MicroRNA22-5p targets ten-eleven translocation and regulates estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

Li Xiao; Tianjiao Pei; Wei Huang; Min Zhou; Jing Fu; Jing Tan; Tingting Liu; Yong Song; Shiyuan Yang

doi:10.1371/journal.pone.0234086

. 2020 Jul 13;15(7):e0234086. doi: 10.1371/journal.pone.0234086

MicroRNA22-5p targets ten-eleven translocation and regulates estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

Li Xiao ^1,^2,^#, Tianjiao Pei ^1,^2,^#, Wei Huang ^1,^2,^*, Min Zhou ^1,², Jing Fu ^1,², Jing Tan ^1,², Tingting Liu ^1,², Yong Song ^1,², Shiyuan Yang ^1,²

Editor: Jae-Wook Jeong³

PMCID: PMC7357761 PMID: 32658928

Abstract

Based on microRNA (miR) microarray analysis, we previously found that miR22-5p expression is decreased in the mid-luteal endometrium of women with minimal/mild endometriosis. Bioinformatics analysis predicted that miR22-5p targets ten-eleven translocation (TET2) 3′-untranslated region. This study aimed to determine the regulation and roles of miR22-5p in the pathogenesis of minimal/mild endometriosis-associated infertility. MiR22-5p and TET2 expression in the mid-luteal endometrium from women with or without minimal/mild endometriosis was analyzed. After transfection with miR22-5p mimics or inhibitor, TET2 expression was analyzed by quantitative reverse transcription (RT-q) PCR, western blotting and immunohistochemistry. 5-Hydroxymethylcytosine was determined by immunofluorescence and dot blotting. Expression and promoter methylation of estrogen receptor 2 (ESR2) was measured by RT-qPCR and western blotting, and by bisulfite sequencing, respectively. We first established that miR22-5p expression decreased and TET2 expression increased in minimal/mild endometriosis during implantation window. TET2 was found to be a direct target of miR22-5p. MiR22-5p regulated the expression of ESR2, but did not directly affect methylation of its promoter region (–197/+359). Our results suggest that an imbalance in miR22-5p expression in the mid-luteal endometrium may be involved in minimal/mild endometriosis-associated infertility.

Introduction

Endometriosis is characterized by the implantation and growth of endometrial tissue (glands and stroma) outside the uterine cavity. Women with endometriosis generally experience cyclical chronic pelvic pain, dyspareunia, and infertility, which significantly affect their quality of life. An estimated 30–50% of women with the disease are infertile, and 25–50% of infertile women are diagnosed as having endometriosis [1]. It has been suggested that endometriosis-associated infertility may be due to impaired pelvic anatomy, folliculogenesis, fertilization, and implantation [2–4]; however, the association between infertility and early-stage disease (minimal [stage I] and mild [stage II] endometriosis), in which no substantial pelvic anatomical changes are identified, remains controversial [4–6]. Endometrial receptivity is defined as a restricted period in the menstrual cycle during which the uterus is receptive to blastocyst attachment and implantation [7]. Innate pathology in the eutopic endometrium is suggested to contribute to implantation impairment in women with endometriosis with subfertility [8–10].

Progesterone resistance results in inadequate antagonism of estrogen action, increased inflammation, inadequate differentiation of the stroma, and remodeling of the endometrium, all of which can lead to a non-receptive endometrium for embryo implantation [11]. mRNA and protein levels of estrogen receptor 2 (ESR2) are significantly elevated in endometriotic cells as compared to normal stromal cells, whereas estrogen receptor 1 (ESR1), total progesterone receptor (PGR), and progesterone receptor B (PGR B) are repressed [12]. Increased ESR2 levels are directly related to ESR2 promoter hypomethylation in endometriotic cells [12, 13]. ESR2 represses ESR1 expression by directly binding to its promoter, which can result in progesterone resistance [12, 13]. However, the complete repertoire of ESR2 functions is believed to be more complicated.

MicroRNAs (miRNAs) are approximately 22-nucleotide non-coding RNAs that negatively regulate protein expression via translational inhibition or mRNA degradation. Emerging data suggest that dysregulation of miRNA expression may be implicated in the development and pathogenesis of endometriosis [14]. Using microarray-based miRNA profiling, we previously found that 66 mature miRNAs were differentially expressed (54 up- and 12 downregulated) in mid-luteal eutopic endometrium from women with minimal/mild endometriosis as compared with normal endometrial tissues [15]. Specifically, miR-196a upregulated MEK/ERK signaling and mediated repressed PGR expression and decidualization of endometrial stromal cells (ESCs) from eutopic endometrium with endometriosis [15]. Likewise, upregulation of miR-194-3p in eutopic endometrium inhibited PGR expression and ESC decidualization in endometriosis, which hinders fertility by repressing the levels of PGR and decidualization in the eutopic endometrium [16]. We have also shown that miR23a and miRNA23b are downregulated in endometriosis and they upregulate several unidentified genes required for Steroidogenic factor 1 (SF-1) expression in ESCs [17].

Bioinformatics analysis of a downregulated miRNA, miR22-5p, revealed a binding site in the 3′-untranslated region (3′-UTR) of ten-eleven translocation 2 (TET2) [18]. The TET family encodes enzymes responsible for the oxidation of 5-methylcytosine (5mC) to 5-hmC in DNA demethylation. Genome-wide analysis of endometriomas revealed significantly low TET gene expression associated with high 5-hmC levels upon in-vitro decidualization, suggesting a unique epigenetic regulation in these ectopic tissues [19]. However, how TET2 affects minimal/mild endometriosis-related infertility and the specific mechanism are unknown.

The aim of the present study was to evaluate miR22-5p expression and the relationship between miR22-5p and TET2 expression in mid-luteal eutopic endometrium of infertile women with and without minimal/mild endometriosis using tissues and primary ESCs.

Material and methods

Study population

This study was approved by the Medical Research Review Board of West China Second University Hospital of Sichuan University, and written informed consent for participation was obtained from all participants. In total, 50 infertile women aged 22–34 years old with regular menstrual cycles were enrolled in this study between January 2015 and May 2018. Normal endometrium was obtained from 24 infertile women without endometrial pathology, and eutopic endometrium was obtained from 26 infertile women with a laparoscopic and histological diagnosis of stage I–II endometriosis according to the revised American Fertility Society classification system (Table 1). Participants with adenomyosis, leiomyomas, endometrial hyperplasia, genital tumors, acute pelvic inflammatory disease, or receiving hormonal treatment within the previous three months were excluded. Secretory-phase endometrial tissues, assessed based on the timing of the last menstrual period and histological analysis, were used in the study.

Table 1. Details of patient samples used in this study.

Code	Age	Menstrual stage	Indication/diagnosis	Assay
1	25	Secretory	Minimal/mild endometriosis	IHC
2	25	Secretory	Minimal/mild endometriosis	IHC, Q
3	28	Secretory	Minimal/mild endometriosis	IHC, Q
4	31	Secretory	Minimal/mild endometriosis	Q
5	34	Secretory	Minimal/mild endometriosis	Q
6	32	Secretory	Minimal/mild endometriosis	Q
7	26	Secretory	Minimal/mild endometriosis	Q
8	25	Secretory	Minimal/mild endometriosis	Q
9	23	Secretory	Minimal/mild endometriosis	Q
10	31	Secretory	Minimal/mild endometriosis	Q
11	33	Secretory	Minimal/mild endometriosis	Q
12	28	Secretory	Minimal/mild endometriosis	Q
13	23	Secretory	Minimal/mild endometriosis	Q
14	34	Secretory	Minimal/mild endometriosis	Q
15	27	Secretory	Minimal/mild endometriosis	WB
16	27	Secretory	Minimal/mild endometriosis	WB
17	26	Secretory	Minimal/mild endometriosis	WB
18	28	Secretory	Minimal/mild endometriosis	WB
19	31	Secretory	Minimal/mild endometriosis	WB
20	32	Secretory	Minimal/mild endometriosis	WB
21	34	Secretory	Minimal/mild endometriosis	PCC
22	26	Secretory	Minimal/mild endometriosis	PCC
23	26	Secretory	Minimal/mild endometriosis	PCC
24	29	Secretory	Minimal/mild endometriosis	PCC
25	24	Secretory	Minimal/mild endometriosis	PCC
26	26	Secretory	Minimal/mild endometriosis	PCC
27	26	Secretory	Peritubal adhesion	Q
28	28	Secretory	Peritubal adhesion	Q
29	25	Secretory	Pelvic adhesion	Q
30	30	Secretory	Peritubal adhesion	Q
31	31	Secretory	Peritubal adhesion, mesosalpinx cyst	Q
32	25	Secretory	Peritubal adhesion, mesosalpinx cyst	Q
33	28	Secretory	Peritubal adhesion, mesosalpinx cyst	Q
34	28	Secretory	Peritubal adhesion, mesosalpinx cyst	Q
35	24	Secretory	Peritubal adhesion	Q
36	29	Secretory	Peritubal adhesion	Q
37	24	Secretory	Peritubal adhesion	IHC, Q
38	31	Secretory	Peritubal adhesion	IHC
39	33	Secretory	Peritubal adhesion	IHC
40	32	Secretory	Peritubal adhesion	WB
41	25	Secretory	Peritubal adhesion	WB
42	26	Secretory	Peritubal adhesion	WB
43	28	Secretory	Peritubal adhesion	WB
44	24	Secretory	Pelvic adhesion	WB
45	26	Secretory	Pelvic adhesion	PCC
46	24	Secretory	Pelvic adhesion	PCC
47	22	Secretory	Peritubal adhesion	PCC
48	28	Secretory	Peritubal adhesion	PCC
49	31	Secretory	Peritubal adhesion	PCC
50	32	Secretory	Peritubal adhesion	PCC

Open in a new tab

Primary cell culture and transfection

ESCs were isolated from eutopic endometrium (n = 3) and normal endometrium (n = 3) as described previously. Isolated ESCs were cultured in DMEM/F12 (1:1) supplemented with 10% fetal bovine serum (FBS) at 37°C. 293T human embryonic kidney cells were obtained from Sichuan University, Chinese University of Hong Kong Joint Laboratory for Reproductive Medicine, and were maintained in DMEM supplemented with 10% FBS. When cells reached 80% confluency, they were trypsinized and seeded into 6-well plates at 1.0 × 10⁵ cells/mL. When the cells reached 30–40% confluency, they were transfected with Hsa-miR22-5p mimics or inhibitor (100 nM, Guangzhou RiboBio, Guangzhou, China), using Lipofectamine 3000 transfection reagent (Invitrogen, Carlsbad, CA), according to the manufacturer’s protocol. After 48–72 h of culture, the cells were harvested and collected for mRNA isolation or protein extraction. All experiments were performed in triplicate.

