Abstract
We have previously shown that acacia polyphenol (AP), which was extracted from the bark of Acacia mearnsii De Wild, exerts antiobesity, antidiabetic, and antihypertensive effects. In this study, we examined the effect of AP on atopic dermatitis. Trimellitic anhydride (TMA) was applied to the ears of mice to create model mice with atopic dermatitis. The frequency of scratching behavior in the TMA-treated group was significantly higher than that in the control group, and the expression levels of inflammatory markers (tumor necrosis factor-α, interleukin-6, inducible nitric oxide synthase, and cyclooxygenase-2) in the skin also increased. In contrast, both the frequency of scratching behavior and the expression levels of skin inflammatory markers in the AP-treated group were significantly lower than those in the TMA-treated group. The abundances of beneficial bacteria, such as Bifidobacterium spp. and Lactobacillus spp., increased in the AP-treated group compared with the TMA-treated group. Furthermore, the abundances of Bacteroides fragilis and Clostridium coccoides in the gut, which are known for anti-inflammatory properties, increased significantly with AP administration. The present results revealed that AP inhibits TMA-induced atopic dermatitis-like symptoms. In addition, the results also suggested that this effect may be associated with the mechanism of gut microbiota improvement.
Keywords: acacia polyphenol, atopic dermatitis, gut microbiota, functional food
1. Introduction
Atopic dermatitis causes eczema, accompanied by itchiness on the body, with repeated aggravation and remission. As the quality of life of patients with atopic dermatitis is markedly decreased due to itchiness, the development of a suitable treatment is very important. However, there are still many unclear points about the pathogenic mechanism of atopic dermatitis. Currently, in the treatment of atopic dermatitis, topical steroids and immunosuppressants are used as symptomatic treatments, but it is not a fundamental treatment.
In recent years, it has become clear that gut microbiota is involved in the development of atopic dermatitis [1]. For example, it has been reported that (1) patients with atopic dermatitis had more intestinal Clostridium spp. and fewer intestinal Bifidobacterium spp. in their feces than non-atopic dermatitis subjects [2] and that (2) the administration of probiotics improved atopic dermatitis [3,4,5,6]. Thus, drugs or foods that correct the gut microbiota may be useful for atopic dermatitis. To date, we have clarified that polyphenols, which have a poor absorption rate in the digestive tract, change the flora in the large intestine, resulting in substantial alteration of hepatic functional molecules [7,8]. Thus, it was considered that polyphenols may improve atopic dermatitis through the change of gut microbiota, as well as probiotics.
The aqueous extract from the bark of Acacia mearnsii De Wild. (acacia polyphenol (AP)) is high in polyphenols, and we have previously shown that AP exerts antiobesity, antidiabetic, and antihypertensive effects [9,10,11]. In addition, we have demonstrated that AP ameliorates atopic dermatitis-like symptoms in mice fed a magnesium-free special diet [12]. However, little is known about the mechanism by which AP improves atopic dermatitis, and, in particular, the effect on gut microbiota is not known at all. Therefore, based on the above findings, we hypothesized that AP changed gut microbiota and improved atopic dermatitis and verified the hypothesis. Briefly, AP was administered to trimellitic anhydride (TMA)-induced atopic dermatitis model mice [13], after which their scratching behavior and skin inflammatory reactions were observed. In addition, the abundances of gut microbes in the feces were analyzed.
2. Materials and Methods
2.1. The Preparation of AP
AP (lot: DF5) was donated by Acacia-No-Ki Co., Ltd. (Hiroshima, Japan) and prepared according to Cutting’s methods [14]. Briefly, the bark of A. mearnsii De Wild. from South Africa was crushed, extracted with hot water (100 °C), and dried with a spray drier. The HPLC chart of AP used in this study is shown in Figure S1. Details of AP, such as the ingredients, were given in previous reports [15,16,17].
2.2. Animals
Female BALB/c mice (5 weeks old, Japan SLC, Inc., Shizuoka, Japan) were used in this study. The mice were housed at 55 ± 5% humidity and room temperature (24 ± 1 °C). The study was conducted with approval (approval no. 30–121) and in accordance with the Hoshi University Guiding Principles.
