Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Genetic Reagent (M. musculus) | Card14LSL-E138A | Taconic | MGI:6111507 | Mice were bred into the C57BL6/J background for > 8 generations by the Ley lab. Strain name at the Francis Crick Institute SLAT. |
| Genetic Reagent (M. musculus) | Rosa26CreERT2 | PMID:12582257 | RRID:IMSR_TAC:10471 | Strain name at the Francis Crick Institute BRAW |
| Genetic Reagent (M. musculus) | VillinCreERT2 | PMID:15282745 | RRID:IMSR_JAX:020282 | Strain name at the Francis Crick Institute BRGU |
| Genetic Reagent (M. musculus) | Krt14CreERT2 | PMID:14742263 | (MGI:4357971) | Mice were bred into the C57BL6/J background for > 8 (more like N5 for the SLDD12) generations by the Ley lab Strain name at the Francis Crick Institute SLBN |
| Genetic Reagent (M. musculus) | Rag1-/- | PMID:7926785 | (MGI:2448994) | Historically Backcrossed 12 x to C57BL/6J total N unknown Strain name at the Francis Crick Institute BRAU |
| Gene (M. musculus) | Card14 |
Mus musculus
Mouse Genome Informatics |
MGI:2386258 | |
| Cell line (H. sapiens) | NHEK | Lonza | Cat #00192627 | |
| Antibody | IgG1 isotype control (mouse monoclonal) | BioXcell | MOPC-21 | 0.5 mg per injection |
| Antibody | Anti-Il17a (mouse monoclonal) | BioXcell | clone 17F3 | 0.5 mg per injection |
| Antibody | IgG2b isotype control (Rat monoclonal) | BioXcell | LTF-2 | 0.5 mg per injection |
| Antibody | Anti-Gr1 (Rat monoclonal) | BioXcell | clone RB6-8C5 | 0.5 mg per injection |
| Antibody | rat IgG1 isotype control (Rat monoclonal) | BioXcell | TNP6A7 | 0.5 mg per injection |
| Antibody | Anti-TNFa (Rat monoclonal) | BioXcell | clone XT3.11 | 0.5 mg per injection |
| Antibody | Anti-Ki67 (Rabbit monoclonal) | Abcam | ab16667 | 1/350 |
| Antibody | Anti-Involucrin (Rabbit monoclonal) | In house | ERL-3 | Produced by the Crick Cell Services. 1/800 |
| Antibody | Anti-S100a9 (Rat monoclonal) | In house | 2b10 | 1/1000 (Can be purchased from abcam ab105472) |
| Antibody | Anti-Endomucin (Rat monoclonal) | Santa Cruz | sc-65495 | 1/400 |
| Antibody | anti-FLAG (Mouse monoclonal) | Sigma | F1804 | 1/1000 |
| Antibody | anti-CARD14 (Rabbit polyclonal) | This paper | CUK-1813 | Produced by Covalab 1/1000 |
| Antibody | anti-Hsp90 (Rabbit polyclonal) | Santa Cruz | sc-7947 | 1/5000 |
| Sequence-based reagent | Card14 oligo 1 | This paper | PCR oligo | TCAACATTATCTTCCAAGCTCC |
| Sequence-based reagent | Card14 oligo 2 | This paper | PCR oligo | TGACCTCACGTTTCATGCG |
| Commercial assay or kit | SuperScript VILO cDNA Synthesis Kit | Life Technologies | 11754250 | |
| Commercial assay or kit | RNeasy mini kit | Qiagen | 74106 | |
| Commercial assay or kit | LEGENDplex, | Biolegend | 740150 | |
| Commercial assay or kit | TaqMan Gene Expression Master Mix | Thermo Fisher | 4369514 | |
| Commercial assay or kit | Card14 RNAscope | ACDBio | Probe - Mm-Card14 Cat No 476041 | |
| Chemical compound, drug | Corn oil | Sigma | C8267 | 100 ul per injection |
| Chemical compound, drug | Tamoxifen | Sigma | T5648 | 2 mg per injection |
| Software, algorithm | Image J | NIH, Bethesda, MD |
RRID:SCR_003070 | https://imagej.nih.gov/ij/ |
| Software, algorithm |
GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_002798 | GraphPad Prism eight software for Mac |