Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2020 Jun 30;14(6):e0008419. doi: 10.1371/journal.pntd.0008419

First identification of genotypes of Enterocytozoon bieneusi (Microsporidia) among symptomatic and asymptomatic children in Mozambique

Aly S Muadica 1,#, Augusto E Messa Jr 2,#, Alejandro Dashti 1, Sooria Balasegaram 3, Mónica Santin 4, Filomena Manjate 2, Percina Chirinda 2, Marcelino Garrine 2,5, Delfino Vubil 2, Sozinho Acácio 2,6, Pamela C Köster 1, Begoña Bailo 1, Tacilta Nhampossa 2,6, Rafael Calero-Bernal 7, Jason M Mwenda 8, Inácio Mandomando 2,6,*, David Carmena 1,*
Editor: Thuy Le9
PMCID: PMC7357779  PMID: 32603325

Abstract

Enterocytozoon bieneusi is a human pathogen with a broad range of animal hosts. Initially, E. bieneusi was considered an emerging opportunistic pathogen in immunocompromised, mainly HIV-infected patients, but it has been increasingly reported in apparently healthy individuals globally. As in other African countries, the molecular epidemiology of E. bieneusi in Mozambique remains completely unknown. Therefore, we undertook a study to investigate the occurrence and genetic diversity of E. bieneusi infections in children with gastrointestinal symptoms as well as in asymptomatic children in Mozambique. Individual stool specimens were collected from 1,247 children aged between 0 and 14 years-old living in urban and rural settings in Zambézia (n = 1,097) and Maputo (n = 150) provinces between 2016 and 2019. Samples were analysed for E. bieneusi by nested-PCR targeting the internal transcribed spacer (ITS) region of the rRNA gene. All positive amplicons were confirmed and genotyped. Penalised logistic regression (Firth) was used to evaluate risk associations. The overall prevalence of E. bieneusi in this children population was 0.7% (9/1,247). A 10-fold higher prevalence was found in Maputo (4.0%; 6/150) than in Zambézia (0.3%; 3/1,097). All E. bieneusi-positive samples were from children older than 1-year of age, and most (8/9) from asymptomatic children. Nucleotide sequence analysis of the ITS region revealed the presence of four genotypes, three previously reported (Peru11, n = 1; Type IV, n = 2, and S2, n = 2) and a novel genotype (named HhMzEb1, n = 4). Novel genotype HhMzEb1 was identified in both asymptomatic (75%, 3/4) and symptomatic (25%, 1/4) children from a rural area in Maputo province in southern Mozambique. Genotypes HhMzEb1, Peru11, S2, and Type IV belonged to the Group 1 that includes genotypes with low host specificity and the potential for zoonotic and cross-species transmission. Being infected by enteric protozoan parasites and no handwashing were identified as risk associations for E. bieneusi infection. This study reports the first investigation of E. bieneusi genotypes in Mozambique with the identification of three previously reported genotypes in humans as well as a novel genotype (HhMzEb1). Findings highlight the need to conduct additional research to elucidate the epidemiology of E. bieneusi in the country, especially in rural areas where poor hygiene conditions still prevail. Special attention should be paid to the identification of suitable animal and environmental reservoirs of this parasite and to the characterization of transmission pathways.

Author summary

Enterocytozoon bieneusi is an obligate intracellular parasite that infects a wide range of vertebrate hosts. It is the most important etiological agent of human microsporidiasis. Most clinical and epidemiological studies conducted to date have focused on immunodeficient or immunosuppressed individuals including HIV+ patients and solid organ transplant recipients, as in those E. bieneusi infection causes life-threatening chronic diarrhoea. In contrast, latent microsporidia infections in immunocompetent individuals have received far less attention. Molecular epidemiological studies in humans and animals have revealed that E. bieneusi encompasses a very large diversity of genetic variants (genotypes) with marked differences in host specificity and even geographical distribution. In Mozambique, as in many other African countries, the epidemiology of E. bieneusi is completely unknown. Therefore, to identify the occurrence and genetic diversity of this pathogen in Mozambique stool samples were obtained from children, including apparently healthy and symptomatic, in Zambézia and Maputo provinces and tested for E. bieneusi by molecular methods. Results demonstrated the presence of E. bieneusi genotypes for the first time in Mozambique. Four genotypes were identified, three genotypes that have previously been reported in humans (Peru11, Type IV, and S2) and a novel genotype (HhMzEb1). Two of the genotypes Peru11, Type IV have also been frequently identified in animals indicating that potentially zoonotic E. bieneusi genotypes are inadvertently circulating in the surveyed populations. Additional population genetic studies are needed to elucidate the actual extent of the epidemiology and transmission dynamics of E. bieneusi in Mozambique.

Introduction

Microsporidia comprises 200 genera and nearly 1,500 species of spore-forming parasites ubiquitously found in the environment and able to colonize/infect a wide variety of invertebrate and vertebrate hosts [1,2]. Among the 17 Microsporidia species infecting humans Enterocytozoon bieneusi is the most frequently reported, causing gastrointestinal infections globally [3]. Infections with E. bieneusi in immunocompromised individuals (e.g. patients with AIDS, cancer, organ transplant recipients, and the elderly) are usually associated with chronic diarrhoea, wasting syndrome, and weight loss. Infections in immunocompetent subjects are often asymptomatic or result in self-limited diarrhoea and malabsorption [4,5]. Extraintestinal disorders and pathologies have also been reported, mainly in lung [6]. In addition, E. bieneusi infection in early childhood has been recently linked to impaired growth in children in low-resource settings including African countries such as Malawi, South Africa, or Tanzania [7,8]. Enterocytozoon bieneusi has a high genetic diversity and is capable of colonizing/infecting a broad spectrum of mammal and avian species. There are marked differences in host specificities and zoonotic potential among those genotypes [911]. Infections are acquired through ingestion of food and water contaminated with E. bieneusi spores, or through direct contact with faeces of infected persons and animals or with contaminated soils [2,12,13].

The highly polymorphic ribosomal internal transcribed spacer (ITS) of the ribosomal rRNA (rRNA) gene is the most widely used marker for assessing the genetic diversity within E. bieneusi [11]. Based on ITS nucleotide sequences nearly 500 genotypes have been validated according to current nomenclature standards that are distributed into 11 distinct phylogenetic groups [10,14]. Groups 1 and 2 comprise genotypes able to infect a broad range of mammalian species including humans and are, therefore, considered potentially zoonotic. On the other hand, groups 3‒11 have strong host specificities and are considered to pose little or null zoonotic risk [11].

The Global Enteric Multicenter Study (GEMS) has provided important information on the aetiology and population-based burden of paediatric diarrheal diseases in sub-Saharan Africa and South Asia. GEMS included in their study enteric protozoan parasites Giardia duodenalis, Cryptosporidium spp., and Entamoeba histolytica, but not the microsporidia E. bieneusi [15]. However, in recent years there has been a steady increase in the studies aiming to improve our understanding of the epidemiology of E. bieneusi in Africa since this parasite is frequently reported in immunocompromised individuals in African countries (Table 1 and S1 Fig). Importantly, early microscopy-based studies documented E. bieneusi prevalences as high as 40‒67% in apparently healthy people in Cameroon [16] and Nigeria [17]. These findings indicate that asymptomatic, chronic E. bieneusi infections could be more frequent than anticipated. Despite the undoubted progress achieved over the past years, the actual epidemiological situation of E. bieneusi in most African countries, including Mozambique, remains largely unknown. To fill this gap, the present study aims to investigate the occurrence and genetic diversity of E. bieneusi in symptomatic and asymptomatic paediatric populations in two of the most populous provinces of Central (Zambézia) and Southern (Maputo) Mozambique.

Table 1. Enterocytozoon bieneusi infections reported in humans in African countries including country of origin, type of surveyed population, symptomatology, diagnostic method, and reported prevalence and genotypes.

Diagnosis was conducted in stool samples except otherwise indicated.