2.3. TMA-Induced Atopic Dermatitis
The experimental protocol is illustrated in Figure 1 [13]. Briefly, mice were sensitized with TMA (Fujifilm Wako Pure Chemical Corporation, Osaka, Japan) by topical application on abdominal skin on day 0, received TMA on both ears on day 5, and were repeatedly challenged with TMA on days 6–14. The vehicle groups were treated with a mixture of acetone and isopropylmyristate (4:1, v/v).
Figure 1.
Experimental protocol.
2.4. Treatments
The mice were divided into the following groups (n = 8, 4 mice/cage, Figure 1): (1) normal group, (2) AP 3% group, (3) TMA-control group, (4) TMA-AP 1.5% group, and (5) TMA-AP 3% group. With the exception of the mice in the normal and AP 3% groups, all mice were treated with TMA to induce atopic dermatitis (AD)-like skin lesions. Each mouse was fed a normal diet (MF, Oriental Yeast, Tokyo, Japan) or a normal diet containing 1.5% or 3% AP ad libitum for 22 days. On the 15th day (Figure 1), the ear skin and feces in the colon were removed and put in tubes. The samples were flash-frozen in liquid nitrogen and stored at −80 °C until analysis.
2.5. Scratching Behavior
Scratching behavior was observed on the 14th day (Figure 1). To measure scratching behavior, mice were individually housed in a cage divided into compartments and acclimatized for 60 min. The scratching behavior was recorded using a digital video camera for 30 min, with no direct human observation. The number of scratching episodes was counted from the recordings.
2.6. Hematoxylin-Eosin (HE) Staining
After mouse skin was fixed and embedded in paraffin, the sample was cut into 5-μm sections and mounted on slides. The slides were stained with hematoxylin and eosin. We observed the epidermal thickness, presence of ulcer, and infiltration of inflammatory cells into the dermis.
2.7. Real-Time RT-PCR
Total RNA from mouse skin was isolated by homogenization in TRI reagent (Sigma-Aldrich Corp., St. Louis, MO, USA). cDNA was synthesized by a high-capacity cDNA synthesis kit (Applied Biosystems, Foster City, CA, USA). Target gene expression was analyzed by real-time RT-PCR (CFX Connect Real-Time System, Bio-Rad Laboratories, Hercules, CA, USA). The primer sequences for real-time PCR are shown in Table 1. The mRNA expressions were normalized to the expression of the housekeeping gene 18S rRNA.
Table 1.
Primer sequences for real-time PCR.
| Gene | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| TNF-α | ATGGACACCAAACATTTCCTGC | CCAGTGGAGAGCCGATTCC |
| IL-6 | CCCTGACAGACCCGGACTTA | GCCGAGACTGTTGTTCCATAAT |
| iNOS | GGCAGCCTGTGAGACCTTTG | GCATTGGAAGTGAAGCGTTTC |
| COX-2 | CAGGGCCCTTCCTCCCGTAG | GCCTTGGGGGTCAGGGATGA |
| 18S rRNA | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase-2.
2.8. Quantification of Bacteria from Fecal Samples
DNA from the feces was extracted by the QIAamp DNA Stool Mini Kit (Qiagen, Inc., Valencia, CA, USA). Target gene expression was analyzed by real-time RT-PCR. The primer sequences for the gut microbiota are shown in Table 2. The DNA expression levels were normalized to the expression of 16S rRNA.
Table 2.
Primer sequences used for the gut microbiota.
| Target | Forward Primer (5’ to 3’) | Reverse Primer (5’ to 3’) |
|---|---|---|
| Firmicutes [18] | TGAAACTYAAAGGAATTGACG | ACCATGCACCACCTGTC |
| Bacteroidetes [19] | GGGGTTCTGAGAGGAAGGT | CCGTCATCCTTCACGCTACT |
| Proteobacteria [20] | CATGACGTTACCCGCAGAAGAAG | CTCTACGAGACTCAAGCTTGC |
| Actinobacteria [21] | TGTAGCGGTGGAATGCGC | AATTAAGCCACATGCTCCGCT |
| Lactobacillus spp. [22] | TGGAAACAGRTGCTAATACCG | GTCCATTGTGGAAGATTCCC |
| Bifidobacterium spp. [23] | GGTGTTCTTCCCGATATCTACA | CTCCTGGAAACGGGTGG |
| Bacteroides fragilis [23] | ATAGCCTTTCGAAAGRAAGAT | CCAGTATCAACTGCAATTTTA |
| Clostridium coccoides [24] | GCCACATTGGGACTGAGA | GCTTCTTAGTCAGGTACCG |
| 16S rRNA [25] | TCCTACGGGAGGCAGCAGT | GGACTACCAGGGTATCTAATCCTGTT |
2.9. Statistical Analysis
The results are presented as the mean ± standard deviation. The Tukey’s test was used to compare data among groups. Values of p < 0.05 were considered to indicate significance.