RNA extraction and quantitative reverse-transcription (RT-q)PCR

Total RNA was extracted from endometrial tissues and primary cultured ESCs using TRIzol reagent (Life Technologies, Carlsbad, CA), according to the manufacturer’s protocol. RNA quality and purification were analyzed using a NanoVue Plus spectrophotometer (Healthcare Bio-Sciences AB, Uppsala, Sweden). cDNA was synthesized from purified total RNA using a PrimeScript RT reagent kit (TaKaRa Biotechnology, Dalian, China). Primer sequences for TET2, ESR1, ESR2, and GAPDH (Sango Biotech, Shanghai, China) are listed in Table 2. qPCRs were run using SYBR Green real-time PCR Master Mix (Toyobo, Osaka, Japan) on an Applied Biosystems 7900 Real-time PCR Detection System (ABI, Foster City, CA). The thermal cycles were 95°C for 20 s followed by 40 cycles of 95°C for 10 s and 60°C for 20 s. The specificity of PCR products was confirmed by dissociation curve analysis. GAPDH was used as an endogenous control to normalize target gene expression, and relative expression was calculated using the 2^–ΔΔCt method. For the quantitation of mature miRNAs, miRNA RT-qPCR was conducted using specific primers for miR22-5p and U6 small nuclear RNA (as an internal control) from the Bulge-Loop qRT-PCR Primer Set (Guangzhou RiboBio, Guangzhou, China), according to the manufacturers’ protocol. All experiments were repeated three times.

Table 2. Primers used for RT-qPCR.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
TET2	`ATACCCTGTATGAAGGGAAGCC`	`CTTACCCCGAAGTTACGTCTTTC`
ESR1	`GAAAGGTGGGATACGAAAAGACC`	`GCTGTTCTTCTTAGAGCGTTTGA`
ESR2	`AGCACGGCTCCATATACATACC`	`TGGACCACTAAAGGAGAAAGGT`
GAPDH	`TGCACCACCAACTGCTTAGC`	`GGCATGGACTGTGGTCATGAG`

Open in a new tab

Western blot analysis

Total protein was extracted using radio immunoprecipitation lysis buffer (P0013B, Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Protein concentrations were determined using a bicinchoninic acid assay kit (Beyotime Biotechnology). Proteins (30 μg) from each sample were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis and were transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA). The membranes were blocked in 5% defatted milk at room temperature for 1 h. Then, the membranes were incubated with mouse anti-human TET2 (1:400; ab94580, Abcam, Cambridge, UK), polyclonal rabbit anti-human ESR2 (1:400; ab3577, Abcam), polyclonal mouse anti-β-actin (1:30000; bs-2188R, Bioss, Beijing, China) antibodies at 4°C overnight and then with horseradish peroxidase–conjugated secondary anti-mouse/rabbit antibody at room temperature for 1 h. Proteins bands were visualized using an enhanced chemiluminescence system (Millipore) and were analyzed with ImageJ 2X (National Institutes of Health, Bethesda, MD). Protein levels were normalized to that of β-actin.

Luciferase reporter assay

The base sequences of TET2 3′-UTR fragments were identical to the sequences in the NCBI public bioinformation resource (www.ncbi.nlm.nih.gov/gene/54790). MiR22-5p targets were predicted using TargetScan (http://www.targetscan.org) and microRNA.org (http://microrna.org). Three potential miR22-5p target sites were identified in the 3′-UTR of the TET2 mRNA sequence. Reporter genes were constructed by PCR amplification, gel purification, and restriction digest of the TET2 3′-UTR. Three wild-type (WT) TET2 3′-UTR fragments each containing one of the predicted miR22-5p-binding sites were cloned into the pmiR-RB-REPORT vector (Promega, Fitchburg, WI). The constructed reporter plasmids were designated TET2 3′-UTR WT1, TET2 3′-UTR WT2, and TET2 3′-UTR WT3. The differential expressed TET2 3’-UTR WT1, mutation of TET2 3’-UTR WT1 (TET2 3’-UTR M1) was also designated. 293T cells were transfected with the reporter plasmids and 50 nM of miR22-5p mimic or miRNA negative control (Guangzhou RiboBio, Guangzhou, China). After 48 h, the cells were harvested and luciferase activity was measured using a dual-luciferase reporter assay system (Promega) according to the manufacturer’s protocol. All transfections and assays were performed three times, with six technical replicates.

Immunofluorescence

Endometrial cells (25 × 10³) were seeded on glass coverslips in 24-well plates. After treatment, the cells were fixed in 4% paraformaldehyde in 1× PBS for 15 min, washed in PBS, and treated with 0.2% Triton X-100 in PBS for 15 min. Permeabilized cells were denatured with 2 N HCl for 15 min and neutralized with 100 mM Tris-HCl (pH 8.5) for 10 min. Proteins were blocked in 1% BSA in PBS for 30 min and then, the cells were incubated with rabbit anti-human 5-hmc antibody (1:100) and mouse anti-human TET2 antibody (1:200) at room temperature for 2 h, followed by Alexa Fluor 488-labeled anti-mouse antibody (Life Technologies). After washing, the cells were counterstained with 4′,6-diamidino-2-phenylindole.

Dot blot assay

Genomic DNA was extracted from primary cells using a DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s protocol. DNA samples were diluted with 2 N NaOH and 10 mM Tris Cl (pH 8.5) and blotted onto a nitrocellulose membrane. After baking at 80°C for 30 min and blocking in 5% nonfat milk at room temperature for 1 h, the membrane was incubated with a polyclonal rabbit anti-human 5-hmC antibody (Active Motif 39769, 1:10,000) at 4°C overnight. 5-hmC was visualized using chemiluminescence. The membranes were stained with methylene blue to assess equal DNA loading.

Immunohistochemistry

Tissue was embedded in paraffin, cut into 5-μm sections, and mounted onto gelatin-coated slides. Sections were dried at 37°C overnight, deparaffinized in xylene, and rehydrated through a graded ethanol series. The slides were immersed in citrate antigen retrieval buffer (pH 6) at 120°C for 10 min to retrieve the epitopes, incubated with 3% H₂O₂ for 10 min to block endogenous peroxidase activity after cooling, blocked with 10% normal goat serum for 30 min, and incubated with the primary antibody (TET2 1:200, 5-hmc 1:200) at 4°C overnight. Biotinylated secondary antibody and streptavidin-peroxidase conjugate were applied according to the manufacturer’s instructions (Beijing Zhongshan Biotech, Beijing, China). Immunoreactivity was visualized with diaminobenzidine, and the sections were counterstained with hematoxylin and mounted. Isotype controls were performed with matched concentrations of mouse IgG for TET2 and rabbit IgG for 5-hmC.

Bisulfite modification and sequencing

Genomic DNA was extracted from miR22-5p inhibitor- and control-transfected primary ESCs (n = 3) from infertile women without endometriosis using the DNeasy Tissue Kit (Qiagen) and was used for bisulfite modification and sequencing analysis (Sangon Biotech, Shanghai, China). Three microliters of bisulfite-modified DNA was PCR-amplified a reaction volume of 50 μl, using the following primers for ESR2: forward: 5′-ATTATTTTTGTGGGTGGATTAGGAG-3′, and reverse: 5′-AACCCCTTCTTCCTTTTAAAAACC-3′. Thermal cycles were as follows: 98°C for 4 min, 20 cycles of denaturation at 94°C for 45 s, annealing at 66°C for 45 s, and elongation at 72°C for 1 min, and 20 cycles of denaturation at 94°C for 45 s, annealing at 56°C for 45 s, and elongation at 72°C for 1 min, and finally, 72°C for 8 min. PCR products (166 bp) were gel-purified and cloned into the pUC18-T vector (Sangon Biotech). Following transformation, ten clones with the correct insert were randomly picked for each PCR product and were sequenced using an Applied Biosystems 3730XL instrument.

Statistical analysis

Statistical analysis was performed using SPSS version 18.0 (IBM Corp., USA). All data were expressed as the mean ± SD. Means of two groups were compared using Student’s t-test. P < 0.05 was considered statistically significant (two-tailed).