Country Surveyed population Clinical manifestations Diagnostic method Prevalence (%) Genotype(s) Reference
Cameroon HIV+/TB+; HIV‒/TB+; Immunocompetent Diarrhoea LM, IFAT 35.7 (10/28); 24.0 (6/25); 67.5 (85/126) ND [16]
HIV‒; HIV+ NS IFAT, PCR 2.9 (22/758); 0.5 (4/758) A (8), B (3), CAF4 (5), D (3), Type IVc (1) [36]
HIV+ (adults) Diarrhoea, asymptomatic LM, PCR-RFLP 6.5 (3/46); 4.6 (5/108) Type IV (4) [39]
HIV‒ None PCR 2.6 (5/196) CAF1d (1), Type IV (4) [51]
Chad HIV+a Diarrhoea LM, IFAT, PCR 100 (1/1) ND [52]
Democratic Republic of the Congo HIV+ (> 15 yrs.) Diarrhoea PCR 7.8 (19/242) D (1), CAF1d (1), KIN-2 (1), KIN-3 (1), NIA1 (1) [53]
AIDS patients (> 15 yrs.) Diarrhoea IFAT, PCR 5.1 (9/175) NIA1 (2) [54]
AIDS patients Diarrhoea, other LM, IFAT, 2.0 (1/50) ND [55]
Democratic Republic of São Tome and Principe Rural children; Urban inpatient children Diarrhoea, other PCR 5.2 (7/134); 8.9 (19/214) CAF1d (4), KIN-3 (1), Type IV (14), A (2), D (5) [30]
Ethiopia HIV+, HIV‒ (adults) Diarrhoea U2B, PCR 14.3 (15/105) ND [56]
HIV+, HIV‒ (adults) Diarrhoea, other LM, PCR 12.3 (30/243) ND [57]
Gabon HIV+ (> 16 yrs.) Diarrhoea IFAT, PCR 3.0 (25/822) A (1), CAF1 (3), CAF2 (1), CAF3 (1), CAF4 (4), D (1), Type IVc (4) [36]
Kenya HIV+ (adults) Diarrhoea U2B 3.0 (1/36) ND [58]
Madagascar Inpatients (adults) Diarrhoea, asymptomatic PCR 1.5 (1/67); 2.5 (5/198) ND [59]
Malawi HIV+, HIV‒ NS PCR 100 (37/37)b D (4), Type IVc (9), Peru8 (1), S1 (1), S2 (11), S3 (2), S4 (1), S5 (4), S6 (2), UG2145 (1), [35]
HIV+ (< 18 yrs.) Diarrhoea, other qPCR 37.0 (13/35) ND [7]
Mali HIV+ (adults); HIV‒ (adults) Diarrhoea TEM, LM 32.0 (28/88); 27.0 (3/11) ND [60]
HIV+ Immunocompetent children Diarrhoea U2B, IFAT, PCR 14.8 (9/61); 0.0 (0/71) ND [61]
Mozambique Children and adults Asymptomatic PCR 9.0 (27/301) ND [27]
Children Diarrhoea, asymptomatic PCR 0.3 (1/331); 0.9 (8/916) HhMzEb1 (4), Peru11 (1), Type IV (2), S2 (2) This study
Niger HIV+ (Adults); HIV‒ (children) Diarrhoea, other TEM, LM 7.0 (4/60); 0.8 (8/990) ND [62]
HIV+ (mostly adults) NS LM, qPCR 10.5 (24/228) A (10), CAF1 (2), D (2), E (1), HAN1 (1) Type IVc (1), NIA1 (3) [41]
Nigeria Rural/urban dwellers NS LM 39.6 (80/204) ND [17]
HIV‒ (children) Diarrhoea, asymptomatic PCR 9.3 (4/43) D (2), Type IVc (1), novel K-like (1) [31]
HIV+, HIV‒ Diarrhoea, other PCR 6.4 (10/157) A/Type IV (1), D (3), D/WL7 (1), Type IV (1), WL7 (3), WL7/Type IV (1) [42]
HIV+ (adults) Diarrhoea, other PCR 26.5 (26/98); 4.3 (52/365) A (22), CAF2 (2), D (31), D/Type IV (1), EbpA (1), Type IV (14), Nig1(1), Nig2 (1), Nig3 (1), Nig4 (1), Nig5 (1), Peru8 (1) [43]
HIV+ Diarrhoea PCR 7.7 (10/132) D (1), Nig2 (2), Peru8 (1), Nig4-like (1), Type IV (5) [63]
HIV+ (adults on HAART) Diarrhoea, asymptomatic PCR 11.1 (12/108); 3.4 (6/177) Mixed genotypes (3), Nig4 (2), Nig6 (10), Nig7 (2), Type IV (1) [64]
HIV+ Diarrhoea, asymptomatic LM, IFAT, PCR 2.6 (5/193) B (1), P-like, Peru3, PtEb IV, PtEb V, Type IV, UG2145 (2) [65]
HIV+ (adults) Diarrhoea PCR 5.5 (5/90) Type IV (4), unknown mixed infection (1) [66]
South Africa HIV+ (inpatients); HIV‒ (children) Diarrhoea LM, PCR-RFLP, qPCR 12.9 (33/255); 4.5 (3/67) ND [32]
Tanzania HIV+ (adults); HIV+, HIV‒(children) Diarrhoea, other; Chronic diarrhoea; Acute diarrhoea; Asymptomatic LM, TEM 3.5 (3/86); 3.4 (2/59); 0.0 (0/55); 20.0 (4/20) ND [34]
Tunisia Immunocompromised patients Diarrhoea LM, PCR 3.5 (3/86) ND [67]
HIV+ (newborn) Asymptomatic LM, PCR 100 (1/1) ND [68]
HIV+ (adults); HIV‒ (adults) Diarrhoea, other LM, PCR 20.0 (7/35); 5.3 (3/56) ND [69]
HIV+ (adults) Diarrhoea LM, PCR 2.5 (3/119); 5.9 (7/119) ND [70]
HIV+ (mostly adults) Diarrhoea LM, PCR 100% (7/7) B (2), D (4), Peru8 (1) [71]
HIV+ (adults) Diarrhoea, asymptomatic LM, PCR 19.4 (6/31); 2.8 (2/71) ND [72]
Uganda and Zambia HIV+b Diarrhoea, other LM, TEM 6.5 (5/77) ND [73]
Children (< 5 yrs) Diarrhoea, asymptomatic LM, PCR 17.4 (310/1779); 16.8 (112/667) Type IVc (6), UG2145 (1) [40]
HIV+ (children); HIV‒ (children) Diarrhoea, other PCR 76.9 (70/91); 6.6 (10/152) ND [33]
Zambia Rural children Asymptomatic U2B, TEM 0.6 (1/176) ND [74]
Zimbabwe HIV+ (adults) Diarrhoea LM 10.0 (13/129) ND [75]
HIV+ (adults) Diarrhoea LM, PCR 46.0 (34/74) ND [76]
HIV+ (adults) Diarrhoea LM, PCR 18.0 (10/55); 51.0 (28/55) ND [77]
HIV‒ Diarrhoea, other LM, PCR 33.0 (2/6) ND [78]

HAART, Highly active antiretroviral therapy; HIV, Human immunodeficiency virus; IFAT, immunofluorescence antibody test; LM, light microscopy; ND, not determined; NS, not specified; PCR, polymerase chain reaction; qPCR, real-time PCR; RFLP, restriction fragment length polymorphism; TB, Tuberculosis; TEM, Transmission electron microscopy; U2B, Uvitex 2B fluorescent dye.

a Patient from Chad diagnosed in France.

b Diagnosed in an intestinal biopsy.

c Reported as genotype K.

d Reported as genotype KIN-1.

Methods

Ethics statement

Written informed consent was obtained from legal guardians of children voluntarily participating in this survey. All procedures involved in the study were approved by the Ethics Committee of the Health Institute Carlos III under reference number CEI PI 17_2017-v3, and the National Bioethics Committee for Health (CNBS–Comité Nacional de Bioética para Saúde) of Mozambique under reference number 52/CNBS/2017 (participants in Zambézia). Similarly, approval by the Centro de Investigação em Saúde de Manhiça’s Institutional Bioethics Committee for Health—CIBS (Ref. CIBS-CISM/075/2015), with final approval by CNBS (Ref. 209/CNBS/15), were obtained for participants in Maputo.

Study design

This study is part of an ongoing research collaborative effort involving the Spanish National Centre for Microbiology (SNCM) in Spain, the Centro de Investigação em Saúde de Manhiça (CISM)/Fundação Manhiça (FM) in Mozambique, and the United States Department of Agriculture to assess the molecular epidemiology of the most frequent enteric protist parasites infecting humans in Mozambique. Two independent studies involving different sampling designs were conducted in Zambézia and Maputo provinces.

Collection of stool samples in Zambézia province

Zambézia (population: 5.1 million; total area: 103,478 km2) is the second most-populous province of Mozambique, located in the central coastal region of the country. A prospective cross-sectional molecular epidemiological study was carried out between October 2017 and February 2019. All enrolled children were between 3 and 14 years old. A first set of samples were obtained from school children attending 18 public schools with each 35‒2,111 (mean: 651) children in 10 of the 22 districts of Zambézia. Voluntary participants were provided with sampling kits (sterile polystyrene plastic flask with spatula and a unique identification number) to obtain individual stool samples. In addition, a second set of samples from children presenting with gastrointestinal complaints (abdominal pain, anal pruritus, bloating, constipation, diarrhoea, flatulence, loss of appetite, nausea, vomiting) seeking medical attention in health care centres (n = 6) and hospital settings (n = 1) from six districts of the province were collected.

For both sets, an aliquot of each faecal sample was transferred to a TOTAL-FIX stool collection device (Durviz, Valencia, Spain) and shipped to SNCM in Majadahonda (Spain) for downstream molecular analyses.

Collection of stool samples in Maputo province

The study in the Maputo province was conducted in the Manhiça district (population: 0.2 million; total area: 2,373 km2) that is located approximately 80 km north of the capital city Maputo in Southern Mozambique. The Manhiça district has been under a Health and Demographic Surveillance System (HDSS) from CISM since 1996, allowing the link between demographic and clinical data of the population [18].

Stool samples were collected from children under 5 years of age under an ongoing surveillance of diarrheal diseases conducted by the CISM since September 2015 in the Manhiça District Hospital (MDH) and other health peripheral facilities [18,19]. Children under 5 years of age presenting to the peripheral health facilities with moderate-to-severe and less-severe diarrhoea were recruited. Definition of diarrhoeal cases and inclusion criteria to participate in the research study were as previously described [20]. In addition, starting from December 2016, 1 to 3 community controls (asymptomatic children free of diarrhoea episode > 14 days) matched to the index case by age, sex and neighbourhood were identified (using the HDSS databases) and enrolled within 14 days after said index case was enrolled. Stools were collected for both cases and controls and sent to the laboratory for processing. Additionally, stools from children presenting to the sentinel health facility complaining with less-severe diarrhoea and those children presenting to the Xinavane Rural Hospital (XRH), were enrolled starting in April 2017 up to December 2018. Stool samples were collected in sterile flasks, transported to the laboratory, and stored at ‒80°C without any preservatives for further testing of enteric pathogens as previously described [21].

Data collection

Epidemiological and clinical information was collected in a standardized questionnaire provided as part of the sampling kits and labelled with the same identification number. The questionnaire was completed by researchers interviewing participating children and their caretakers at the time of sampling. The questionnaire included basic demographic characteristics (age, sex, place of living), and potential risk factors including contact with livestock or companion animals, type of drinking water, and information regarding the defecation place. There were some differences between Manhiça and Zambézia questionnaires.