3. Results
3.1. Scratching Behavior
We examined the effect of AP on scratching behavior (Figure 2). When AP was administered to mice, no changes occurred in either the body or liver weight (Figure 2A,B). The frequency of scratching behavior in the TMA-control group was approximately 250 times per 30 min, which was approximately 10 times higher than that in the normal group. In contrast, the frequency of scratching behavior in the TMA+AP 1.5% group was approximately 180 times per 30 min, while that in the TMA+AP 3% group was approximately 130 times per 30 min, showing that AP exhibited a significant dose-dependent reduction in scratching behavior (Figure 2C).
Figure 2.
Scratching behavior. Mice with atopic dermatitis induced by repeated application of TMA were given a diet with AP. The body weight (A), liver weight (B), and scratching behavior (C) were measured (mean ± SD, N = 8, *** p < 0.001 vs. normal group, # p < 0.05 vs. TMA-control group, ## p < 0.01 vs. TMA-control group).
The above results demonstrate that AP inhibits the scratching behavior induced by TMA.
3.2. Skin Inflammation
At the onset of atopic dermatitis, skin inflammation occurs and the expression levels of inflammatory markers, such as TNF-α, IL-6, iNOS, and COX-2, increase [26,27]. We observed the skin condition and the effect of AP on the inflammatory reactions using these expression levels as indexes (Figure 3 and Figure 4).
Figure 3.
Skin inflammation. Mice with atopic dermatitis induced by repeated application of TMA were given a diet with AP. Clinical features of skin were observed (A). Skin tissue was assessed by HE staining (B).
Figure 4.
The mRNA expression levels of TNF-α (A), IL-6 (B), iNOS (C), and COX-2 (D). Mice with atopic dermatitis induced by repeated application of TMA were given a diet with AP. The skin was harvested, and the TNF-α (A), IL-6 (B), iNOS (C), and COX-2 (D) mRNA expression levels were measured using real-time RT-PCR (mean ± SD, N = 8, ** p < 0.01 vs. normal group, # p < 0.05 vs. TMA-control group).
Redness was noted in the ears of the TMA-control group mice compared with the normal group, and epidermal thickening, ulcers, and inflammatory cell infiltration into the dermis was observed. In contrast, improvement of these effects was noted in the TMA+AP 3% group compared with the TMA-control group (Figure 3).
The mRNA expression levels of TNF-α, IL-6, iNOS, and COX-2 in the ears of the TMA-control group increased markedly compared with the levels in the normal group. In contrast, the expression levels of TNF-α, IL-6, iNOS, and COX-2 in the ears of mice that were administered AP were significantly decreased compared with the levels in the TMA-control group (Figure 4).
Based on these findings, it is suggested that AP inhibits TMA-induced inflammatory reactions.
3.3. The Phyla Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria
Recently, it has become clear that changes in the gut microbiota are associated with the onset and remission of atopic dermatitis [1,3,4,5,6]. Therefore, we investigated the mechanism by which AP inhibited atopic dermatitis, focusing on the intestinal flora.
Ninety-nine percent of human intestinal bacteria belong to four phyla: Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria [28,29]. The abundance of the gut microbiota (phyla Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria) in the TMA-control group was approximately the same as that in the normal group. In contrast, administration of AP significantly decreased the abundance of the phylum Firmicutes in the gut microbiota and significantly increased that of the phyla Bacteroidetes and Actinobacteria (Figure 5).
Figure 5.
The phyla Firmicutes (A), Bacteroidetes (B), Proteobacteria (C), and Actinobacteria (D). Mice with atopic dermatitis induced by repeated application of TMA were given a diet with AP. The feces were collected from the colon, and the abundances of the phyla Firmicutes (A), Bacteroidetes (B), Proteobacteria (C), and Actinobacteria (D) in the gut microbiota were measured using real-time PCR (mean ± SD, N = 8, *** p < 0.001 vs. normal group, # p < 0.05 vs. TMA-control group, ## p < 0.01 vs. TMA-control group, ### p < 0.001 vs. TMA-control group).
Based on these findings, it is suggested that AP causes significant alterations in the gut microbiota.
3.4. Bifidobacterium spp., Lactobacillus spp., Bacteroides fragilis, and Clostridium coccoides
Gut microbes, such as Bifidobacterium spp. and Lactobacillus spp., are called beneficial bacteria and are considered to be effective in the prevention and treatment of many diseases [1,3,4,5,6]. Meanwhile, both Bacteroides fragilis and Clostridium coccoides are related to the onset and remission of inflammatory diseases [30,31,32]. The abundance of Bifidobacterium spp. in the gut microbiota decreased significantly in the TMA-control group compared with the normal group. In contrast, the abundance of Bifidobacterium spp. increased significantly in the AP-treated group in a dose-dependent manner compared with the TMA-control group (Figure 6A). No differences were noted in the abundance of Lactobacillus spp., B. fragilis, or C. coccoides in the gut microbiota between the normal group and the TMA-control group. The abundances of these bacteria increased significantly with the administration of AP (Figure 6B–D).
Figure 6.
Bifidobacterium spp. (A), Lactobacillus spp. (B), Bacteroides fragilis (C), and Clostridium coccoides (D). Mice with atopic dermatitis induced by repeated application of TMA were given a diet with AP. The feces were collected from the colon, and the abundances of Bifidobacterium spp. (A), Lactobacillus spp. (B), Bacteroides fragilis (C), and Clostridium coccoides (D) in the gut microbiota were measured using real-time PCR (mean ± SD, N = 8, * p < 0.05 vs. normal group, ** p < 0.01 vs. normal group, *** p < 0.001 vs. normal group, # p < 0.05 vs. TMA-control group, ## p < 0.01 vs. TMA-control group, ### p < 0.001 vs. TMA-control group).
Based on the above findings, it is suggested that AP increases the abundances of Bifidobacterium spp., Lactobacillus spp., B. fragilis, and C. coccoides.
4. Discussion
AP is a powder extracted from the bark of A. mearnsii De Wild. by using hot water. It contains large amounts of flavonoids, such as fisetinidol and robinetinidol [15,16,17], and its antidiabetic, antiobesity, and antihypertensive effects have been confirmed [9,10,11]. In this study, we examined the effect of AP on atopic dermatitis and the underlying mechanism.
Model mice with atopic dermatitis exhibiting scratching behavior can be generated by regularly applying TMA to the ears of the mice. The mice used in this study also exhibited increased scratching behavior, as observed in previous reports [6]. When AP was administered to model mice with TMA-induced atopic dermatitis, inhibition of scratching behavior was observed (Figure 2). Although inflammatory reactions on the skin were noted in these model mice, AP significantly inhibited these reactions (Figure 3 and Figure 4). As it has been reported that the induction of skin inflammation increases the intensity of itchiness, there is a close relation between inflammatory reactions and scratching behavior [33]. Thus, these findings suggest that AP inhibits skin inflammatory reactions and restrains scratching behavior.