Results

MiR22-5p and TET2 expression signature discriminates eutopic endometrium of mild/minimal endometriosis from normal endometrium

In our previous microarray-based miRNA profiling analysis of mid-luteal endometrium from women with minimal and mild endometriosis, we observed a marked downregulation of miR22-5p [15]. To confirm these findings in this study, we subjected 13 endometrial tissues of mild/minimal endometriosis and 11 normal control tissues to RT-qPCR. MiR22-5p expression was significantly lower in eutopic endometrium of minimal/mild endometriosis than in normal tissues (Fig 1A). Next, we investigated the biological significance of miR22-5p downregulation in the regulation of target TET2 mRNAs. Compared to endometrium from women without endometriosis, TET2 expression was significantly higher in endometrium from women with minimal/mild endometriosis during the secretory phase (Fig 1B). TET2 protein levels were significantly higher in endometrium from women with minimal/mild endometriosis than in normal endometrium as indicated by western blot results (Fig 1C). Immunohistochemistry revealed that TET2 was strongly expressed in both the nucleus and the cytoplasm of epithelial and stromal cells of eutopic endometrium of endometriosis, whereas normal endometrium exhibited weak to moderate expression (Fig 1D). The above results suggested a correlation between miR22-5p and TET2 in minimal/mild endometriosis. The DNA pyrimidine nitrogen base 5-hmC was strongly expressed in both the nucleus and the cytoplasm of epithelial and stromal cells of eutopic and normal endometrium (Fig 1D).

Fig 1 — (A) RT-qPCR analysis of miR22-5p and (B) *TET2* expression in endometrium of minimal/mild endometriosis (n = 13) and normal endometrium (n = 11). miRNA expression was normalized to U6 snRNA expression, and mRNA expression was normalized to *GAPDH* expression. (C) Western blot analysis of TET2 expression in mild endometriosis (n = 6) and in normal endometrium (n = 5), normalized to GAPDH expression. (D) Representative Immunohistochemistry images showing TET2 and 5-hmC in the cytoplasmic and nuclear regions of stromal and epithelial cells in endometrium of mild endometriosis and normal endometrium (n = 3). Black arrows indicate positive staining. Scale bars, 200 μm. Data represent the mean ± SD and were analyzed by Student’s t-test.

MiR22-5p regulates TET2 expression in primary ESCs

We examined the impact of miR22-5p on TET2 expression by transfecting primary ESCs with miR22-5p mimics and inhibitor. Successful miR22-5p mimic and inhibitor transfection was validated by a significant increase (0.85 ± 0.15 vs. 5189.65 ± 3062.38; P < 0.001; Fig 2A) and decrease (0.98 ± 0.22 vs. 0.17 ± 0.09; P < 0.001; Fig 2A), respectively, in miR22-5p in ESCs. Upon miR22-5p mimic transfection, we observed significant decreases in the TET2 mRNA (1.03 ± 0.12 vs. 0.51 ± 0.24, P < 0.001, Fig 2B) and protein (1.05 ± 0.20 vs. 0.12 ± 0.04, P = 0.001, Fig 2C and 2E) levels. Accordingly, following transfection with miR22-5p inhibitor, we observed significant increases in the TET2 mRNA (1.07 ± 0.17 vs. 1.52 ± 0.28, P < 0.001, Fig 2B) and protein (1.53 ± 0.14. vs. 1.02 ± 0.19, P = 0.02, Fig 2D and 2E) levels.

Next, we investigated 5-hmC expression in genomic DNA of ESCs following transfection with miR22-5p mimics and inhibitor by dot blot assays (Fig 2F). Treatment with the miR22-5p mimics and inhibitor decreased and increased global 5-hmC, respectively. Consistent with the western blotting and DNA methylation dot blot assay results, immunofluorescence revealed that the expression of TET2 and 5-hmC was decreased in miR22-5p mimics-treated cells, whereas they were overexpressed in miR22-5p inhibitor-treated cells (Fig 3).

MiR22-5p directly targets the TET2 3′-UTR

We used a luciferase reporter assay to determine whether TET2 regulation was mediated by direct binding of miR22-5p to its 3′-UTR (Fig 4A). 293T cells cotransfected with a reporter plasmid and miR22-5p mimics showed significantly decreased luciferase activity as compared to cells transfected with the reporter plasmid alone only for the TET2 3′-UTR WT1 construct, among the three wild-type constructs evaluated (Fig 4B). Direct interaction of miR22-5p with TET2 was confirmed by using a luciferase reporter harboring a point mutation (Fig 4C).

MiR22-5p affects ESR2 mRNA and protein expression

To investigate the impact of miR22-5p on ESR2 expression, we assessed primary ESCs following transfection with miR22-5p mimics or its inhibitor. ESR2 mRNA expression was significantly downregulated after transfection with miR22-5p mimics (1.11 ± 0.30 vs. 0.42 ± 0.35, P < 0.001, Fig 5A), and significantly upregulated after treatment with the inhibitor (0.84 ± 0.20 vs. 1.83 ± 0.41, P < 0.001, Fig 5A). There was no difference in ESR1 expression following either treatment. Accordingly, the ESR1/ESR2 mRNA ratio was significantly increased after transfection of miRNA22-5p mimics (1.07 ± 0.33 vs. 6.18 ± 0.33, P = 0.019, Fig 5A) or inhibitor (1.142 ± 0.48 vs. 0.68 ± 0.29, P < 0.001, Fig 5A). ESR2 protein expression was significantly decreased in cells treated with miRNA22-5p mimics (0.87 ± 0.11 vs. 0.43 ± 0.15, P < 0.001, Fig 5B) and increased in cells treated with inhibitor (0.82 ± 0.31 vs. 1.47 ± 0.21, P < 0.001, Fig 5B), as demonstrated by western blot analysis.

Fig 5 — (A) RT-qPCR analysis of mRNA expression of *ESR1* and *ESR2* and the *ESR1*/*ESR2* mRNA ratio following treatment of ESCs with miR22-5p mimics and inhibitor (n = 3). (B) Western blot analysis of ESR2 protein levels following the treatment of ESCs with miR22-5p mimics and inhibitor (n = 3). Data were analyzed by Student’s t-test.

MiR22-5p affects the DNA methylation status of the ESR2 promoter region expression in primary endometrial cells

To investigate the role of miR22-5p in DNA methylation further, we assessed the transfected ESCs by bisulfite sequencing. We identified and approximately 550-bp classic CpG island (–197/+359) within the ESR2 promoter and the downstream untranslated exon 0N region. The CpG methylation status after treatments is shown in Fig 6A. The methylation status within this region after transfected with miRNA 22-5p inhibitor or controls was very low and it was not statistically significant (Fig 6B).

Fig 6 — (A) Methylation status of 13 CpG sites in the *ESR2* promoter region after treatment with miR22-5p inhibitor as indicated by bisulfite sequencing (n = 3). The numbers indicate the positions of cytosine residues of CpGs relative to the transcription start site (+1). (B) Percent methylation of the *ESR2* promoter region in ESCs after treatment with miR22-5p inhibitor. Data were analyzed by Student’s t-test.

Discussion

Endometriosis is an estrogen-dependent chronic inflammatory disease that contributes to cyclical chronic pain and infertility in reproductive women. Recent research has focused on microRNAs because of their roles in regulating epigenetic changes involved in the pathophysiology of infertility due to endometriosis. Previously, utilizing microRNA array analysis, we identified miR22-5p as one of 12 downregulated miRNAs in eutopic mid-luteal endometrium of minimal/mild endometriosis [15]. In the present study, we validated that miR22-5p expression was decreased in eutopic endometrium of minimal/mild endometrium during the mid-luteal phase. Utilizing a primary ESC model, we found that miR22-5p expression was inversely related to TET2 and 5-hmC expression. MiR22-5p regulated ESR2 expression, but did not directly affect ESR2 promoter methylation. These results support the hypothesis that miRNAs, and in casu, miR22-5p, contributes to the pathophysiology of endometriosis and may be a useful therapeutic target.

Women with minimal/mild endometriosis are significantly less likely to achieve pregnancy than those with tubal factor infertility [20]. Endometriosis likely is the most common cause of endometrial receptivity defects, especially in cases of minimal/mild endometriosis, in which the loss of fertility cannot be explained by mechanical reasons [21]. How the endometrium in women with minimal/mild endometriosis is resistant to embryo implantation remains unknown. Maciejak et al. reported upregulation of miR22-5p in the plasma and serum following acute myocardial infarction as a novel diagnostic biomarker [22]. A direct relationship between miR22-5p and TET2 expression has been demonstrated in K562 cells, and in AML cells, low TET2 expression is related to proliferation [23]. However, it has been widely reported that miR-22 negatively regulates TET2 expression and that its overexpression closely phenocopies many of the characteristics observed upon TET2 inactivation both in vitro and in vivo [24]. MiR-22 contributes to the inactivation of TET2 and other TET family members in tumorigenesis, and represents a tumorigenic pathway in addition to the more familiar TET family mutations and deletions [24, 25]. These studies indicated that the regulatory relationships between TET2 and miR-22 or miR22-5p are worth investigating in other tissues. Based on a comprehensive analysis of minimal/mild endometriosis patients, we found that TET2 is upregulated in the endometrium during implantation window, and is directly affected by the miR22-5p level.

A subset of DNA hypomethylated canyons is maintained by the cooperative action of TET proteins, in particular, TET1 and TET2 [26]. Aberrant expression of epigenetic alterations in endometriosis include genomic DNA methylation of the gene encoding progesterone receptor-β [27], HOXA10 [28], ESR2 [13], which are candidate genes responsible for the development of progesterone resistance and implantation failure. The ESR2 mRNA level was significantly increased in endometriotic ESCs when compared to normal ESCs. A hypomethylated (–197/+359) promoter region of ESR2 in endometriotic cells was previously considered the primary mechanism responsible for the differential ESR2 expression in endometriotic and normal endometrium [13]. We investigated whether increased TET2 expression due to decreased miR22-5p expression affected ESR2 expression, and we found that ESCs transfected with miR22-5p mimics demonstrated significantly attenuated ESR2 expression. Bioinformatics and genetic analyses revealed no potential miR22-5p target sites in the 3′-UTR of the ESR2 mRNA sequence. Indeed, it is speculated that miR22-5p may regulate ESR2 promoter methylation by directly targeting TET2. Bisulfite sequencing of this promoter region (–197/+359) showed that there was no significant difference in the methylation status after transfection with miR22-5p inhibitor. Methylation tended to be lower in miR22-5p inhibitor-transfected cells than in control cells, but the promoter was extremely hypomethylated in both cases, which was inconsistent with a previous study [13]. In Xue’s study, eutopic endometrium was not compared between subjects with endometriosis and disease-free subjects, and the menstrual cycles of the study subjects were unknown [13], whereas we utilized mid-luteal endometrium of infertile women with minimal/mild endometriosis in the embryo implantation phase.

DNA methylation profiles of human endometrium differ in different phases of the cycle [29, 30], which could explain the opposing findings in our and other studies. Overall, our findings suggested that miR22-5p directly dysregulates TET2, which modified the 5-hmC level and altered ESR2, but not ESR1 expression in ESCs. This also contributed to an increase in the ESR1/ESR2 mRNA ratio. ESR2 is suggested to modulate ESR1 activity; thus, a change in the relative expression levels of ESR2 to ESR1 suggests a differential regulatory response in estrogen signaling [13]. PR expression in the secretory phase of the menstrual cycle is regulated through ESR1 [31]. Therefore, altered miR22-5p expression in the endometrium may lead to dysregulation of the progesterone response and consequently, implantation-related infertility in women with endometriosis.

To our knowledge, this is the first study to demonstrate downregulation of miR22-5p in eutopic endometrium of women with endometriosis during the secretory phase. Further, we showed that TET2 upregulation during implantation window in human endometrium was directly regulated by miR22-5p. MiR22-5p, which has not been thoroughly studied in endometriosis to date, directly dysregulated the expression of TET2, which is a key marker for DNA hydroxymethylation.

There are some limitations of our study. The first is that we found that ESR2 was also upregulated by miR22-5p, but it was not through the regulation of promoter region methylation of ESR2; hence, the regulatory mechanisms are needed to be further studied. In addition, some studies have revealed the functions of miR22-5p in other diseases [32, 33]. However, this study only focused on that miR22-5p dysregulates directly the expression of TET2 in the eutopic endometrium of endometriosis without the exploration of specific functions of miR22-5p. The role of miR22-5p in modulating the function of the eutopic ESCs and endometrial receptivity in endometriosis also requires exploration in the following study.

Supporting information

S1 Raw images

(PDF)

Click here for additional data file.^{(729.5KB, pdf)}

Acknowledgments

We thank Dr. Shanti Gurung from The Ritchie Centre, Hudson Institute of Medical Research for language modification.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This work was supported by a grant from the National Natural Science Foundation of China (No. 81370693). WH received the grant from the National Natural Science Foundation of China Grant number is 81370693 The full name of each funder: the National Natural Science Foundation of China URL of each funder website: http://www.nsfc.gov.cn/ The funders did not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Medicine PCotASfR. Endometriosis and infertility: a committee opinion. Fertil steril. 2012;98(3):591–8. 10.1016/j.fertnstert.2012.05.031 . [DOI] [PubMed] [Google Scholar]
2.Tummon IS, Maclin VM, Radwanska E, Binor Z, Dmowski WP. Occult ovulatory dysfunction in women with minimal endometriosis or unexplained infertility. Fertil steril. 1988;50(5):716–20. . [PubMed] [Google Scholar]
3.Simon C, Gutierrez A, Vidal A, de los Santos MJ, Tarin JJ, Remohi J, et al. Outcome of patients with endometriosis in assisted reproduction: results from in-vitro fertilization and oocyte donation. Hum Reprod. 1994;9(4):725–9. 10.1093/oxfordjournals.humrep.a138578 . [DOI] [PubMed] [Google Scholar]
4.Da Broi MG, Navarro PA. Oxidative stress and oocyte quality: ethiopathogenic mechanisms of minimal/mild endometriosis-related infertility. Cell Tissue Res. 2016;364(1):1–7. 10.1007/s00441-015-2339-9 . [DOI] [PubMed] [Google Scholar]
5.Akande VA, Hunt LP, Cahill DJ, Jenkins JM. Differences in time to natural conception between women with unexplained infertility and infertile women with minor endometriosis. Hum Reprod. 2004;19(1):96–103. 10.1093/humrep/deh045 . [DOI] [PubMed] [Google Scholar]
6.Bergqvist A, D'Hooghe T. Mini symposium on pathogenesis of endometriosis and treatment of endometriosis-associated subfertility. Introduction: the endometriosis enigma. Hum Reprod update. 2002;8(1):79–83. 10.1093/humupd/8.1.79 . [DOI] [PubMed] [Google Scholar]
7.Salamonsen LA, Nie G, Hannan NJ, Dimitriadis E. Society for Reproductive Biology Founders' Lecture 2009. Preparing fertile soil: the importance of endometrial receptivity. Reprod Fertil Dev. 2009;21(7):923–34. 10.1071/RD09145 . [DOI] [PubMed] [Google Scholar]
8.Mahutte NG, Arici A. New advances in the understanding of endometriosis related infertility. J Reprod Immunol. 2002;55(1–2):73–83. 10.1016/s0165-0378(01)00130-9 . [DOI] [PubMed] [Google Scholar]
9.Gupta S, Goldberg JM, Aziz N, Goldberg E, Krajcir N, Agarwal A. Pathogenic mechanisms in endometriosis-associated infertility. Fertil Steril. 2008;90(2):247–57. 10.1016/j.fertnstert.2008.02.093 . [DOI] [PubMed] [Google Scholar]
10.Revel A. Defective endometrial receptivity. Fertil Steril. 2012;97(5):1028–32. 10.1016/j.fertnstert.2012.03.039 . [DOI] [PubMed] [Google Scholar]
11.Barragan F, Irwin JC, Balayan S, Erikson DW, Chen JC, Houshdaran S, et al. Human Endometrial Fibroblasts Derived from Mesenchymal Progenitors Inherit Progesterone Resistance and Acquire an Inflammatory Phenotype in the Endometrial Niche in Endometriosis. Biol Reprod. 2016;94(5):118 10.1095/biolreprod.115.136010 。 [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Bulun SE, Monsavais D, Pavone ME, Dyson M, Xue Q, Attar E, et al. Role of estrogen receptor-beta in endometriosis. Semin Reprod Med. 2012;30(1):39–45. 10.1055/s-0031-1299596 。 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Xue Q, Lin Z, Cheng Y-H, Huang C-C, Marsh E, Yin P, et al. Promoter Methylation Regulates Estrogen Receptor 2 in Human Endometrium and Endometriosis. Biol Reprod. 2007;77(4):681–7. 10.1095/biolreprod.107.061804 . [DOI] [PubMed] [Google Scholar]
14.Braza-Boils A, Mari-Alexandre J, Gilabert J, Sanchez-Izquierdo D, Espana F, Estelles A, et al. MicroRNA expression profile in endometriosis: its relation to angiogenesis and fibrinolytic factors. Hum Reprod. 2014;29(5):978–88. 10.1093/humrep/deu019 . [DOI] [PubMed] [Google Scholar]
15.Zhou M, Fu J, Xiao L, Yang S, Song Y, Zhang X, et al. miR-196a overexpression activates the MEK/ERK signal and represses the progesterone receptor and decidualization in eutopic endometrium from women with endometriosis. Hum Reprod. 2016;31(11):2598–608. 10.1093/humrep/dew223 . [DOI] [PubMed] [Google Scholar]
16.Pei T, Liu C, Liu T, Xiao L, Luo B, Tan J, et al. miR-194-3p Represses the Progesterone Receptor and Decidualization in Eutopic Endometrium From Women With Endometriosis. Endocrinology. 2018;159(7):2554–62. 10.1210/en.2018-00374 . [DOI] [PubMed] [Google Scholar]
17.Shen L, Yang S, Huang W, Xu W, Wang Q, Song Y, et al. MicroRNA23a and microRNA23b deregulation derepresses SF-1 and upregulates estrogen signaling in ovarian endometriosis. J Clin Endocrinol Metab. 2013;98(4):1575–82. 10.1210/jc.2012-3010 . [DOI] [PubMed] [Google Scholar]
18.Wu H, Zhang Y. Reversing DNA methylation: mechanisms, genomics, and biological functions. Cell. 2014;156(1–2):45–68. 10.1016/j.cell.2013.12.019 . [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Roca FJ, Loomans HA, Wittman AT, Creighton CJ, Hawkins SM. Ten-Eleven Translocation Genes are Downregulated in Endometriosis. Curr Mol Med. 2016;16(3):288–98. 10.2174/1566524016666160225153844 . [DOI] [PubMed] [Google Scholar]
20.Barnhart K, Dunsmoor-Su R, Coutifaris C. Effect of endometriosis on in vitro fertilization. Fertil Steril. 2002;77(6):1148–55. 10.1016/s0015-0282(02)03112-6 . [DOI] [PubMed] [Google Scholar]
21.Brosens I, Brosens JJ, Benagiano G. The eutopic endometrium in endometriosis: are the changes of clinical significance? Reprod Biomed Online. 2012;24(5):496–502. 10.1016/j.rbmo.2012.01.022 . [DOI] [PubMed] [Google Scholar]
22.Maciejak A, Kiliszek M, Opolski G, Segiet A, Matlak K, Dobrzycki S, et al. miR-22-5p revealed as a potential biomarker involved in the acute phase of myocardial infarction via profiling of circulating microRNAs. Mol Med Rep. 2016;14(3):2867–75. 10.3892/mmr.2016.5566 . [DOI] [PubMed] [Google Scholar]
23.Yao H, Sun P, Duan M, Lin L, Pan Y, Wu C, et al. microRNA-22 can regulate expression of the long non-coding RNA MEG3 in acute myeloid leukemia. Oncotarget. 2017;8(39):65211–7. 10.18632/oncotarget.18059 . [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Song SJ, Ito K, Ala U, Kats L, Webster K, Sun SM, et al. The oncogenic microRNA miR-22 targets the TET2 tumor suppressor to promote hematopoietic stem cell self-renewal and transformation. Cell Stem Cell. 2013;13(1):87–101. 10.1016/j.stem.2013.06.003 . [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Mattei F, Liang X, Liu Y, Mei S, Zhang M, Xin J, et al. MicroRNA-22 Impairs Anti-Tumor Ability of Dendritic Cells by Targeting p38. PLoS One. 2015;10(3):e0121510 10.1371/journal.pone.0121510 . [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Wiehle L, Raddatz G, Musch T, Dawlaty MM, Jaenisch R, Lyko F, et al. Tet1 and Tet2 Protect DNA Methylation Canyons against Hypermethylation. Molecular and cellular biology. 2015;36(3):452–61. 10.1128/MCB.00587-15 . [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Wu Y, Strawn E, Basir Z, Halverson G, Guo SW. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics. 2006;1(2):106–11. 10.4161/epi.1.2.2766 . [DOI] [PubMed] [Google Scholar]
28.Wu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW. Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol. 2005;193(2):371–80. 10.1016/j.ajog.2005.01.034 . [DOI] [PubMed] [Google Scholar]
29.Houshdaran S, Zelenko Z, Irwin JC, Giudice LC. Human endometrial DNA methylome is cycle-dependent and is associated with gene expression regulation. Mol Endocrinol. 2014;28(7):1118–35. 10.1210/me.2013-1340 . [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Saare M, Modhukur V, Suhorutshenko M, Rajashekar B, Rekker K, Soritsa D, et al. The influence of menstrual cycle and endometriosis on endometrial methylome. Clin Epigenetics. 2016;8:2 10.1186/s13148-015-0168-z . [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Patel B, Elguero S, Thakore S, Dahoud W, Bedaiwy M, Mesiano S. Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Hum Reprod update. 2015;21(2):155–73. 10.1093/humupd/dmu056 . [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Yu Y, Mao L, Lu X, Yuan W, Chen Y, Jiang L, et al. Functional Variant in 3'UTR of FAM13A Is Potentially Associated With Susceptibility and Survival of Lung Squamous Carcinoma. DNA Cell Biol. 2019, 38 (11): 1269–1277. 10.1089/dna.2019.4892 . [DOI] [PubMed] [Google Scholar]
33.Zhang X, Ji S, Cai G, Pan Z, Han R, Yuan Y, et al. H19 Increases IL-17A/IL-23 Releases via Regulating VDR by Interacting With miR675-5p/miR22-5p in Ankylosing Spondylitis. Mol Ther Nucleic Acids. 2020, 19: 393–404. 10.1016/j.omtn.2019.11.025 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0234086.r001