DNA extraction and purification

In stool samples from Zambézia, DNA was isolated from 200 mg of faecal material using the QIAamp Fast DNA stool mini Kit and the QIAcube robot (Qiagen, Hilden, Germany) following the manufacturer's instructions except that treatment of the samples with the lysis buffer was carried out for 10 minutes at 95°C. Purified DNA samples (200 μL) were stored at -20 ºC for downstream molecular analysis. In Manhiça, DNA was manually extracted and purified using the QIAamp DNA Stool Mini Kit from 200 mg of faecal material following the manufacturer's instructions, with the same modification for the lysing step. Purified DNA samples (200 μL) were shipped to the SNCM for molecular testing.

Molecular detection of Enterocytozoon bieneusi

To detect E. bieneusi, a nested PCR was conducted to amplify a 390-bp fragment including the entire ITS as well as portions of the flanking large and small subunit of the rRNA gene [22]. Primary and secondary reactions (50 μL) were carried out using the outer primer set EBITS3 (5´‒GGTCATAGGGATGAAGAG‒3´) and EBITS4 (5´‒TTCGAGTTCTTTCGCGCTC‒3´), and the inner primer set EBITS1 (5´‒GCTCTGAATATCTATGGCT‒3´) and EBITS2.4 (5´‒ATCGCCGACGGATCCAAGTG‒3´), respectively. Reaction mixtures consisted of 1 μL of template DNA, 200 nM of each primer, 2.5 units of MyTAQ DNA polymerase (Bioline GmbH, Luckenwalde, Germany), and 5 μL of MyTAQ Reaction Buffer containing 5 mM dNTPs and 15 mM MgCl2. Cycling conditions for the primary PCR were as follows: after denaturation at 94°C for 3 min, samples were subjected to 35 cycles of amplification (denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and elongation at 72°C for 40 s), followed by a final extension at 72°C for 10 min. Conditions for the secondary PCR were identical to the primary PCR except only 30 cycles were carried out with an annealing temperature of 55°C. Negative (no DNA template) and positive (E. bieneusi PCR-positive samples, genotypes Ebcar2 and EbpA) controls were included in all PCR runs. PCR products were resolved on 2% D5 agarose gels (Conda, Madrid, Spain) stained with Pronasafe (Conda).

Sequence analysis

All amplicons of the expected size were directly sequenced in both directions using the internal primer set in 10 μL reaction mixes using Big Dye chemistries and an ABI 3730xl sequencer analyser (Applied Biosystems, Foster City, CA). Sequencing data were viewed using Chromas Lite version 2.1 software (https://technelysium.com.au/wp/chromas/) to generate consensus sequences. The Blast tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to compare those sequences with reference sequences deposited at the National Center for Biotechnology Information (NCBI). Enterocytozoon bieneusi genotypes were determined using the established nomenclature system based on ITS nucleotide sequence [14]. Sequences obtained in the present study were deposited in the GenBank database under accession numbers MN845065 to MN845068.

Phylogenetic analysis

Nucleotide sequences obtained in this study and E. bieneusi nucleotide sequences for all genotypes previously identified in human and animals in Africa as well as appropriate reference sequences to include all E. bieneusi groups retrieved from GenBank were aligned with the Clustal W algorithm using MEGA X [23]. Phylogenetic inference was carried out by the Neighbor-Joining (NJ) method as previously described [24], genetic distance was calculated with the Kimura parameter-2 model using MEGA X [23].

Statistical analysis

We analysed the data using EpiData 4.2.0 (EpiData Association, Odense, Denmark) and Stata software, versions 15 (STATA Corp., College Station, Texas, US). We calculated odds ratios (OR) for associations; a probability (P) value < 0.05 was considered evidence of statistical significance. We examined for possible confounders (change of > 20% in OR) and interactions. As both populations included selection by symptomatic and asymptomatic populations, we included “a priori” the symptomatic variable in the multivariable model. As the event was rare, and some factors (e.g. G. duodenalis) were found in all cases, we used a penalised regression (Firth regression) selecting risk factors with a P-value ≤ 0.2 from the univariable analysis, using Akaike's information criterion (AIC) and Bayesian information criterion (BIC) to determine selection and evaluate the final model [25].

Results

A total of 1,247 children aged between 0 and 14 years-old were recruited to participate in this study in the Manhiça District in Maputo (n = 150) and Zambézia province (n = 1,097) in Mozambique. The main socio-demographic and epidemiological features of these paediatric populations are summarized in Table 2.

Table 2. Main socio-demographic and epidemiological features, expressed as frequencies, of the Mozambican children populations (n = 1,247) investigated in the present study.

Zambézia Manhiça district–Maputo
Asymptomatic (n = 807) Symptomatic (n = 290) Total (n = 1,097) Asymptomatic (n = 109) Symptomatic (n = 41) Total (n = 150)
Gender
    Male 49.7 50.3 49.9 54.1 48.8 52.7
    Female 50.3 49.7 50.1 45.9 51.2 47.3
Age group (years)
    0‒5 13.4 33.8 18.8 100 100 100
    6‒10 64.3 49.3 60.3 NA NA NA
    11‒14 22.3 16.9 20.9 NA NA NA
Area
    Rural 86.5 43.8 75.2 100 100 100
    Urban 13.5 56.2 24.8 NA NA NA
Contact with livestock
    Yes 4.6 14.1 7.1 59b 46.3c 55.3b
    No 95.4 85.9 92.9 41b 53.7c 44.7b
Contact with dogs/cats
    Yes 18.8 26.6 20.9 30b 19.5c 26.9b
    No 81.2 73.4 79.1 70b 80.5c 73.1b
Main drinking water source
    River/springs 4.3a 4.1 4.3a 2b 2.4 3.6b
    Tap 23.2a 54.1 31.4a 91b 80.5 86.5b
    Well 72.0a 41.7 64.0a 7b 17.1 9.9b
Defecation place
    Latrine 88.0 76.9 85.1 100 c 100 d 100 e
    Outside 12.0 23.1 14.9 0.0 c 0.0 d 0.0 e

NA: not applicable.

a Information for four children was not available.

b Information for nine children was not available.

c Information for one child was not available.

d Information for five children was not available.

e Information for six children was not available.

In Zambézia, 807 asymptomatic schoolchildren and 290 children presenting with gastrointestinal complaints seeking for medical care were investigated in 10 and six districts of the province, respectively (Table 2 and S1 and S2 Tables). The overall male/female ratio was 1.0, and children in the age group 6 to 10 years-old represented 60% of the surveyed individuals. Three out of four children investigated lived in rural areas.

In the rural Manhiça district, 109 asymptomatic children and 41 children presenting with gastrointestinal complaints (11 with moderate-to-severe diarrhoea and 30 with less severe diarrhoea) and seeking for medical care were investigated (Table 2 and S3 and S4 Tables). In this subpopulation, the male/female ratio was 1.1, and children in the age group 12–23 months-old represented 40.7% of the surveyed individuals. Most children (62.7%) were from the area covered by the MDH. All these children lived in rural areas.

Overall, E. bieneusi was detected by nested-PCR and confirmed by sequencing in 0.7% (9/1,247, 95% CI: 0.4–1.4) of the investigated children population. The prevalence was more than 10-fold higher in the Manhiça district in Maputo (4.0%, 6/150, 95% CI: 1.8–8.6) compared to all the districts in Zambézia combined (0.3%, 3/1,097, 95%CI: 0.1–0.8). The prevalence for those without symptoms was 0.9% (8/916, 95% CI: 0.4–1.7) and for those with symptoms 0.3% (1/331, 95% CI: 0.04–2.1), and those with diarrhoea 0.4% (1/251, 95% CI: 0.06–2.8). Nucleotide sequences of the ITS revealed the presence of four distinct E. bieneusi genotypes, three previously reported in humans (Type IV, S2, and Peru11) and a novel genotype (named HhMzEb1). No mixed infections were observed. Novel genotype HhMzEb1 differed from genotype D (AF101200) by one nucleotide. Genotype S2 nucleotide sequence obtained in this study showed a SNP at the large subunit region when compared with reference sequence (GenBank accession number FJ439678).

The main socio-demographic, epidemiological, and genotypes identified in each of the E. bieneusi infections identified in the present study are shown in Table 3. In the Zambézia province, E. bieneusi was found in 3 asymptomatic children. Two of them lived in a rural area, attended the same school, but were infected by different genotypes (Peru11 and S2) of the parasite. Both children were co-infected with G. duodenalis, Blastocystis sp., and Strongyloides spp. The third child was infected by the Type IV genotype of E. bieneusi and was co-infected with G. duodenalis. None of the symptomatic children investigated in this province tested positive to E. bieneusi.

Table 3. Main socio-demographic features, risk factors, and genotyping data of Mozambican children positive to Enterocytozoon bieneusi (n = 9) in the present study.

Province District Sample ID Area Gender Age Contact with livestock and/or poultry Contact with companion animals Main source of drinking water Defecation place Genotype GenBank accession number
Zambézia Gurúe 18 Urban Male 132 months-old No Cat, dog Public tap Latrine Type IV MN845065
Mocuba 207 Rural Male 60 months-old No No Well Outside Peru11 MN845067
Mocuba 210 Rural Female 60 months-old No No Well Outside S2 MN845066
Maputo Manhiça–MDH 1728661.9a, c, d Rural Male 16 months-old Poultry No Public tap Latrine HhMzEb1b MN845068
Manhiça–MDH 1725028.3 Rural Male 28 months-old ND ND ND Latrine HhMzEb1b Identical to MN845068
Manhiça–XRH 1754917.2e Rural Male 16 months-old ND ND ND Latrine HhMzEb1b Identical to MN845068
Manhiça–XRH 1725031.3d, e Rural Male 12 months-old No No Public tap Latrine Type IV Identical to MN845065
Manhiça–XRH 1754898.4 Rural Male 12 months-old Goat, poultry No Unprotected well Latrine S2 Identical to MN845066
Manhiça–MDH 1754369.9f Rural Male 15 months-old No No ND Latrine HhMzEb1b Identical to MN845068

ND: no data available; MDH: Manhiça District Hospital; XRH: Xinavane Rural Hospital.

a Symptomatic child presenting with moderate-to-severe diarrhoea.

b Novel genotype.

c Co-infected with Cryptosporidium meleagridis and HIV positive.

d Deceased.

e Co-infected with Rotavirus.

f Co-infected with Cryptosporidium parvum.

In Maputo province, E. bieneusi was found in six male children, one presenting with moderate-to-severe diarrhoea and 5 asymptomatic. Five out of the six cases were younger than 2 years old. The S2 and Type IV genotypes were found in a single boy each, one of them co-infected with Rotavirus. Among the 4 boys infected with the novel genotype, HhMzEb1, one was HIV positive, presented with moderate-to-severe diarrhoea, and was co-infected with Cryptosporidium meleagridis. Another boy with this genotype was co-infected with C. parvum, and a third one was co-infected with Rotavirus. All six E. bieneusi-positive samples were co-infected with G. duodenalis.

Univariable analysis (Table 4) of the combined data showed that significant risk associations included infections with G. duodenalis or Cryptosporidium spp. and age, but handwashing was protective. In the Zambézia dataset alone, G. duodenalis was a significant association. In addition, travel, Blastocystis sp., and absence of a latrine were associated with presence of E. bieneusi (P value < 0.5), but confidence intervals crossed 1, with only 3 positive cases. In the Maputo dataset there were no significant associations. In the final multivariable model using the combined dataset, after adjusting for symptoms, the risk associations for E. bieneusi were infection with G. duodenalis [OR: 19.11, P = 0.43, 95% CI (1.10–332.94)]; infection with Cryptosporidium spp. [OR 5.75, P = 0.49 95% CI (1.01–32.89)] and handwashing [OR 0.31 P = 0.128 95%CI (0.67–1.41)]. Although handwashing was not significant, it was retained in the final model as it confounded the relationship with Cryptosporidium spp. Age was not a factor after adjustment for other variables.

Table 4. Descriptive and univariable analysis of the variables of interest potentially associated with an increased exposure risk to Enterocytozoon bieneusi in the present study.

Variable Cases of E. bieneusi with variable % Non cases with variable % Odds ratio 95% CI P value
Cryptosporidium spp. 2 22 35 3 9.82 0.96–53.84 0.001
Giardia duodenalis 9 100 556 45 15.27 2.87–. 0.001
Age Continuous 0.66 0.51–0.85 0.001
Handwashing (yes) 6 67 1152 93 0.14 0.03–0.86 0.001
Male Sex 7 78 622 50 3.47 0.66–34.29 0.1
Has livestock 2 22 150 12 3.61 0.32–25.37 0.115
Water source (not tap water) 3 33 885 71 0.39 0.05–2.94 0.236
Symptomatic 1 11 330 27 0.34 0.01–2.58 0.293
Blastocystis sp. 2 22 156 13 1.98 0.20–10.51 0.387
No latrine 2 22 162 13 1.89 0.19–10.01 0.423
Rural 8 89 967 78 2.24 0.30–99.83 0.435
Has pets (dog/cats) 1 11 267 22 0.72 0.02–6.50 0.766
Stronglyloides stercoralis 2 22 253 20 1.11 0.11–5.88 0.895
Entamoeba dispar 1 11 122 10 1.14 0.03–8.65 0.9

95% CI: 95% Confidence Interval.

Phylogenetic analysis revealed that the novel genotype HhMzEB1 clustered within Group 1 when its relationship with other genotypes of human and animal origin previously reported in Africa was evaluated (Fig 1).

Fig 1. Phylogenetic relationships among Enterocytozoon bieneusi genotypes identified in this study.

Fig 1

All genotypes identified in humans and animals in Africa, and genotypes to cover all groups of E. bieneusi were included for comparative purposes. Analyses were inferred by a Neighbor-Joining method of the entire ITS of rRNA gene based on genetic distances calculated by the Kimura two-parameter model (MEGA X software). All nucleotide sequences include host information with the GenBank accession number in parenthesis. Nucleotide sequences determined in this study are identified with black circles before the genotype name. White circles indicate genotypes identified in Africa.

Discussion

Little information is currently available on the occurrence and distribution of enteric parasites in Mozambique [2628], although the GEMS project has significantly improved our understanding of the epidemiology of diarrhoea-associated with parasites G. duodenalis, Cryptosporidium spp., and E. histolytica [15, 29]. However, there is almost no information regarding Microsporidia, and only one study that aimed to investigate the prevalence of intestinal parasite infections in an informal settlement in Beira, Mozambique has reported E. bieneusi [27]. They detected E. bieneusi by real-time PCR in 9.3% (28/301) of the individuals tested and no genotyping was provided. Therefore, this is to our knowledge the first molecular epidemiological study describing occurrence and genetic diversity of E. bieneusi in Mozambique. The overall prevalence of E. bieneusi infection in the paediatric (0‒14 years of age) populations from Mozambique tested in this study was 0.7% (9/1,247). Infections were more commonly identified in asymptomatic children in rural settings.

The E. bieneusi infection rates found in our paediatric populations in Zambézia (0.3%) and Maputo (4%) were lower than the prevalence reported in Beira in Sofala province (9%) [27], indicating potential differences in the geographical distribution of the parasite in Mozambique. The disparity could also be associated with differences in socioeconomic characteristics of the studied population as the study in Beira was conducted in an informal settlement in an area that is frequently flooded and not connected to a sewage system after a local hospital noticed high number of diarrhoea cases in this settlement. Prevalence in Mozambique (0.7%) is lower to those previously documented in immunocompetent children populations (range: 4‒9%) in other African countries including the Democratic Republic of São Tomé and Principe [30], Nigeria [31], South Africa [32], and Uganda [33], and much lower than those found in similar paediatric populations (range: 20‒67%) in Cameroon [16], Nigeria [17], and Tanzania [34] (see Table 1). However, prevalence is influenced by the age group selected in the study and the presence of symptoms, so comparisons among studies must keep those differences in mind.

It is noteworthy to indicate that all E. bieneusi-positive children were also co-infected by other pathogens including two children in Manhiça that were HIV-positive. Indeed, one to three additional enteric parasites (G. duodenalis, Cryptosporidium spp., Blastocystis sp., and Strongyloides spp.) were found and the strongest risk associations were with G. duodenalis and Cryptosporidium spp. These data clearly depict a highly endemic scenario where polyparasitism is common as previously reported in the city of Beira [27].

Our study is limited by the small number of positive samples, thus the wide confidence intervals for our results. Furthermore, detailed information on handwashing (use of soap or not) and latrine use (toilet or outside latrine) were unavailable in the Zambézia dataset, and missing values for water source and animal livestock in the Maputo dataset implied limited exploration of these associations, especially given the low numbers of cases.

Nucleotide sequence analysis on the ITS region of the nine positive cases revealed the presence of four genotypes, three previously reported (Peru11, Type IV, and S2) and a novel genotype (named HhMzEb1). This constitutes the first report of these genotypes in Mozambique. Genotypes Type IV and S2 were both identified in Zambézia and Maputo, while Peru11 was only identified in Zambézia and novel genotype HhMzEb1 only in Maputo. All genotypes identified in the present study, including novel HhMzEb1, belonged to Group 1 (Fig 1) that includes E. bieneusi genotypes with low host specificity that are found not only in humans but also in domestic and wild animals worldwide [10,11,14]. This is the second report of genotype S2 in humans, that had only been previously reported in Malawi from three children (2 HIV-positive and one HIV-negative) and eight HIV-positive adults [35]. Genotype Type IV (also reported previously as K, Peru2, BEB5, CMITS1, BEB-var, PtEB III) has widely been found in humans in different regions throughout the world [5,3638], with multiple reports in African countries that include Gabon [36], Cameroon [36,39], Uganda [40], Niger [41], Nigeria [31,42,43], Democratic Republic of São Tomé and Principe [30], and Malawi [35] (S5 Table). In addition, Type IV has also been reported in a wide range of animal hosts including non-human primates, cattle, cats, dogs, rodents, birds, snakes, and black bears (S5 Table) as well as in water samples [4447]. There are no previous reports of Peru11 (also reported previously as Peru12) in humans in Africa, but it has been found in humans in Asia and South America (S5 Table). In Africa, Peru11 has been found in a baboon in Kenya [48]. In addition, there are also reports of this genotype in other parts of the world in non-human primates, cats, raccoons, rabbits, rodents, and birds (S5 Table).

In this study, no mixed infections by different E. bieneusi genotypes were noticed using ITS-PCR and Sanger sequencing. However, it should be noted that co-infections seem a common finding in human populations in endemic areas. Indeed, intra-isolate diversity has been demonstrated in children with diarrhoea in Uganda using microsatellite markers (in addition to ITS) and subsequent cloning and sequencing of PCR products [49]. These data preclude us to conclusively state that mixed infections are not present in the surveyed Mozambican population as the methodology used in this study was not chosen to address mixed infections. The identification of potentially zoonotic genotypes Peru11 and Type IV, commonly found not only in humans but also in domestic and wild animals worldwide, indicates the potential for zoonotic or cross-species transmission. There are few studies in the African continent that include molecular characterization of E. bieneusi in humans and in animals. However, environmental (water) samples should be also considered as a source of infection by microsporidia, as E. bieneusi has been demonstrated to be involved in waterborne outbreaks of gastrointestinal disease [50]. Our findings emphasize the need of further studies to explore risk associations as these were limited in our study by the low prevalence and missing information. Studies could include water as well as animals that may be in contact with human populations in Mozambique to understand the modes of transmission of E. bieneusi, and, by analogy, of other diarrhoea-causing enteric protist species.

Conclusions

This is the first molecular study of E. bieneusi in Mozambique. The parasite was primarily found in asymptomatic children in Maputo (Manhiça district) and Zambézia province. Molecular characterization detected a novel genotype (HhMzEb1) and three known genotypes (Type IV, Peru11 and S2) in diarrheal and healthy Mozambican children. The identification of genotypes previously described in animals suggests potential zoonotic and anthroponotic transmission. There is a lack of information of E. bieneusi in the African continent in humans, animal hosts and environmental samples. Under the One Health perspective, further genotyping studies are needed to better understand the epidemiology of this parasite.

Supporting information

S1 Fig. Occurrence of Enterocytozoon bieneusi in humans in Africa.

Average values for symptomatic and asymptomatic individuals are represented according to reported infection rates summarized in Table 1.

(TIF)

S1 Table. Main socio-demographic features and risk factors of the asymptomatic schoolchildren population (n = 807) investigated in Zambézia province (Mozambique), 2017‒2019.

(DOCX)

S2 Table. Main socio-demographic features and risk factors of the symptomatic schoolchildren population (n = 290) attended at public health centres in Zambézia province (Mozambique), 2017‒2018.

(DOCX)

S3 Table. Main socio-demographic features and risk factors of the asymptomatic children population (n = 109) investigated in Maputo province (Mozambique), 2016‒2018.

(DOCX)

S4 Table. Main socio-demographic features and risk factors of the symptomatic children population (n = 41) investigated in Maputo province (Mozambique), 2016–2018.

(DOCX)

S5 Table. Summary of all Enterocytozoon bieneusi genotypes reported in Africa including host and geographic range.

Highlighted in bold are African countries.

(DOCX)

Acknowledgments

We thank the children and their caretakers who participated in the study, as well as the clinical, field and laboratory staff who worked tirelessly to ensure the data collection and laboratory testing was performed according to the protocols. We also thank all the local government authorities (district Administration Health and Education Directorates in Zambézia and Manhiça) and all community leaders for supporting the study.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

DC received funding from the Health Institute Carlos III, Ministry of Economy and Competitiveness (Spain), under project PI16CIII/00024. TN received funding from the Fundo Nacional de Investigação, Ministry of Health (Mozambique) under project 245-INV. Additional funding was obtained from the USAID Country Office of Mozambique under the Fixed Amount Award Grant No. AID-656-F-16-00002 (IM) and the Centers for Disease Control and Prevention (CDC, USA) through the GAVI Alliance under subcontractor agreement MOA# 870-15 SC (JM). The funders did not play any role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Didier ES, Weiss LM. Microsporidiosis: current status. Curr Opin Infect Dis. 2006;19: 485–492. 10.1097/01.qco.0000244055.46382.23 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Stentiford GD, Becnel JJ, Weiss LM, Keeling PJ, Didier ES, Williams BAP, et al. Microsporidia—emergent pathogens in the global food chain. Trends Parasitol. 2016;32: 336–348. 10.1016/j.pt.2015.12.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Weiss LM, Becnel JL. Microsporidia: Pathogens of Opportunity. New Jersey: Willey-Blackwell; 2014. [Google Scholar]
  • 4.Lobo ML, Xiao L, Antunes F, Matos O. Microsporidia as emerging pathogens and the implication for public health: a 10-year study on HIV-positive and negative patients. Int J Parasitol. 2012;42: 197–205. 10.1016/j.ijpara.2011.12.002 [DOI] [PubMed] [Google Scholar]
  • 5.Santín M. Enterocytozoon bieneusi. In: Xiao L, Ryan U, Feng Y, editors. Biology of foodborne parasites. Boca Raton: CRC Press; 2015. pp 149–174. [Google Scholar]
  • 6.del Águila C, Lopez-Velez R, Fenoy S, Turrientes C, Cobo J, Navajas R, et al. Identification of Enterocytozoon bieneusi spores in respiratory samples from an AIDS patient with a 2-year history of intestinal microsporidiosis. J Clin Microbiol. 1997;35: 1862–1866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Huibers MHW, Moons P, Maseko N, Gushu MB, Iwajomo OH, Heyderman RS, et al. Multiplex real-time PCR detection of intestinal protozoa in HIV-infected children in Malawi: Enterocytozoon bieneusi is common and associated with gastrointestinal complaints and may delay BMI (nutritional status) recovery. Pediatr Infect Dis J. 2018;37: 910–915. 10.1097/INF.0000000000001924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Rogawski ET, Liu J, Platts-Mills JA, Kabir F, Lertsethtakarn P, Siguas M, et al. Use of quantitative molecular diagnostic methods to investigate the effect of enteropathogen infections on linear growth in children in low-resource settings: longitudinal analysis of results from the MAL-ED cohort study. Lancet Glob Health. 2018;6:e1319–e1328. 10.1016/S2214-109X(18)30351-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Santín M, Fayer R. Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Res Vet Sci. 2011;90: 363–371. 10.1016/j.rvsc.2010.07.014 [DOI] [PubMed] [Google Scholar]
  • 10.Li W, Feng Y, Santín M. Host specificity of Enterocytozoon bieneusi and public health implications. Trends Parasitol. 2019;35: 436–451. 10.1016/j.pt.2019.04.004 [DOI] [PubMed] [Google Scholar]
  • 11.Li W, Feng Y, Zhang L, Xiao L. Potential impacts of host specificity on zoonotic or interspecies transmission of Enterocytozoon bieneusi. Infect Genet Evol. 2019;104033 10.1016/j.meegid.2019.104033 [DOI] [PubMed] [Google Scholar]
  • 12.Mathis A, Weber R, Deplazes P. Zoonotic potential of the microsporidia. Clin Microbiol Rev. 2005;18: 423–445. 10.1128/CMR.18.3.423-445.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Izquierdo F, Castro Hermida JA, Fenoy S, Mezo M, González-Warleta M, del Aguila C. Detection of microsporidia in drinking water, wastewater and recreational rivers. Water Res. 2011;45: 4837–4843. 10.1016/j.watres.2011.06.033 [DOI] [PubMed] [Google Scholar]
  • 14.Santín M, Fayer R. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: a consensus. J Eukaryot Microbiol. 2009;56: 34–38. 10.1111/j.1550-7408.2008.00380.x [DOI] [PubMed] [Google Scholar]
  • 15.Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, et al. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. Lancet. 2013;382: 209–222. 10.1016/S0140-6736(13)60844-2 [DOI] [PubMed] [Google Scholar]
  • 16.Nkinin SW, Asonganyi T, Didier ES, Kaneshiro ES. Microsporidian infection is prevalent in healthy people in Cameroon. J Clin Microbiol. 2007;45: 2841–2846. 10.1128/JCM.00328-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Ikeh EI, Obadofin MO, Brindeiro B, Baugherb C, Frost F, Vanderjagt D, et al. Intestinal parasitism in Magama Gumau rural village and Jos township in north central Nigeria. Niger Postgrad Med J. 2007;14: 290–295. [PubMed] [Google Scholar]
  • 18.Sacoor C, Nhacolo A, Nhalungo D, Aponte JJ, Bassat Q, Augusto O, et al. , Profile: Manhiça Health Research Centre (Manhiça HDSS). Int J Epidemiol. 2013;42: 1309–1318. 10.1093/ije/dyt148 [DOI] [PubMed] [Google Scholar]
  • 19.Alonso P, Saúte F, Aponte J, Gómez-Olivé F, Nhacolo A, Thomson R, et al. Manhiça DSS, Mozambique. Vol. 1, Population and health in developing countries. 2002. 189–195 p. [Google Scholar]
  • 20.Kotloff KL, Blackwelder WC, Nasrin D, Nataro JP, Farag TH, van Eijk A, et al. The Global Enteric Multicenter Study (GEMS) of diarrheal disease in infants and young children in developing countries: epidemiologic and clinical methods of the case/control study. Clin Infect Dis. 2012;55: S232–S245. 10.1093/cid/cis753 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Panchalingam S, Antonio M, Hossain A, Mandomando I, Ochieng B, Oundo J, et al. Diagnostic microbiologic methods in the GEMS-1 case/control study. Clin Infect Dis. 2012;55: S225–S231. 10.1093/cid/cis787 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Buckholt MA, Lee JH, Tzipori S. Prevalence of Enterocytozoon bieneusi in swine: an 18-month survey at a slaughterhouse in Massachusetts. Appl Environ Microbiol. 2002;68: 2595–2599. 10.1128/aem.68.5.2595-2599.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kumar S., Stecher G., Li M., Knyaz C., Tamura K., Battistuzzi F.U. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018; 35: 1547–1549. 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4: 406‒425. 10.1093/oxfordjournals.molbev.a040454 [DOI] [PubMed] [Google Scholar]
  • 25.Heinze G, Schemper M. A solution to the problem of separation in logistic regression. Stat Med. 2002;21:2409–2419. 10.1002/sim.1047 [DOI] [PubMed] [Google Scholar]
  • 26.Irisarri-Gutiérrez MJ, Mingo MH, de Lucio A, Gil H, Morales L, Seguí R, et al. Association between enteric protozoan parasites and gastrointestinal illness among HIV- and tuberculosis-infected individuals in the Chowke district, southern Mozambique. Acta Trop. 2017;170: 197–203. 10.1016/j.actatropica.2017.03.010 [DOI] [PubMed] [Google Scholar]
  • 27.Meurs L, Polderman AM, Vinkeles Melchers NV, Brienen EA, Verweij JJ, Groosjohan B, et al. Diagnosing polyparasitism in a high-prevalence setting in Beira, Mozambique: Detection of intestinal parasites in fecal samples by microscopy and real-time PCR. PLoS Negl Trop Dis. 2017;11: e0005310 10.1371/journal.pntd.0005310 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Augusto G, Nalá R, Casmo V, Sabonete A, Mapaco L, Monteiro J. Geographic distribution and prevalence of schistosomiasis and soil-transmitted helminths among schoolchildren in Mozambique. Am J Trop Med Hyg. 2009;81: 799–803. 10.4269/ajtmh.2009.08-0344 [DOI] [PubMed] [Google Scholar]
  • 29.Kotloff KL, Nasrin D, Blackwelder WC, Wu Y, Farag T, Panchalingham S, et al. The incidence, aetiology, and adverse clinical consequences of less severe diarrhoeal episodes among infants and children residing in low-income and middle-income countries: a 12-month case-control study as a follow-on to the Global Enteric Multicenter Study (GEMS). Lancet Glob Health. 2019;7(5):e568–e584. 10.1016/S2214-109X(19)30076-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lobo ML, Augusto J, Antunes F, Ceita J, Xiao L, Codices V, et al. Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi and other intestinal parasites in young children in Lobata province, Democratic Republic of São Tomé and Principe. PLoS One. 2014;9: e97708 10.1371/journal.pone.0097708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ayinmode AB, Ojuromi OT, Xiao L. Molecular Identification of Enterocytozoon bieneusi isolates from Nigerian children. J Parasitol Res. 2011;129542 10.1155/2011/129542 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Samie A, Obi CL, Tzipori S, Weiss LM, Guerrant RL. Microsporidiosis in South Africa: PCR detection in stool samples of HIV-positive and HIV-negative individuals and school children in Vhembe district, Limpopo Province. Trans R Soc Trop Med Hyg. 2007;101:547–554. 10.1016/j.trstmh.2007.02.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tumwine JK, Kekitiinwa A, Bakeera-Kitaka S, Ndeezi G, Downing R, Feng X, et al. Cryptosporidiosis and microsporidiosis in Ugandan children with persistent diarrhea with and without concurrent infection with the human immunodeficiency virus. Am J Trop Med Hyg. 2005;73: 921–925. [PubMed] [Google Scholar]
  • 34.Cegielski JP, Ortega YR, McKee S, Madden JF, Gaido L, Schwartz DA, et al. Cryptosporidium, Enterocytozoon, and Cyclospora infections in pediatric and adult patients with diarrhea in Tanzania. Clin Infect Dis. 1999;28: 314–321. 10.1086/515131 [DOI] [PubMed] [Google Scholar]
  • 35.ten Hove RJ, Van Lieshout L, Beadsworth MB, Perez MA, Spee K, Claas EC, et al. Characterization of genotypes of Enterocytozoon bieneusi in immunosuppressed and immunocompetent patient groups. J Eukaryot Microbiol. 2009;56: 388–393 10.1111/j.1550-7408.2009.00393.x [DOI] [PubMed] [Google Scholar]
  • 36.Breton J, Bart-Delabesse E, Biligui S, Carbone A, Seiller X, Okome-Nkoumou M, et al. New highly divergent rRNA sequence among biodiverse genotypes of Enterocytozoon bieneusi strains isolated from humans in Gabon and Cameroon. J Clin Microbiol. 2007;45: 2580–2589. 10.1128/JCM.02554-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wang L, Zhang H, Zhao X, Zhang L, Zhang G, Guo M, et al. Zoonotic Cryptosporidium species and Enterocytozoon bieneusi genotypes in HIV-positive patients on antiretroviral therapy. J Clin Microbiol. 2013;51: 557–563. 10.1128/JCM.02758-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sulaiman IM, Bern C, Gilman R, Cama V, Kawai V, Vargas D, et al. A molecular biologic study of Enterocytozoon bieneusi in HIV-infected patients in Lima, Peru. J Eukaryot Microbiol. 2003;50: S591–S596. [DOI] [PubMed] [Google Scholar]
  • 39.Sarfati C, Bourgeois A, Menotti J, Liegeois F, Moyou-Somo R, Delaporte E, et al. Prevalence of intestinal parasites including microsporidia in human immunodeficiency virus-infected adults in Cameroon: a cross-sectional study. Am J Trop Med Hyg. 2006;74:162–164. [PubMed] [Google Scholar]
  • 40.Tumwine JK, Kekitiinwa A, Nabukeera N, Akiyoshi DE, Buckholt MA, Tzipori S. Enterocytozoon bieneusi among children with diarrhea attending Mulago Hospital in Uganda. Am J Trop Med Hyg. 2002;67: 299–303. 10.4269/ajtmh.2002.67.299 [DOI] [PubMed] [Google Scholar]
  • 41.Espern A, Morio F, Miegeville M, Illa H, Abdoulaye M, Meyssonnier V, et al. Molecular study of microsporidiosis due to Enterocytozoon bieneusi and Encephalitozoon intestinalis among human immunodeficiency virus-infected patients from two geographical areas: Niamey, Niger, and Hanoi, Vietnam. J Clin Microbiol. 2007;45: 2999–3002. 10.1128/JCM.00684-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Maikai BV, Umoh JU, Lawal IA, Kudi AC, Ejembi CL, Xiao L. Molecular characterizations of Cryptosporidium, Giardia, and Enterocytozoon in humans in Kaduna State, Nigeria. Exp Parasitol. 2012;131: 452–456. 10.1016/j.exppara.2012.05.011 [DOI] [PubMed] [Google Scholar]
  • 43.Akinbo FO, Okaka CE, Omoregie R, Dearen T, Leon ET, Xiao L. Molecular epidemiologic characterization of Enterocytozoon bieneusi in HIV-infected persons in Benin City, Nigeria. Am J Trop Med Hyg. 2012;86: 441–445. 10.4269/ajtmh.2012.11-0548 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ye J, Xiao L, Ma J, Guo M, Liu L, Feng Y. Anthroponotic enteric parasites in monkeys in public park, China. Emerg Infect Dis. 2012;18: 1640–1643. 10.3201/eid1810.120653 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Ben Ayed L, Yang W, Widmer G, Cama V, Ortega Y, Xiao L. Survey and genetic characterization of wastewater in Tunisia for Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi, Cyclospora cayetanensis and Eimeria spp. J Water Health. 2012;10: 431–444. 10.2166/wh.2012.204 [DOI] [PubMed] [Google Scholar]
  • 46.Graczyk TK, Lucy FE, Mashinsky Y, Andrew Thompson RC, Koru O, Dasilva AJ. Human zoonotic enteropathogens in a constructed free-surface flow wetland. Parasitol Res. 2009;105: 423–428. 10.1007/s00436-009-1400-6 [DOI] [PubMed] [Google Scholar]
  • 47.Li N, Xiao L, Wang L, Zhao S, Zhao X, Duan L, et al. Molecular surveillance of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi by genotyping and subtyping parasites in wastewater. PLoS Negl Trop Dis. 2012;6: e1809 10.1371/journal.pntd.0001809 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Li W, Kiulia NM, Mwenda JM, Nyachieo A, Taylor MB, Zhang X, et al. Cyclospora papionis, Cryptosporidium hominis, and human-pathogenic Enterocytozoon bieneusi in captive baboons in Kenya. J Clin Microbiol. 2011;49: 4326–4329. 10.1128/JCM.05051-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Widmer G, Dilo J, Tumwine JK, Tzipori S, Akiyoshi DE. Frequent occurrence of mixed Enterocytozoon bieneusi infections in humans. Appl Environ Microbiol. 2013;79: 5357–5362. 10.1128/AEM.01260-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Wang L, Xiao L, Duan L, Ye J, Guo Y, Guo M, et al. Concurrent infections of Giardia duodenalis, Enterocytozoon bieneusi, and Clostridium difficile in children during a cryptosporidiosis outbreak in a pediatric hospital in China. PLoS Negl Trop Dis. 2013;7: e2437 10.1371/journal.pntd.0002437 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Ndzi ES, Asonganyi T, Nkinin MB, Xiao L, Didier ES, Bowers LC, et al. Fast technology analysis enables identification of species and genotypes of latent Microsporidia infections in healthy native Cameroonians. J Eukaryot Microbiol. 2016;63: 146–152. 10.1111/jeu.12262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Raccurt CP, Agnamey P, Sarfati C, Chouaki T, Totet A. [Intestinal microsporidiosis due to Enterocytozoon bieneusi in a patient infected with HIV-1: first reported case in Chad]. Med Trop. 2008;68: 307–308. [PubMed] [Google Scholar]
  • 53.Wumba R, Jean M, Benjamin LM, Madone M, Fabien K, Josué Z, et al. Enterocytozoon bieneusi identification using real-time polymerase chain reaction and restriction fragment length polymorphism in HIV-infected humans from Kinshasa Province of the Democratic Republic of Congo. J Parasitol Res. 2012:278028 10.1155/2012/278028 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Wumba R, Longo-Mbenza B, Mandina M, Odio WT, Biligui S, Sala J, et al. Intestinal parasites infections in hospitalized AIDS patients in Kinshasa, Democratic Republic of Congo. Parasite. 2010;17: 321–328. 10.1051/parasite/2010174321 [DOI] [PubMed] [Google Scholar]
  • 55.Wumba R, Enache-Angoulvant A, Develoux M, Mulumba A, Mulumba PM, Hennequin C, et al. [Prevalence of opportunistic digestive parasitic infections in Kinshasa, Democratic Republic of Congo. Results of a preliminary study in 50 AIDS patients]. Med Trop (Mars). 2007;67: 145–148. [PubMed] [Google Scholar]
  • 56.Endeshaw T, Kebede A, Verweij JJ, Wolday D, Zewide A, Tsige K, et al. Detection of intestinal microsporidiosis in diarrhoeal patients infected with the human immunodeficiency virus (HIV-1) using PCR and Uvitex-2B stain. Ethiop Med J. 2005;43: 97–101. [PubMed] [Google Scholar]
  • 57.Endeshaw T, Kebede A, Verweij JJ, Zewide A, Tsige K, Abraham Y, et al. Intestinal microsporidiosis in diarrheal patients infected with human immunodeficiency virus-1 in Addis Ababa, Ethiopia. Jpn J Infect Dis. 2006;59: 306–310. [PubMed] [Google Scholar]
  • 58.Mwachari C, Batchelor BI, Paul J, Waiyaki PG, Gilks CF. Chronic diarrhoea among HIV-infected adult patients in Nairobi, Kenya. J Infect. 1998;37: 48–53. 10.1016/s0163-4453(98)90561-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Greigert V, Abou-Bacar A, Brunet J, Nourrisson C, Pfaff AW, Benarbia L, et al. Human intestinal parasites in Mahajanga, Madagascar: The kingdom of the protozoa. PLoS One 2018;13: e0204576 10.1371/journal.pone.0204576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Maiga I, Doumbo O, Dembele M, Traoré H, Desportes-Livage I, Hilmarsdottir I, et al. [Human intestinal microsporidiosis in Bamako (Mali): the presence of Enterocytozoon bieneusi in HIV seropositive patients]. Sante. 1997;7: 257–262. [PubMed] [Google Scholar]
  • 61.Alfa Cisse O, Ouattara A, Thellier M, Accoceberry I, Biligui S, Minta D, et al. Evaluation of an immunofluorescent-antibody test using monoclonal antibodies directed against Enterocytozoon bieneusi and Encephalitozoon intestinalis for diagnosis of intestinal microsporidiosis in Bamako (Mali). J Clin Microbiol. 2002;40: 1715–1718. 10.1128/jcm.40.5.1715-1718.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Bretagne S, Foulet F, Alkassoum W, Fleury-Feith J, Develoux M. [Prevalence of Enterocytozoon bieneusi spores in the stool of AIDS patients and African children not infected by HIV]. Bull Soc Pathol Exot. 1993;86: 351–357. [PubMed] [Google Scholar]
  • 63.Ayinmode AB, Zhang H, Dada-Adegbola HO, Xiao L. Cryptosporidium hominis subtypes and Enterocytozoon bieneusi genotypes in HIV-infected persons in Ibadan, Nigeria. Zoonoses Public Health. 2014;61: 297–303. 10.1111/zph.12072 [DOI] [PubMed] [Google Scholar]
  • 64.Akinbo FO, Okaka CE, Omoregie R, Adamu H, Xiao L. Unusual Enterocytozoon bieneusi genotypes and Cryptosporidium hominis subtypes in HIV-infected patients on highly active antiretroviral therapy. Am J Trop Med Hyg. 2013;89: 157–161. 10.4269/ajtmh.12-0635 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Ojuromi OT, Izquierdo F, Fenoy S, Fagbenro-Beyioku A, Oyibo W, Akanmu A, et al. Identification and characterization of microsporidia from fecal samples of HIV-positive patients from Lagos, Nigeria. PLoS One. 2012;7: e35239 10.1371/journal.pone.0035239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Ojuromi OT, Duan L, Izquierdo F, Fenoy SM, Oyibo WA, Del Aguila C, et al. Genotypes of Cryptosporidium spp. and Enterocytozoon bieneusi in human immunodeficiency virus-infected patients in Lagos, Nigeria. J Eukaryot Microbiol. 2016;63: 414–418. 10.1111/jeu.12285 [DOI] [PubMed] [Google Scholar]
  • 67.Chabchoub N, Abdelmalek R, Mellouli F, Kanoun F, Thellier M, Bouratbine A, et al. Genetic identification of intestinal microsporidia species in immunocompromised patients in Tunisia. Am J Trop Med Hyg. 2009;80: 24–27. [PubMed] [Google Scholar]
  • 68.Abdelmalek R, Anane S, Chabchoub N, Essid R, Aoun K, Chaabéne TB, et al. [Microsporidia and cryptosporidia coinfection in an HIV-infected newborn]. Arch Pediatr. 2011;18: 562–564. 10.1016/j.arcped.2011.02.016 [DOI] [PubMed] [Google Scholar]
  • 69.Anane S, Kaouech E, Belhadj S, Abdelmalek R, Ammari L, Ben Othman T, et al. [Identification of Enterocytozoon bieneusi by PCR in stools of Tunisian immunocompromised patients]. Pathol Biol. 2011;59: 234–239. 10.1016/j.patbio.2009.03.007 [DOI] [PubMed] [Google Scholar]
  • 70.Chabchoub N, Abdelmalek R, Issa S, Kanoun F, Ben Chaabene T, Bouratbine A, et al. Apport de la PCR dans la recherche et l’identification des microsporidies intestinales chez les sujets infectés par le VIH. Pathol Biol. 2012;60: 91–94. 10.1016/j.patbio.2009.07.034 [DOI] [PubMed] [Google Scholar]
  • 71.Chabchoub N, Abdelmalek R, Breton J, Kanoun F, Thellier M, Bouratbine A, et al. Genotype identification of Enterocytozoon bieneusi isolates from stool samples of HIV-infected Tunisian patients. Parasite. 2012;19: 147–151. 10.1051/parasite/2012192147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Aissa S, Chabchoub N, Abdelmalek R, Kanoun F, Goubantini A, Ammari L, et al. Asymptomatic intestinal carriage of microsporidia in HIV-positive patients in Tunisia: prevalence, species, and pathogenesis. Med Sante Trop. 2017;27: 281–285. 10.1684/mst.2017.0697 [DOI] [PubMed] [Google Scholar]
  • 73.Lucas SB, Papadaki L, Conlon C, Sewankambo N, Goodgame R, Serwadda D. Diagnosis of intestinal microsporidiosis in patients with AIDS. J Clin Pathol. 1989;42: 885–887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Hautvast JL, Tolboom JJ, Derks TJ, Beckers P, Sauerwein RW. Asymptomatic intestinal microsporidiosis in a human immunodeficiency virus-seronegative, immunocompetent Zambian child. Pediatr Infect Dis J. 1997;16: 415–416. 10.1097/00006454-199704000-00017 [DOI] [PubMed] [Google Scholar]
  • 75.van Gool T, Luderhoff E, Nathoo KJ, Kiire CF, Dankert J, Mason PR. High prevalence of Enterocytozoon bieneusi infections among HIV-positive individuals with persistent diarrhoea in Harare, Zimbabwe. Trans R Soc Trop Med Hyg. 1995;89: 478–480. 10.1016/0035-9203(95)90073-x [DOI] [PubMed] [Google Scholar]
  • 76.Carville A, Mansfield K, Widmer G, Lackner A, Kotler D, Wiest P, et al. Development and application of genetic probes for detection of Enterocytozoon bieneusi in formalin-fixed stools and in intestinal biopsy specimens from infected patients. Clin Diagn Lab Immunol. 1997;4: 405–408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Gumbo T, Sarbah S, Gangaidzo IT, Ortega Y, Sterling CR, Carville A, et al. Intestinal parasites in patients with diarrhea and human immunodeficiency virus infection in Zimbabwe. AIDS. 1999;13: 819–821. 10.1097/00002030-199905070-00011 [DOI] [PubMed] [Google Scholar]
  • 78.Gumbo T, Gangaidzo IT, Sarbah S, Carville A, Tzipori S, Wiest PM. Enterocytozoon bieneusi infection in patients without evidence of immunosuppression: two cases from Zimbabwe found to have positive stools by PCR. Ann Trop Med Parasitol. 2000;94: 699–702. 10.1080/00034983.2000.11813593 [DOI] [PubMed] [Google Scholar]
PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0008419.r001

Decision Letter 0

Todd B Reynolds, Thuy Le

13 Apr 2020

Dear Dr Carmena,

Thank you very much for submitting your manuscript "First identification of genotypes of Enterocytozoon bieneusi (Microsporidia) among symptomatic and asymptomatic children in Mozambique" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Thuy Le

Guest Editor

PLOS Neglected Tropical Diseases

Todd Reynolds

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: The manuscript by Salimo Muadica et al report on an extensive survey of Enterocytozoon bieneusi infection in children in Mozambique. These studies are difficult to conduct and the authors deserve credit for surveying a relatively large number of children.

Reviewer #2: (No Response)

Reviewer #3: -Are the objectives of the study clearly articulated with a clear testable hypothesis stated? YES

-Is the study design appropriate to address the stated objectives? YES

-Is the population clearly described and appropriate for the hypothesis being tested? YES

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested? YES

-Were correct statistical analysis used to support conclusions? YES

-Are there concerns about ethical or regulatory requirements being met? NO

"Comments to the Author":

In the epigraphs “Collection of stool samples in Zambézia province” and “Collection of stool samples in the Manhiça district, Maputo province”, in my opinion is confused the treatment and sample processing (lines 188-190 and lines 229-231, respectively). The authors could clarify or homogenize this step.

- Line 243: “DNA extraction”. Add: “and purification”.

--------------------

Results

-Does the analysis presented match the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: Perhaps the most important contribution of the study is the apparent absence of association between diarrhea and Eb.

Reviewer #2: (No Response)

Reviewer #3: -Does the analysis presented match the analysis plan? YES

-Are the results clearly and completely presented? YES

-Are the figures (Tables, Images) of sufficient quality for clarity? YES

"Comments to the Author":

- Line 328: “Overall, E. bieneusi was detected by PCR”. Add: nested.

- Table 1: Include in the table foot (legend), TEM (transmission electron microscopy).

- Table 3: Remove in table foot “NA: not applicable”, I think it is not used.

- S3 Table: Remove in table foot “NA: not applicable”, I think it is not used.

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: Given the size of the study, the small number of positives is worth reporting, but statements comparing the prevalence in the 2 study sites (line 328, 412) and between this and previously published reports (lines 414-425) may not be warranted unless supported by a statistical analysis. Similarly, the statement on line 333 about the absence of mixed infections seems problematic given the PCR and sequencing method used in this study; see for instance Widmer G, Dilo J, Tumwine JK, Tzipori S, Akiyoshi DE. Appl Environ Microbiol. 2013, Sep;79(17):5357-62.

Reviewer #2: (No Response)

Reviewer #3: -Are the conclusions supported by the data presented? YES

-Are the limitations of analysis clearly described? YES

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study? YES

-Is public health relevance addressed? YES

"Comments to the Author": (Discussion).

- Lines 455-461: Comment: The authors should cite or comment the importance of the water transmission of the parasite for a better knowledge of the transmission pathways in the context in which the study was carried out.

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: The manuscript is generally well written, but some additional editing seems warranted. See following examples:

Line 206-219. Consider reporting enrollment criteria as a numbered or bulleted list. Text using numerous parentheses and nested parentheses is difficult to follow.

Line 103. …capable of colonizing/infecting a broad spectrum…

Line 110. nearly 500 genotypes

Line 113. …mammalian species, including humans…

Line 126. …could be more frequent that anticipated. Despite the progress…

Line 156. delete “the” (…under reference number…)

Line 186. …seeking medical attention… (no “for” preposition)

Line 192. …children were between 3 and 14 years old.

Line 201. delete “continuous” (it’s implied in the sentence); something is missing after (HDDS), like program or survey?

Line 202. Start new sentence: This survey covers approximately…

Line 208. peripheral health facilities

Line 224. …were enrolled starting in April 2017.

Line 230. testing for enteric pathogens

Line 249. In Manhica, DNA was manually extracted and purified using the QIA….

etc.

Reviewer #2: (No Response)

Reviewer #3: "Comments to the Author":

Keywords:

- Add: novel genotype.

Abstract:

- Line 33: “Enterocytozoon bieneusi (Phylum Microsporidia)”. Comment: With the new classification of the Eukaryotes, in my opinion the Microsporidia (Fungi) is not a Phylum.

Reference: 1: Adl SM, Bass D, Lane CE, Lukeš J, Schoch CL, Smirnov A, Agatha S, Berney C,Brown MW, Burki F, Cárdenas P, Čepička I, Chistyakova L, Del Campo J, Dunthorn M,Edvardsen B, Eglit Y, Guillou L, Hampl V, Heiss AA, Hoppenrath M, James TY, Karnkowska A, Karpov S, Kim E, Kolisko M, Kudryavtsev A, Lahr DJG, Lara E, Le Gall L, Lynn DH, Mann DG, Massana R, Mitchell EAD, Morrow C, Park JS, Pawlowski JW, Powell MJ, Richter DJ, Rueckert S, Shadwick L, Shimano S, Spiegel FW, Torruella G, Youssef N, Zlatogursky V, Zhang Q. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. J Eukaryot Microbiol. 2019 Jan;66(1):4-119.

Introduction:

- Line 92: “Microsporidia comprises 200 genera and nearly 1,500 species of spore-forming parasites”. Add: “Microsporidia (Fungi) comprises 200 genera and nearly 1,500 species of spore-forming parasites”.

- Lines 95-96: “causing gastrointestinal infections globally”. Add: “and other disorders and pathologies such as in lung”.

Reference: “del Águila C, Lopez-Velez R, Fenoy S, Turrientes C, Cobo J, Navajas R, Visvesvara GS, Croppo GP, Da Silva AJ, Pieniazek NJ. Identification of Enterocytozoon bieneusi spores in respiratory samples from an AIDS patient with a 2-year history of intestinal microsporidiosis. J Clin Microbiol. 1997, Jul; 35(7): 1862-6”.

- Lines 105-107: “Infections are acquired through ingestion of food or water contaminated with E. bieneusi spores, or through direct contact with faeces of infected persons and animals”. Add: soils.

- Lines 118-120: “GEMS included in their study enteric protozoan parasites Giardia duodenalis, Cryptosporidium spp., and Entamoeba histolytica, but not E. bieneusi”. Comment: E. bieneusi is not a protozoa parasite. Add: enteric parasites, for example.

- Line 130: “asymptomatic paediatric populations”. Change for “pediatric”.

Materials and Methods:

In the epigraphs “Collection of stool samples in Zambézia province” and “Collection of stool samples in the Manhiça district, Maputo province”, in my opinion is confused the treatment and sample processing (lines 188-190 and lines 229-231, respectively). The authors could clarify or homogenize this step.

- Line 243: “DNA extraction”. Add: “and purification”.

Results:

- Line 328: “Overall, E. bieneusi was detected by PCR”. Add: nested.

Discussion:

- Lines 455-461: Comment: The authors should cite or comment the importance of the water transmission of the parasite for a better knowledge of the transmission pathways in the context in which the study was carried out.

Tables:

- Table 1: Include in the table foot (legend), TEM (transmission electron microscopy).

- Table 3: Remove in table foot “NA: not applicable”, I think it is not used.

- S3 Table: Remove in table foot “NA: not applicable”, I think it is not used.

References:

- Add: “Adl SM, Bass D, Lane CE, Lukeš J, Schoch CL, Smirnov A, Agatha S, Berney C,Brown MW, Burki F, Cárdenas P, Čepička I, Chistyakova L, Del Campo J, Dunthorn M,Edvardsen B, Eglit Y, Guillou L, Hampl V, Heiss AA, Hoppenrath M, James TY, Karnkowska A, Karpov S, Kim E, Kolisko M, Kudryavtsev A, Lahr DJG, Lara E, Le Gall L, Lynn DH, Mann DG, Massana R, Mitchell EAD, Morrow C, Park JS, Pawlowski JW, Powell MJ, Richter DJ, Rueckert S, Shadwick L, Shimano S, Spiegel FW, Torruella G, Youssef N, Zlatogursky V, Zhang Q. Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes. J Eukaryot Microbiol. 2019 Jan;66(1):4-119”.

- Add: “del Águila C, Lopez-Velez R, Fenoy S, Turrientes C, Cobo J, Navajas R, Visvesvara GS, Croppo GP, Da Silva AJ, Pieniazek NJ. Identification of Enterocytozoon bieneusi spores in respiratory samples from an AIDS patient with a 2-year history of intestinal microsporidiosis. J Clin Microbiol. 1997, Jul; 35(7): 1862-6”.

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The apparent absence of association between diarrhea and Eb is worth reporting. Some of the conclusions should be supported by statistical tests.

Reviewer #2: (No Response)

Reviewer #3: The main objective of the manuscript is very interesting with promising results. In my opinion would have been interesting to investigate the presence of other species of Microsporidia (for example Encephalitozoon spp) using others complementary techniques such as staining methods or immunological techniques.

Obviously, the authors want to study only the genotypes of E. bieneusi in children in Africa (Mozambique) as main objective. But these additional techniques (staining methods or immunological techniques) could contribute to knowledge of the prevalence of other species of Microsporidia and provide us of a valuable information for this study or for new studies in the future.

I enjoyed reviewing this article. It is extensive with detailed information with a complete review of the prevalence of E. bieneusi and its genotypes in Africa. The results are interesting highlighting the description of a novel genotype. I encourage the authors to continue investigating the circulation and prevalence of this novel genotype and those already described in Africa.

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Giovanni Widmer

Reviewer #2: No

Reviewer #3: Yes: Dr. Fernando Izquierdo Arias.

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to generate graphs, histograms etc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods

Attachment

Submitted filename: RewierComments_PNTD-D-20-00113.docx

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0008419.r003

Decision Letter 1

Todd B Reynolds, Thuy Le

23 May 2020

Dear Dr Carmena,

We are pleased to inform you that your manuscript 'First identification of genotypes of Enterocytozoon bieneusi (Microsporidia) among symptomatic and asymptomatic children in Mozambique' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press office or the journal office choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Thuy Le

Guest Editor

PLOS Neglected Tropical Diseases

Todd Reynolds

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

PLoS Negl Trop Dis. doi: 10.1371/journal.pntd.0008419.r004

Acceptance letter

Todd B Reynolds, Thuy Le

18 Jun 2020

Dear Dr Carmena,

We are delighted to inform you that your manuscript, "First identification of genotypes of Enterocytozoon bieneusi (Microsporidia) among symptomatic and asymptomatic children in Mozambique," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, etc...) are generated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Occurrence of Enterocytozoon bieneusi in humans in Africa.

    Average values for symptomatic and asymptomatic individuals are represented according to reported infection rates summarized in Table 1.

    (TIF)

    S1 Table. Main socio-demographic features and risk factors of the asymptomatic schoolchildren population (n = 807) investigated in Zambézia province (Mozambique), 2017‒2019.

    (DOCX)

    S2 Table. Main socio-demographic features and risk factors of the symptomatic schoolchildren population (n = 290) attended at public health centres in Zambézia province (Mozambique), 2017‒2018.

    (DOCX)

    S3 Table. Main socio-demographic features and risk factors of the asymptomatic children population (n = 109) investigated in Maputo province (Mozambique), 2016‒2018.

    (DOCX)

    S4 Table. Main socio-demographic features and risk factors of the symptomatic children population (n = 41) investigated in Maputo province (Mozambique), 2016–2018.

    (DOCX)

    S5 Table. Summary of all Enterocytozoon bieneusi genotypes reported in Africa including host and geographic range.

    Highlighted in bold are African countries.

    (DOCX)

    Attachment

    Submitted filename: RewierComments_PNTD-D-20-00113.docx

    Attachment

    Submitted filename: Letter to reviewers PNTD-D-20-00113.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS Neglected Tropical Diseases are provided here courtesy of PLOS

    RESOURCES