It is commonly known that polyphenols have a low rate of absorption. Thus, although we have not conducted a pharmacokinetic study of AP, it is considered that components containing AP are unlikely to affect the skin after being absorbed into the body. Meanwhile, we have confirmed that polyphenols change the flora in the large intestine, resulting in substantial alteration of hepatic functional molecules [7,8]. Therefore, we considered that there is a possibility that AP changes the gut microbiota and inhibits symptoms of atopic dermatitis. As a result, the abundance of the phylum Firmicutes decreased markedly in TMA-treated mice that were administered AP, while that of the phyla Bacteroidetes and Proteobacteria increased significantly (Figure 5). It was also revealed that the abundances of Bifidobacterium spp. and Lactobacillus spp., which are involved in the onset and cure of atopic dermatitis [1,3,4,5,6], increased with the administration of AP to TMA-treated mice. In addition, the amounts of B. fragilis, which corrects intestinal immunity and is involved in the allergy-like eczema [32], increased with the administration of AP (Figure 6). Moreover, AP increased the amount of C. coccoides, which has been shown to be involved in the development of inflammatory diseases [31]. Although no reports have directly linked C. coccoides to the onset of atopic dermatitis, it was considered that C. coccoides corrects intestinal immunity, similar to B. fragilis. Based on the above findings, it was suggested that AP alters the gut microbiota substantially and likely prevents the onset of atopic dermatitis.
It has been reported that patients with atopic dermatitis have large amounts of intestinal Clostridium spp. (phylum Firmicutes) and small amounts of intestinal Bifidobacterium spp. (phylum Actinobacteria) [2]. However, there were no differences in the amounts of most gut microbes between the normal group and the TMA-control group (Figure 5 and Figure 6), suggesting that there is no correlation between TMA-induced atopic dermatitis-like symptoms and alteration of the gut microbiota. On the other hand, the abundance of Bifidobacterium spp. in the gut microbiota decreased significantly in the TMA-control group compared with the normal group. Although it has been reported that the application of hapten changes in gut microbiota [6], the reason for this is hardly known. This result suggests that skin inflammation may regulate gut microbiota and this is an important finding in considering the skin–gut axis. In the future, analysis of the effect of AP on gut microbiota in patients with atopic dermatitis is awaited.
The gut microbiota is associated with the onset of many diseases other than atopic dermatitis. For instance, it is known that in patients with obesity the abundance of the phylum Firmicutes is high, while that of the phylum Bacteroidetes is low, and the Firmicutes-to-Bacteroidetes ratio is used as an obesity index [34,35]. In addition, it was reported that the Firmicutes-to-Bacteroidetes ratio increased in diabetes [36], coronary artery disease [37], or hypertension [38]. When normal mice were fed AP, the intestinal abundance of the phylum Firmicutes decreased, while that of the phylum Bacteroidetes increased (Figure 5). These results indicate the association of changes in the gut microbiota with the antiobesity, antidiabetic, and antihypertensive action of AP.
Currently, in addition to probiotics, many prebiotics that promote the growth of intestinal bacteria are offered commercially, with the aim of preventing and treating diseases through correction of the gut microbiota. The present study—which demonstrates that polyphenols are involved in significant alteration of the gut microbiota—suggests that polyphenols may be useful as an intestinal-flora-improving food, in addition to probiotics and prebiotics. We believe that our findings provide crucial insights.
Acknowledgments
We thank Mami Sasaki and Makiba Ochiai (Department of Biomolecular Pharmacology, Hoshi University) for their technical assistance. We also thank Yosuke Matsuo and Takashi Tanaka (Department of Natural Product Chemistry, Graduate School of Biomedical Sciences, Nagasaki University) for providing HPLC profile of the extract of Acacia mearnsii bark. We thank Sosuke Ogawa and Tomoki Kobayashi (Acacia-No-Ki Co., Ltd.) for advice and discussions before starting this experiment.
Supplementary Materials
The following are available online at https://www.mdpi.com/2304-8158/9/6/773/s1, Figure S1: HPLC profile of the extract of Acacia mearnsii bark. Dried extract of Acacia mearnsii was solubilized with 60% EtOH (5.0 mg/mL). After filtration (membrane filter, 0.45 μm), 10 μL of filtrate was analyzed by analytical HPLC. Analytical HPLC was performed on a Cosmosil 5C18-ARII (Nacalai Tesque, Kyoto, Japan) column (250 × 4.6 mm, i.d.) with a gradient elution of 4−30% (39 min) and 30−75% (15 min) CH3CN in 50 mM H3PO4 at 35 °C (flow rate, 0.8 mL/min; detection, 230 nm; detector: Jasco photodiode array detector MD-4010, Jasco, Tokyo, Japan).
Author Contributions
Conceptualization, N.I. and K.S.; methodology, N.I. and K.S.; formal analysis, N.I., N.F. (Natsumi Fujitate) T.T., N.T. and N.F. (Natsuko Fukuda); writing—original draft preparation, N.I., N.F. (Natsumi Fujitate), R.K., H.S. and J.K.; writing—review and editing, K.S. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by Acacia-No-Ki Co., Ltd.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.
References
- 1.Saavedra J.M. Use of probiotics in pediatrics: Rationale, mechanisms of action, and practical aspects. Nutr. Clin. Pract. 2007;22:351–365. doi: 10.1177/0115426507022003351. [DOI] [PubMed] [Google Scholar]
- 2.Kalliomaki M., Kirjavainen P., Eerola E., Kero P., Salminen S., Isolauri E. Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J. Allergy Clin. Immunol. 2001;107:129–134. doi: 10.1067/mai.2001.111237. [DOI] [PubMed] [Google Scholar]
- 3.Di Pierro F., Basile I., Danza M.L., Venturelli L., Contini R., Risso P., Colombo M. Use of a probiotic mixture containing Bifidobacterium animalis subsp. lactis BB12 and Enterococcus faecium L3 in atopic children. Minerva Pediatr. 2018;70:418–424. doi: 10.23736/S0026-4946.18.05203-9. [DOI] [PubMed] [Google Scholar]
- 4.Lee S.H., Yoon J.M., Kim Y.H., Jeong D.G., Park S., Kang D.J. Therapeutic effect of tyndallized Lactobacillus rhamnosus IDCC 3201 on atopic dermatitis mediated by down-regulation of immunoglobulin E in NC/Nga mice. Microbiol. Immunol. 2016;60:468–476. doi: 10.1111/1348-0421.12390. [DOI] [PubMed] [Google Scholar]
- 5.Matsumoto M., Aranami A., Ishige A., Watanabe K., Benno Y. LKM512 yogurt consumption improves the intestinal environment and induces the T-helper type 1 cytokine in adult patients with intractable atopic dermatitis. Clin. Exp. Allergy. 2007;37:358–370. doi: 10.1111/j.1365-2222.2007.02642.x. [DOI] [PubMed] [Google Scholar]
- 6.Yeom M., Sur B.J., Park J., Cho S.G., Lee B., Kim S.T., Kim K.S., Lee H., Hahm D.H. Oral administration of Lactobacillus casei variety rhamnosus partially alleviates TMA-induced atopic dermatitis in mice through improving intestinal microbiota. J. Appl. Microbiol. 2015;119:560–570. doi: 10.1111/jam.12844. [DOI] [PubMed] [Google Scholar]
- 7.Ikarashi N., Ogawa S., Hirobe R., Kon R., Kusunoki Y., Yamashita M., Mizukami N., Kaneko M., Wakui N., Machida Y., et al. Epigallocatechin gallate induces a hepatospecific decrease in the CYP3A expression level by altering intestinal flora. Eur. J. Pharm. Sci. 2017;100:211–218. doi: 10.1016/j.ejps.2017.01.022. [DOI] [PubMed] [Google Scholar]
- 8.Ikarashi N., Ogawa S., Hirobe R., Kusunoki Y., Kon R., Ochiai W., Sugiyama K. High-dose green tea polyphenol intake decreases CYP3A expression in a liver-specific manner with increases in blood substrate drug concentrations. Eur. J. Pharm. Sci. 2016;89:137–145. doi: 10.1016/j.ejps.2016.04.031. [DOI] [PubMed] [Google Scholar]
- 9.Ikarashi N., Takeda R., Ito K., Ochiai W., Sugiyama K. The inhibition of lipase and glucosidase activities by acacia polyphenol. Evid. Based Complement. Altern. Med. 2011;2011:272075. doi: 10.1093/ecam/neq043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ikarashi N., Toda T., Hatakeyama Y., Kusunoki Y., Kon R., Mizukami N., Kaneko M., Ogawa S., Sugiyama K. Anti-hypertensive effects of acacia polyphenol in spontaneously hypertensive rats. Int. J. Mol. Sci. 2018;19:700. doi: 10.3390/ijms19030700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Ikarashi N., Toda T., Okaniwa T., Ito K., Ochiai W., Sugiyama K. Anti-obesity and anti-diabetic effects of acacia polyphenol in obese diabetic KKAy mice fed high-fat diet. Evid. Based Complement. Altern. Med. 2011;2011:952031. doi: 10.1093/ecam/nep241. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Ikarashi N., Sato W., Toda T., Ishii M., Ochiai W., Sugiyama K. Inhibitory effect of polyphenol-rich fraction from the bark of acacia mearnsii on itching associated with allergic dermatitis. Evid. Based Complement. Altern. Med. 2012;2012:120389. doi: 10.1155/2012/120389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Schneider C., Docke W.D., Zollner T.M., Rose L. Chronic mouse model of TMA-induced contact hypersensitivity. J. Invest. Derm. 2009;129:899–907. doi: 10.1038/jid.2008.307. [DOI] [PubMed] [Google Scholar]
- 14.Cutting N.J. The development and application of speciality wattle extracts. J. Soc. Leather Tech. Chem. 1997;81:89–93. [Google Scholar]
- 15.Kusano R., Ogawa S., Matsuo Y., Tanaka T., Yazaki Y., Kouno I. alpha-Amylase and lipase inhibitory activity and structural characterization of acacia bark proanthocyanidins. J. Nat. Prod. 2011;74:119–128. doi: 10.1021/np100372t. [DOI] [PubMed] [Google Scholar]
- 16.Matsuo Y., Kusano R., Ogawa S., Yazaki Y., Tanaka T. Characterization of the alpha-Amylase Inhibitory Activity of Oligomeric Proanthocyanidins from Acacia mearnsii Bark Extract. Nat. Prod. Commun. 2016;11:1851–1854. [PubMed] [Google Scholar]
- 17.Ogawa S., Matsuo Y., Tanaka T., Yazaki Y. Utilization of Flavonoid compounds from bark and wood. III. application in health foods. Molecules. 2018;23:1860. doi: 10.3390/molecules23081860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bacchetti De Gregoris T., Aldred N., Clare A.S., Burgess J.G. Improvement of phylum- and class-specific primers for real-time PCR quantification of bacterial taxa. J. Microbiol. Methods. 2011;86:351–356. doi: 10.1016/j.mimet.2011.06.010. [DOI] [PubMed] [Google Scholar]
- 19.Siefring S., Varma M., Atikovic E., Wymer L., Haugland R.A. Improved real-time PCR assays for the detection of fecal indicator bacteria in surface waters with different instrument and reagent systems. J. Water Health. 2008;6:225–237. doi: 10.2166/wh.2008.022. [DOI] [PubMed] [Google Scholar]
- 20.Queipo-Ortuno M.I., Seoane L.M., Murri M., Pardo M., Gomez-Zumaquero J.M., Cardona F., Casanueva F., Tinahones F.J. Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels. PLoS ONE. 2013;8:e65465. doi: 10.1371/journal.pone.0065465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Matsuki T., Watanabe K., Fujimoto J., Takada T., Tanaka R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl. Environ. Microbiol. 2004;70:7220–7228. doi: 10.1128/AEM.70.12.7220-7228.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Byun R., Nadkarni M.A., Chhour K.L., Martin F.E., Jacques N.A., Hunter N. Quantitative analysis of diverse Lactobacillus species present in advanced dental caries. J. Clin. Microbiol. 2004;42:3128–3136. doi: 10.1128/JCM.42.7.3128-3136.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Matsuki T., Watanabe K., Fujimoto J., Miyamoto Y., Takada T., Matsumoto K., Oyaizu H., Tanaka R. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl. Environ. Microbiol. 2002;68:5445–5451. doi: 10.1128/AEM.68.11.5445-5451.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Verma A.K., Verma R., Ahuja V., Paul J. Real-time analysis of gut flora in Entamoeba histolytica infected patients of Northern India. BMC Microbiol. 2012;12:183. doi: 10.1186/1471-2180-12-183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Nadkarni M.A., Martin F.E., Jacques N.A., Hunter N. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology. 2002;148:257–266. doi: 10.1099/00221287-148-1-257. [DOI] [PubMed] [Google Scholar]
- 26.Lee Y., Choi H.K., N’Deh K.P.U., Choi Y.J., Fan M., Kim E.K., Chung K.H., An A.J.H. Inhibitory Effect of Centella asiatica Extract on DNCB-Induced Atopic Dermatitis in HaCaT Cells and BALB/c Mice. Nutrients. 2020;12:411. doi: 10.3390/nu12020411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sur B., Lee B., Yoon Y.S., Lim P., Hong R., Yeom M., Lee H.S., Park H., Shim I., Lee H., et al. Extract of polygala tenuifolia alleviates stress-exacerbated atopy-like skin dermatitis through the modulation of protein kinase a and p38 mitogen-activated protein kinase signaling pathway. Int. J. Mol. Sci. 2017;18:190. doi: 10.3390/ijms18010190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Frank D.N., St Amand A.L., Feldman R.A., Boedeker E.C., Harpaz N., Pace N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. USA. 2007;104:13780–13785. doi: 10.1073/pnas.0706625104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sartor R.B. Microbial influences in inflammatory bowel diseases. Gastroenterology. 2008;134:577–594. doi: 10.1053/j.gastro.2007.11.059. [DOI] [PubMed] [Google Scholar]
- 30.Mazmanian S.K., Round J.L., Kasper D.L. A microbial symbiosis factor prevents intestinal inflammatory disease. Nature. 2008;453:620–625. doi: 10.1038/nature07008. [DOI] [PubMed] [Google Scholar]
- 31.Sokol H., Seksik P., Rigottier-Gois L., Lay C., Lepage P., Podglajen I., Marteau P., Dore J. Specificities of the fecal microbiota in inflammatory bowel disease. Inflamm. Bowel Dis. 2006;12:106–111. doi: 10.1097/01.MIB.0000200323.38139.c6. [DOI] [PubMed] [Google Scholar]
- 32.Zheng H., Liang H., Wang Y., Miao M., Shi T., Yang F., Liu E., Yuan W., Ji Z.S., Li D.K. Altered gut microbiota composition associated with eczema in infants. PLoS ONE. 2016;11:e0166026. doi: 10.1371/journal.pone.0166026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sakai H., Ishida T., Sato K., Mandokoro K., Yabe S., Sato F., Chiba Y., Kon R., Ikarashi N., Kamei J. Interference of skin scratching attenuates accumulation of neutrophils in murine allergic contact dermatitis model. Inflammation. 2019;42:2226–2235. doi: 10.1007/s10753-019-01086-y. [DOI] [PubMed] [Google Scholar]
- 34.Ley R.E., Turnbaugh P.J., Klein S., Gordon J.I. Microbial ecology: Human gut microbes associated with obesity. Nature. 2006;444:1022–1023. doi: 10.1038/4441022a. [DOI] [PubMed] [Google Scholar]
- 35.Turnbaugh P.J., Ley R.E., Mahowald M.A., Magrini V., Mardis E.R., Gordon J.I. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 2006;444:1027–1031. doi: 10.1038/nature05414. [DOI] [PubMed] [Google Scholar]
- 36.Remely M., Hippe B., Zanner J., Aumueller E., Brath H., Haslberger A.G. Gut Microbiota of Obese, Type 2 Diabetic Individuals is Enriched in Faecalibacterium prausnitzii, Akkermansia muciniphila and Peptostreptococcus anaerobius after Weight Loss. Endocr. Metab. Immune Disord. Drug Targets. 2016;16:99–106. doi: 10.2174/1871530316666160831093813. [DOI] [PubMed] [Google Scholar]
- 37.Emoto T., Yamashita T., Sasaki N., Hirota Y., Hayashi T., So A., Kasahara K., Yodoi K., Matsumoto T., Mizoguchi T., et al. Analysis of gut microbiota in coronary artery disease patients: A possible link between gut microbiota and coronary artery disease. J. Atheroscler. Thromb. 2016;23:908–921. doi: 10.5551/jat.32672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Mushtaq N., Hussain S., Zhang S., Yuan L., Li H., Ullah S., Wang Y., Xu J. Molecular characterization of alterations in the intestinal microbiota of patients with grade 3 hypertension. Int. J. Mol. Med. 2019;44:513–522. doi: 10.3892/ijmm.2019.4235. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.