Decision Letter 0

Jae-Wook Jeong

21 Jan 2020

PONE-D-19-32583

MicroRNA22-5p targets TET2 and regulates Estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

PLOS ONE

Dear Prof. Huang,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Mar 06 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Jae-Wook Jeong, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We noticed you have some minor occurrence(s) of overlapping text with the following previous publication(s), which needs to be addressed:

https://doi.org/10.1093/humrep/dew223

https://doi.org/10.1095/biolreprod.107.061804

https://doi.org/10.1186/1477-7827-12-42

https://doi.org/10.1210/jc.2012-3010

https://doi.org/10.1210/en.2018-00374

https://doi.org/10.1186/s12958-017-0234-9

https://doi.org/10.1016/j.stem.2013.06.003

https://doi.org/10.1007/s00441-015-2339-9

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the Methods section. Further consideration is dependent on these concerns being addressed.

3. We note that you have reported significance probabilities of 0 in places. Since p=0 is not strictly possible, please correct this to a more appropriate limit, eg 'p<0.0001'.

4. Please include in your Methods section the date ranges over which you recruited participants to this study.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript, the authors showed that MicroRNA22-5p targets TET2 and regulates Estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window. The authors suggest the role of miR22-5p in endometriosis-associated infertility and the significant findings from this study were that a decrease of miR22-5p and an increase of TET2 expression were observed in minimal/mild endometriosis during implantation window. TET2 was a key directly target of miR22-5p and MiR22-5p regulated the expression of ESR2. The topic of the paper is interesting although some minor concerns have been raised after carefully reading the work.

1. Is “disease-free women” group infertile or fertile?

2. What do you mean “another 13 mild/minimal endometriosis and 11 normal controls” ? Are these group from 24 of normal and 26 of endometriosis in “Study Population “ section? The authors need to provide the detail human sample information.

3. The authors described that all participants were determined to be in the proliferative or secretory phase. Is there any different expression between proliferative and secretory phase in Figure 1A?

4. Again, the author only used secretory phase group for Figure 1B. The author needs to clarify the expression between proliferative and secretory phase.

5. The authors need to provide high magnification picture for better understanding in Figure 1D.

6. The statistical analysis should be t-test not ANOVA in Figure 1.

7. What is the rationale to use primary ESCs cell? TET2 are highly expressed in stromal and epithelial cells in endometriosis group.

8. What primary cells were used for Figure 5? The authors need to be clarified.

9. The authors described that ESR2 represses ESR1 gene expression by directly binding to ESR1 promoter region, which can result in a state of progesterone resistance but the expression of ESR1 were not changed in Figure 5. What is the author’s conclusion?

10. How was the expression of ESR1 by Western blot in Figure 5?

11. As TET2 are expressed in stromal and epithelial cells, it will be helpful if the authors add the result in epithelial cells for depth of the authors’ conclusion.

Reviewer #2: This study was to investigate the expression and role of a microRNA, miR22-5p, in endometriosis. The authors previously found that miR22-5p was downregulated in the endometrium of patients with mild endometriosis. The current study confirmed this finding and further explored its role using primary endometrial stromal cells and 293T cells. The authors showed that TET2 was a direct target gene of miR22-5p in endometrial cells, and ESR2 expression was also affected by manipulation of miR22-5p levels through an unidentified mechanism. The experiments were overall well described. However, there are several major concerns on the rigor, design, and language that need to be addressed.

Major concerns:

1. A major weakness of this manuscript is that there are no functional studies designed to evaluate the role of miR22-5p. It is necessary to include cell culture experiments to address the role of miR22-5p in endometrial stromal cell properties.

2. The authors stated that normal endometrial tissues were obtained from 24 disease-free women. However, it was unclear under what conditions these women underwent surgeries.

3. There are no negative controls (i.e. the use of isotype matched IgGs controls) for immunofluorescence and immunohistochemistry.

4. The authors indicated that 6 experiments were performed for Luciferase Reporter Gene Assay. However, results in Fig. 4 showed n = 3. Are only 3 experiments out of 6 showed or n refers to 3 technical replicates?

5. The manuscript contains many grammatical errors and vague statements. A thorough language editing appears necessary.

Minor concerns:

1. ANOVA (under Fig. 1 legend) was not mentioned in the statistical analysis section. In addition, why ANOVA was used in these experiments as only two means were compared?

2. Descriptions of sample numbers (n) are missing in Fig. 5 and Fig. 6.

3. Fig. 5: ESR1 protein levels should also be examined and shown.

4. The TET2 result in mimics control and miR22-5p mimics group in Fig. 2F seems inconsistent with the quantification result listed in panel E.

5. There is no justification for using 293T cells in this study. Figure legend

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Jul 13;15(7):e0234086. doi: 10.1371/journal.pone.0234086.r002

Author response to Decision Letter 0

1 Mar 2020

（1）Responses to editors

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Reply: Thank you for your reminding. The revised manuscript has been checked and meets PLOS ONE’s style requirement.

2. We noticed you have some minor occurrence(s) of overlapping text with the following previous publication(s), which needs to be addressed:

https://doi.org/10.1093/humrep/dew223

https://doi.org/10.1095/biolreprod.107.061804

https://doi.org/10.1186/1477-7827-12-42

https://doi.org/10.1210/jc.2012-3010

https://doi.org/10.1210/en.2018-00374

https://doi.org/10.1186/s12958-017-0234-9

https://doi.org/10.1016/j.stem.2013.06.003

https://doi.org/10.1007/s00441-015-2339-9

Reply:

For https://doi.org/10.1093/humrep/dew223, it is “miR-196a overexpression activates the MEK/ERK signal and represses the progesterone receptor and decidualization in eutopic endometrium from women with endometriosis”. This article was one of our previous publications about miRNAs research on endometriosis. We found 66 differentially expressed miRNAs, and miR22-5p was one of those from this study. It was Ref.15, which has been quoted except in Methods sections.

For https://doi.org/10.1095/biolreprod.107.061804, it is “Promoter Methylation Regulates Estrogen Receptor 2 in Human Endometrium and Endometriosis”, which was the first one to determine the hypomethylated promoter of ESR2 gene, which was the basis of our study. It was Ref. 13, which has been quoted except in Methods sections.

For https://doi.org/10.1186/1477-7827-12-42, it is “Increased expression of the pluripotency markers sex-determining region Y-box 2 and Nanog homeobox in ovarian endometriosis”, which is one of our previous publications. The experimental procedures of “RNA extraction and Quantitative Real-time PCR”, “Western Blot Analysis”, and “Immunohistochemistry” used in this study were modified partly from this article.

For https://doi.org/10.1210/jc.2012-3010, it is “MicroRNA23a and MicroRNA23b Deregulation Derepresses SF-1 and Upregulates Estrogen Signaling in Ovarian Endometriosis”, which was the first article from our group working on miRNAs, published in 2013. It was Ref. 17, which has been quoted except in Methods sections.

For https://doi.org/10.1210/en.2018-00374, it is “miR-194-3p Represses the Progesterone Receptor and Decidualization in Eutopic Endometrium from Women with Endometriosis”, which also focused on the miRNAs on endometriosis. It was also a following research of that original research. It was Ref. 16, which has been quoted except in Methods sections.

For https://doi.org/10.1186/s12958-017-0234-9, it is “Expression of SOX2, NANOG and OCT4 in a mouse model of lipopolysaccharide-induced acute uterine injury and intrauterine adhesions”, which is one of our previous publications. The experimental procedures of “RNA extraction and Quantitative Real-time PCR”, “Western Blot Analysis”, and “Immunohistochemistry” used in this study were also modified partly from this article.

For https://doi.org/10.1016/j.stem.2013.06.003, it is “The oncogenic microRNA miR-22 Target the TET2 tumor suppressor to promote hematopoietic stem cell self-renewal and transformation”. It was the first research to identify that miR-22 contributes to inactivation of TET2 and other TET family members in tumorigenesis. It was Ref. 24, which has been quoted except in Methods sections.

For https://doi.org/10.1007/s00441-015-2339-9, it is “Oxidative stress and oocyte quality: ethiopathogenic mechanisms of minimal/mild endometriosis-related infertility”. In the introduction section of our manuscript, the introduction of the mechanisms of minimal/mild endometriosis was quoted from this paper, the revised manuscript has been carefully modified and cited as Ref. 4.

3. We note that you have reported significance probabilities of 0 in places. Since p=0 is not strictly possible, please correct this to a more appropriate limit, eg 'p<0.0001'.

Reply: In the revised manuscript, all those “p=0” were corrected to “p=0.000“. Those changes could be found in the revised Figures (Fig 1, Fig 2, Fig 4 and Fig 5) and Page 14, line 21-26; Page 16, line 9-18, which have been highlighted in manuscript.

4. Please include in your Methods section the date ranges over which you recruited participants to this study.

Reply: The date has been added to the study population section on Page 6, line 1-3 in the revised manuscript with highlight.

Reply: Our blot/gel image data had been provided in Supporting Information in the resubmission.

(2) Responses to reviewers

1. Is “disease-free women” group infertile or fertile?

Reply: The patients from disease-free women group were infertile. All patients recruited in this study were infertile. We have added the detailed description of patients on page 6, line 1-4.

2. What do you mean “another 13 mild/minimal endometriosis and 11 normal controls”? Are these group from 24 of normal and 26 of endometriosis in “Study Population “section? The authors need to provide the detail human sample information.

Reply: 50 infertile patients were recruited in this study that 24 patients with normal endometrium as control and 26 patients who suffered minimal/mild endometriosis, which all samples were from secretory phase. During the 24 control patients, 11 samples were used for PCR analysis, 5 samples were used for Western Blot, 3 samples were for IHC analysis, and 6 samples were for cell experiment. During the 26 endometriosis patients, 13 samples were used for PCR analysis, 6 samples were used for Western Blot, 3 samples were for IHC analysis, and 6 samples were for cell experiment. The details of human sample information have been attached to the revised submission.

3. The authors described that all participants were determined to be in the proliferative or secretory phase. Is there any different expression between proliferative and secretory phase in Figure 1A?

Reply: As this study focused on the changes of implantation window, the expression or analysis of the data was from the endometrial samples of secretory phase. All samples reported and used in the present study were from secretory phase which was determined by the timing of the patients’ last menstrual period and histological analysis of endometrium. As interested, we did have some IHC staining of proliferative phase, which is as follow. For the purpose of the study, it may be no need to include patients from proliferative phase.

4. Again, the author only used secretory phase group for Figure 1B. The author needs to clarify the expression between proliferative and secretory phase.

Reply: As our previous microRNA microarray data in mid-luteal endometrium showed that the expression of miR22-5p decreased, the aim of this study was to investigate the effects/biological functions of miR22-5p in minimal/mild endometriosis during secretory phase. Therefore, all data and analysis in this study were in the secretory phase, the comparison between proliferative and secretory phase has not been investigated yet in the present study, which we will further focus on it in future studies.

5. The authors need to provide high magnification picture for better understanding in Figure 1D.

Reply: A higher magnification picture of Figure 1D has been added in Figure 1.

6. The statistical analysis should be t-test not ANOVA in Figure 1.

Reply: Thanks for your attention. The data has been re-analyzed by t-test, the change was highlighted in the figure legend of Figure 1.

7. What is the rationale to use primary ESCs cell? TET2 are highly expressed in stromal and epithelial cells in endometriosis group.

Reply: Primary cells are directly derived from body tissues, and their biological characteristics have not changed significantly, so they can reflect the state of the disease to a certain extent. Our group has established a stable method for the isolation and culture of primary endometrial stromal cells for several years. As primary endometrial epithelial cell could not be passage and sub-cultured, we used primary endometrial stromal cell for Primary Cell Culture and Transfection.

8. What primary cells were used for Figure 5? The authors need to be clarified.

Reply: Primary endometrial stromal cells (ESCs) were used for Figure 5. The change has been highlighted in Figure legend of Fig 5 on Page 16, Line 22.

Reply: In previous research (Bulun SE, et al. Semin Reprod Med, 2012), they found ESR2 represses ESR1 gene expression by directly binding to ESR1 promoter region in endometriotic tissue, which can result in a state of progesterone resistance. But in our study, there was no significant change in the expression of ESR1 after the transfection of miR22-5p mimics and inhibitor in eutopic endometrium. ESR2 may only repress ESR1 gene expression in some specific situation and location, or the expression of ESR1 has been affected by other unknown ways after transfection of miR22-5p mimics and inhibitor, which may be worthy to further investigate.

10. How was the expression of ESR1 by Western blot in Figure 5?

Reply: There was no significant difference of ESR1 mRNA level in our study, analyzed by qRT-PCR. As knowing about how miRNAs work , and we have a standard protocol of qRT-PCR in miRNAs research since 2013 (Ref.17, Shen, et al. JCEM, 2013), the protein expression was not that crucial and necessary when no difference in mRNA level after miRNAs interfered, so ESR1 expression by WB was not performed when we did the experiments. As reviewer’s interest, we are also trying to do a WB for ESR1, but we do have very rare infertile patients visiting hospital, due to the Covid-19, which is spreading in China recently.

11. As TET2 are expressed in stromal and epithelial cells, it will be helpful if the authors add the result in epithelial cells for depth of the authors’ conclusion.

Reply: We do agree with this opinion. We were also intending to investigate the expression of TET2 in endometrial epithelial cells, but failed to do the primary endometrial epithelial cell passage and sub-culture. The primary endometrial epithelial cell passage and sub-culture are still an unsolved problem for endometrial related researches. If solved, it will greatly contribute to the investigations of endometrial diseases.

Major concerns:

Reply: Thanks to this comment. We also tried to figure out the role of miR22-5p in endometriosis related infertility. We performed in vitro decidualization experiment to investigate the effect of miR22-5p on progesterone resistance which our group focused on all along and reported previously (Min Zhou, at el, 2017, and Tianjiao Pei, et al. 2018, Ref 14 and 15). Unfortunately, miR22-5p downregulation did not promote or hinder decidualization in ESCs, which is showing as follow. But we didn’t put this result in our manuscript.

We will keep on further investigating the role of miR22-5p, as well as TET2, in endometriosis related infertility by other functional studies.

2. The authors stated that normal endometrial tissues were obtained from 24 disease-free women. However, it was unclear under what conditions these women underwent surgeries.

Reply: We were very sorry to confuse the reviewers. All patients recruited in our study were infertile. Laparoscopy and hysteroscopy were performed, those 24 women suffered from peritubal adhesion, mesosalpinx cyst or pelvic adhesion. Normal endometrial tissues were obtained from those 24 infertile women without any endometrial pathology confirmed by hysteroscopy.

3. There are no negative controls (i.e. the use of isotype matched IgGs controls) for immunofluorescence and immunohistochemistry.

Reply: Sorry for our negligence. Images of negative controls have been added to Fig.1 for Immunohistochemistry and Fig. 3 for Immunofluorescence. The isotype controls were Rabbit lgG and Mouse IgG. Changes have been highlighted on Page 11, Line 14-15, also, presenting in Fig.1 and Fig. 3

Reply: Thanks for figuring out this. The Luciferase Reporter Gene Assay experiments were repeated three times with six technical replicates for wild-type TET2 3’-UTRs and mutation of TET2 3’-UTR WT1 each. The change has been highlighted on Page 10, Line 3.

5. The manuscript contains many grammatical errors and vague statements. A thorough language editing appears necessary.

Reply: We have carefully reviewed and re-edited the whole manuscript. Dr. Shanti Gurung from The Ritchie Centre, Hudson Institute of Medical Research, Melbourne, Australia, greatly contributes to edit the revised manuscript. We are grateful for her efforts and help in language modification which is presenting in Acknowledge session. The changes have been highlighted in revised manuscript.

Minor concerns:

1. ANOVA (under Fig. 1 legend) was not mentioned in the statistical analysis section. In addition, why ANOVA was used in these experiments as only two means were compared?

Reply: Thanks for kind reminding this inappropriate statistical analysis. The data has been re-analyzed by Student’s t test for the comparison for two groups, the change was highlighted in the figure legend of Fig. 1(Page 14, Line 10-11).

2. Descriptions of sample numbers (n) are missing in Fig. 5 and Fig. 6.

Reply: Sorry for the omission. The sample number for Primary Cell Culture and Transfection was three in Fig. 2, Fig.5 and Fig.6, which have been highlighted on Page 6, Line 13, Page 16, Line 22 and Page 17, Line 13.

3. Fig. 5: ESR1 protein levels should also be examined and shown.

Reply: Thanks very much for this concern. In our present study, there was no significant difference of ESR1 mRNA level, analyzed by qRT-PCR. As knowing about how miRNAs work , and we have a standard protocol of qRT-PCR in miRNAs research since 2013 (Ref.17, Shen, et al. JCEM, 2013), the protein expression was not that crucial and necessary when no difference in mRNA level after miRNAs inferfered, so ESR1 expression by WB was not performed when we did the experiments previously. As reviewer’s interest, we were also trying to do a WB for ESR1, but we do have very rare infertile patients visiting hospital recently, due to the Covid-19, which is spreading in China. If a ESR1 expression of WB have been required

4. The TET2 result in mimics control and miR22-5p mimics group in Fig. 2F seems inconsistent with the quantification result listed in panel E.

Reply: We are very sorry to confuse the reviewer. The word “TET2” under Fig. 2F was for Fig. 2E, which was presenting the analysis of TET2 expression after transfection of miRNA22-5p by WB. Fig. 2F was showing the expression of 5-hmC expression by Dot blot. TET2 is responsible for conversion of 5-mC in to 5-hmC, therefore, 5-hmC would be unregulated by the down-expressed TET2 when transfecting with miR22-5p mimics, the description was showing on Page 15, Line 1-3.

5. There is no justification for using 293T cells in this study. Figure legend

Reply: 293T cell is a derivative of 293 cells that stably express the large T-antigen of SV40. The presence of T-antigen in 293T cell could help in episomal maintenance of SV40 origin containing vectors. High-density transfection of 293T cells allows doubling of transient titers and remove need for a priori DNA complex formation with PEI. In case of transfection, 293T cell is now preferred since they are normally more transfectable. On the other hand, the primary endometrial stromal cells are not stable enough for Luciferase Reporter Gene Assay to avoid the influence of other factors. Therefore, 293T cells is the most common used for Luciferase Reporter Gene Assay.

________________________________________

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

Reply: we agree to publish the peer review history of our article.

Attachment

Submitted filename: Responses to reviewers.docx

Click here for additional data file.^{(2.3MB, docx)}

PLoS One. doi: 10.1371/journal.pone.0234086.r003

Decision Letter 1

Jae-Wook Jeong

16 Mar 2020

PONE-D-19-32583R1

MicroRNA22-5p targets TET2 and regulates Estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

PLOS ONE

Dear Prof. Huang,

We would appreciate receiving your revised manuscript by Apr 30 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Jae-Wook Jeong, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: No

**********

6. Review Comments to the Author

Reviewer #1: The authors have addressed comments from the initial review. This manuscript is appropriate for publication.

Reviewer #2: The authors are commended for their efforts to address the reviewer’s comments. However, there are some concerns remain.

Major concern # 1: Since the authors know nothing about the function of miR22-5p, it is suggested that this limitation be discussed in the “discussion section”.

Major concern # 6: The language has been improved, but there are still many errors and awkward sentences that prevent a clear understanding of the manuscript. Language editing is strongly recommended. A few examples are listed below:

Page 2, Line 15-16: MiR22-5p regulated the expression of ESR2, but do not directly affect the methylation of ESR2 promoter region. In this sentence, “do not” should be “did not”.

Page 2, Lines 17-18: This study provides a novel approach for the imbalance of miR22-5p expression in mid-luteal endometrium of minimal/mild endometriosis, may involve in the mechanism of its associated infertility. This sentence is grammatically incorrect.

Page 21, Lines 20-21: Our findings may provide a new novel approach to target in the mechanisms of minimal/mild endometriosis associated infertility. In this sentence, new and novel are repetitive. The sentence is also grammatically inappropriate.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

PLoS One. 2020 Jul 13;15(7):e0234086. doi: 10.1371/journal.pone.0234086.r004

Author response to Decision Letter 1

7 May 2020

Reviewer #2: The authors are commended for their efforts to address the reviewer’s comments. However, there are some concerns remain.

Major concern # 1: Since the authors know nothing about the function of miR22-5p, it is suggested that this limitation be discussed in the “discussion section”.

Reply: The limitation of this study has been discussed in the “discussion section”, which is showing on Page 21, Line 3-11.

Page 2, Line 15-16: MiR22-5p regulated the expression of ESR2, but do not directly affect the methylation of ESR2 promoter region. In this sentence, “do not” should be “did not”.

Reply: Thanks for figuring out this inappropriate grammar. “do not” has been replaced with “did not”, which is showing on Page2, Lines 15-16.

Reply: Thanks for this concern. This sentence has been reorganized in the revised manuscript, and it is showing on Page 2, Lines 17-18.

Reply: Thanks for this reminding, “new” has been removed in the revision, which could be found on Page 21, Lines 20-21.

Thanks for the comments on the language. The revised manuscript has been reedited by Editage services (http://app.editage.com/). We are hoping that English writing in this revision has been improved and meet the required standards for publication.

Attachment

Submitted filename: Responses to reviewers.docx

Click here for additional data file.^{(15.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0234086.r005

Decision Letter 2

Jae-Wook Jeong

19 May 2020

MicroRNA22-5p targets ten-eleven translocation and regulates estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

PONE-D-19-32583R2

Dear Dr. Huang,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Jae-Wook Jeong, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: I Don't Know

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #2: Page 21, line 3 &4: Authors stated that “…we found that ESR2 was also upregulated by miR22-5p”. This statement conflicts with the results that “ESR2 mRNA expression was significantly downregulated after transfection with miR22-5p mimics (page 16, lines 6&7).”

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

PLoS One. doi: 10.1371/journal.pone.0234086.r006

Acceptance letter

Jae-Wook Jeong

15 Jun 2020

PONE-D-19-32583R2

MicroRNA22-5p targets ten-eleven translocation and regulates estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

Dear Dr. Huang:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Jae-Wook Jeong

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Raw images

(PDF)

Click here for additional data file.^{(729.5KB, pdf)}

Attachment

Submitted filename: Responses to reviewers.docx

Click here for additional data file.^{(2.3MB, docx)}

Attachment

Submitted filename: Responses to reviewers.docx

Click here for additional data file.^{(15.3KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0234086.ref001] 1.Medicine PCotASfR. Endometriosis and infertility: a committee opinion. Fertil steril. 2012;98(3):591–8. 10.1016/j.fertnstert.2012.05.031 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref002] 2.Tummon IS, Maclin VM, Radwanska E, Binor Z, Dmowski WP. Occult ovulatory dysfunction in women with minimal endometriosis or unexplained infertility. Fertil steril. 1988;50(5):716–20. . [PubMed] [Google Scholar]

[pone.0234086.ref003] 3.Simon C, Gutierrez A, Vidal A, de los Santos MJ, Tarin JJ, Remohi J, et al. Outcome of patients with endometriosis in assisted reproduction: results from in-vitro fertilization and oocyte donation. Hum Reprod. 1994;9(4):725–9. 10.1093/oxfordjournals.humrep.a138578 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref004] 4.Da Broi MG, Navarro PA. Oxidative stress and oocyte quality: ethiopathogenic mechanisms of minimal/mild endometriosis-related infertility. Cell Tissue Res. 2016;364(1):1–7. 10.1007/s00441-015-2339-9 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref005] 5.Akande VA, Hunt LP, Cahill DJ, Jenkins JM. Differences in time to natural conception between women with unexplained infertility and infertile women with minor endometriosis. Hum Reprod. 2004;19(1):96–103. 10.1093/humrep/deh045 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref006] 6.Bergqvist A, D'Hooghe T. Mini symposium on pathogenesis of endometriosis and treatment of endometriosis-associated subfertility. Introduction: the endometriosis enigma. Hum Reprod update. 2002;8(1):79–83. 10.1093/humupd/8.1.79 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref007] 7.Salamonsen LA, Nie G, Hannan NJ, Dimitriadis E. Society for Reproductive Biology Founders' Lecture 2009. Preparing fertile soil: the importance of endometrial receptivity. Reprod Fertil Dev. 2009;21(7):923–34. 10.1071/RD09145 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref008] 8.Mahutte NG, Arici A. New advances in the understanding of endometriosis related infertility. J Reprod Immunol. 2002;55(1–2):73–83. 10.1016/s0165-0378(01)00130-9 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref009] 9.Gupta S, Goldberg JM, Aziz N, Goldberg E, Krajcir N, Agarwal A. Pathogenic mechanisms in endometriosis-associated infertility. Fertil Steril. 2008;90(2):247–57. 10.1016/j.fertnstert.2008.02.093 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref010] 10.Revel A. Defective endometrial receptivity. Fertil Steril. 2012;97(5):1028–32. 10.1016/j.fertnstert.2012.03.039 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref011] 11.Barragan F, Irwin JC, Balayan S, Erikson DW, Chen JC, Houshdaran S, et al. Human Endometrial Fibroblasts Derived from Mesenchymal Progenitors Inherit Progesterone Resistance and Acquire an Inflammatory Phenotype in the Endometrial Niche in Endometriosis. Biol Reprod. 2016;94(5):118 10.1095/biolreprod.115.136010 。 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref012] 12.Bulun SE, Monsavais D, Pavone ME, Dyson M, Xue Q, Attar E, et al. Role of estrogen receptor-beta in endometriosis. Semin Reprod Med. 2012;30(1):39–45. 10.1055/s-0031-1299596 。 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref013] 13.Xue Q, Lin Z, Cheng Y-H, Huang C-C, Marsh E, Yin P, et al. Promoter Methylation Regulates Estrogen Receptor 2 in Human Endometrium and Endometriosis. Biol Reprod. 2007;77(4):681–7. 10.1095/biolreprod.107.061804 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref014] 14.Braza-Boils A, Mari-Alexandre J, Gilabert J, Sanchez-Izquierdo D, Espana F, Estelles A, et al. MicroRNA expression profile in endometriosis: its relation to angiogenesis and fibrinolytic factors. Hum Reprod. 2014;29(5):978–88. 10.1093/humrep/deu019 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref015] 15.Zhou M, Fu J, Xiao L, Yang S, Song Y, Zhang X, et al. miR-196a overexpression activates the MEK/ERK signal and represses the progesterone receptor and decidualization in eutopic endometrium from women with endometriosis. Hum Reprod. 2016;31(11):2598–608. 10.1093/humrep/dew223 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref016] 16.Pei T, Liu C, Liu T, Xiao L, Luo B, Tan J, et al. miR-194-3p Represses the Progesterone Receptor and Decidualization in Eutopic Endometrium From Women With Endometriosis. Endocrinology. 2018;159(7):2554–62. 10.1210/en.2018-00374 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref017] 17.Shen L, Yang S, Huang W, Xu W, Wang Q, Song Y, et al. MicroRNA23a and microRNA23b deregulation derepresses SF-1 and upregulates estrogen signaling in ovarian endometriosis. J Clin Endocrinol Metab. 2013;98(4):1575–82. 10.1210/jc.2012-3010 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref018] 18.Wu H, Zhang Y. Reversing DNA methylation: mechanisms, genomics, and biological functions. Cell. 2014;156(1–2):45–68. 10.1016/j.cell.2013.12.019 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref019] 19.Roca FJ, Loomans HA, Wittman AT, Creighton CJ, Hawkins SM. Ten-Eleven Translocation Genes are Downregulated in Endometriosis. Curr Mol Med. 2016;16(3):288–98. 10.2174/1566524016666160225153844 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref020] 20.Barnhart K, Dunsmoor-Su R, Coutifaris C. Effect of endometriosis on in vitro fertilization. Fertil Steril. 2002;77(6):1148–55. 10.1016/s0015-0282(02)03112-6 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref021] 21.Brosens I, Brosens JJ, Benagiano G. The eutopic endometrium in endometriosis: are the changes of clinical significance? Reprod Biomed Online. 2012;24(5):496–502. 10.1016/j.rbmo.2012.01.022 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref022] 22.Maciejak A, Kiliszek M, Opolski G, Segiet A, Matlak K, Dobrzycki S, et al. miR-22-5p revealed as a potential biomarker involved in the acute phase of myocardial infarction via profiling of circulating microRNAs. Mol Med Rep. 2016;14(3):2867–75. 10.3892/mmr.2016.5566 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref023] 23.Yao H, Sun P, Duan M, Lin L, Pan Y, Wu C, et al. microRNA-22 can regulate expression of the long non-coding RNA MEG3 in acute myeloid leukemia. Oncotarget. 2017;8(39):65211–7. 10.18632/oncotarget.18059 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref024] 24.Song SJ, Ito K, Ala U, Kats L, Webster K, Sun SM, et al. The oncogenic microRNA miR-22 targets the TET2 tumor suppressor to promote hematopoietic stem cell self-renewal and transformation. Cell Stem Cell. 2013;13(1):87–101. 10.1016/j.stem.2013.06.003 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref025] 25.Mattei F, Liang X, Liu Y, Mei S, Zhang M, Xin J, et al. MicroRNA-22 Impairs Anti-Tumor Ability of Dendritic Cells by Targeting p38. PLoS One. 2015;10(3):e0121510 10.1371/journal.pone.0121510 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref026] 26.Wiehle L, Raddatz G, Musch T, Dawlaty MM, Jaenisch R, Lyko F, et al. Tet1 and Tet2 Protect DNA Methylation Canyons against Hypermethylation. Molecular and cellular biology. 2015;36(3):452–61. 10.1128/MCB.00587-15 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref027] 27.Wu Y, Strawn E, Basir Z, Halverson G, Guo SW. Promoter hypermethylation of progesterone receptor isoform B (PR-B) in endometriosis. Epigenetics. 2006;1(2):106–11. 10.4161/epi.1.2.2766 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref028] 28.Wu Y, Halverson G, Basir Z, Strawn E, Yan P, Guo SW. Aberrant methylation at HOXA10 may be responsible for its aberrant expression in the endometrium of patients with endometriosis. Am J Obstet Gynecol. 2005;193(2):371–80. 10.1016/j.ajog.2005.01.034 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref029] 29.Houshdaran S, Zelenko Z, Irwin JC, Giudice LC. Human endometrial DNA methylome is cycle-dependent and is associated with gene expression regulation. Mol Endocrinol. 2014;28(7):1118–35. 10.1210/me.2013-1340 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref030] 30.Saare M, Modhukur V, Suhorutshenko M, Rajashekar B, Rekker K, Soritsa D, et al. The influence of menstrual cycle and endometriosis on endometrial methylome. Clin Epigenetics. 2016;8:2 10.1186/s13148-015-0168-z . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref031] 31.Patel B, Elguero S, Thakore S, Dahoud W, Bedaiwy M, Mesiano S. Role of nuclear progesterone receptor isoforms in uterine pathophysiology. Hum Reprod update. 2015;21(2):155–73. 10.1093/humupd/dmu056 . [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0234086.ref032] 32.Yu Y, Mao L, Lu X, Yuan W, Chen Y, Jiang L, et al. Functional Variant in 3'UTR of FAM13A Is Potentially Associated With Susceptibility and Survival of Lung Squamous Carcinoma. DNA Cell Biol. 2019, 38 (11): 1269–1277. 10.1089/dna.2019.4892 . [DOI] [PubMed] [Google Scholar]

[pone.0234086.ref033] 33.Zhang X, Ji S, Cai G, Pan Z, Han R, Yuan Y, et al. H19 Increases IL-17A/IL-23 Releases via Regulating VDR by Interacting With miR675-5p/miR22-5p in Ankylosing Spondylitis. Mol Ther Nucleic Acids. 2020, 19: 393–404. 10.1016/j.omtn.2019.11.025 . [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

MicroRNA22-5p targets ten-eleven translocation and regulates estrogen receptor 2 expression in infertile women with minimal/mild endometriosis during implantation window

Li Xiao

Tianjiao Pei

Wei Huang

Min Zhou

Jing Fu

Jing Tan

Tingting Liu

Yong Song

Shiyuan Yang

Roles

Abstract

Introduction

Material and methods

Study population

Table 1. Details of patient samples used in this study.

Primary cell culture and transfection

RNA extraction and quantitative reverse-transcription (RT-q)PCR

Table 2. Primers used for RT-qPCR.

Western blot analysis

Luciferase reporter assay

Immunofluorescence

Dot blot assay

Immunohistochemistry

Bisulfite modification and sequencing

Statistical analysis

Results

MiR22-5p and TET2 expression signature discriminates eutopic endometrium of mild/minimal endometriosis from normal endometrium

Fig 1. MiR22-5p, TET2, and 5-hmC expression in endometrium of minimal/mild endometriosis and normal endometrium.

MiR22-5p regulates TET2 expression in primary ESCs

Fig 2. MiR22-5p regulates TET2.

Fig 3. Immunofluorescence expression of TET2 and 5-hmC in ESCs following treatment with miR22-5p mimics and inhibitor.

MiR22-5p directly targets the TET2 3′-UTR

Fig 4. MiR22-5p directly regulates the TET2 3′-UTR.

MiR22-5p affects ESR2 mRNA and protein expression

Fig 5. MiR22-5p affects ESR1 and ESR2 expression.

MiR22-5p affects the DNA methylation status of the ESR2 promoter region expression in primary endometrial cells

Fig 6. DNA methylation status of the ESR2 promoter region (–197/+359) in ESCs following treatment with miR22-5p mimics and inhibitor.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Jae-Wook Jeong

Roles

Author response to Decision Letter 0

Decision Letter 1

Jae-Wook Jeong

Roles

Author response to Decision Letter 1

Decision Letter 2

Jae-Wook Jeong

Roles

Acceptance letter

Jae-Wook Jeong

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases