.Wang ZW, Hayakawa Y, Downer RGH. Factors Influencing Cyclic-Amp and Diacylglycerol Levels in Fat-Body of Locusta-Migratoria. Insect Biochemistry. 1990;20(4):325–30. WOS:A1990DQ56200001. [Google Scholar]

[pgen.1008778.ref054] 54.Viswanathan MC, Blice-Baum AC, Schmidt W, Foster DB, Cammarato A. Pseudo-acetylation of K326 and K328 of actin disrupts Drosophila melanogaster indirect flight muscle structure and performance. Front Physiol. 2015;6:116 Epub 2015/05/15. 10.3389/fphys.2015.00116 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref055] 55.Hwangbo DS, Gershman B, Tu MP, Palmer M, Tatar M. Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature. 2004;429(6991):562–6. Epub 2004/06/04. 10.1038/nature02549 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref056] 56.Monnier V, Iche-Torres M, Rera M, Contremoulins V, Guichard C, Lalevee N, et al. dJun and Vri/dNFIL3 are major regulators of cardiac aging in Drosophila. PLoS Genet. 2012;8(11):e1003081 Epub 2012/12/05. 10.1371/journal.pgen.1003081 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pgen.1008778.ref057] 57.Wessells RJ, Fitzgerald E, Cypser JR, Tatar M, Bodmer R. Insulin regulation of heart function in aging fruit flies. Nat Genet. 2004;36(12):1275–81. Epub 2004/11/27. ng1476 [pii] 10.1038/ng1476 . [DOI] [PubMed] [Google Scholar]

[pgen.1008778.ref058] 58.Wessells RJ, Bodmer R. Screening assays for heart function mutants in Drosophila. BioTechniques. 2004;37(1):58–60, 2, 4 passim. Epub 2004/07/31. 10.2144/04371ST01 . [DOI] [PubMed] [Google Scholar]

PERMALINK

Alpha- and beta-adrenergic octopamine receptors in muscle and heart are required for Drosophila exercise adaptations

Alyson Sujkowski

Anna Gretzinger

Nicolette Soave

Sokol V Todi

Robert Wessells

Roles

Abstract

Author summary

Introduction

Results

Octopamine receptor expression is tissue-specific

OAMB is required in muscle and heart for improved climbing speed, endurance and cardioprotection with exercise

Fig 1. OAMB is required in muscle and heart for exercise adaptations to climbing speed, endurance and heart performance.

Octopamine β1 receptor is specifically required in muscle for adaptive response to chronic exercise

Fig 2. Exercise adaptations in Drosophila require Octopamine β1 receptors in muscle.

Octopamine β2 and β3 receptor expression in muscle separately coordinate exercise adaptations

Fig 3. Octopamine β2 and β3 receptors in muscle coordinate tissue-specific exercise adaptations in Drosophila.

Octopamine β3 receptor is important for fat body homeostasis

Fig 4. Effects of reduced fat body Octopamine β3 receptors on exercise adaptations are largely cell autonomous.

OA feeding rescues phenotypes of some, but not all, octopamine receptor knockdowns

Fig 5. Octopamine feeding rescues flight performance in MHC GS>Octβ2R RNAi flies.

Octβ3R

Fig 6. Octopamine feeding rescues cardiac performance in MHC GS>Octβ3R RNAi flies.

Discussion

Fig 7. Summary of tissue autonomous and non-autonomous effects of octopamine receptor activation during endurance exercise.

Materials and methods

Fly stocks and maintenance

Drug treatment

Exercise training

Endurance

Climbing speed

Flight performance

Cardiac pacing

Lysotracker

Western Blotting

qRT PCR

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Gregory P Copenhaver

Hua Bai

Roles

Transfer Alert

Author response to Decision Letter 0

Decision Letter 1

Gregory P Copenhaver

Hua Bai

Roles

Author response to Decision Letter 1

Decision Letter 2

Gregory P Copenhaver

Hua Bai

Roles

Acceptance letter

Gregory P Copenhaver

Hua Bai

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases