GlobalFungi, a global database of fungal occurrences from high-throughput-sequencing metabarcoding studies

Tomáš Větrovský; Daniel Morais; Petr Kohout; Clémentine Lepinay; Camelia Algora; Sandra Awokunle Hollá; Barbara Doreen Bahnmann; Květa Bílohnědá; Vendula Brabcová; Federica D’Alò; Zander Rainier Human; Mayuko Jomura; Miroslav Kolařík; Jana Kvasničková; Salvador Lladó; Rubén López-Mondéjar; Tijana Martinović; Tereza Mašínová; Lenka Meszárošová; Lenka Michalčíková; Tereza Michalová; Sunil Mundra; Diana Navrátilová; Iñaki Odriozola; Sarah Piché-Choquette; Martina Štursová; Karel Švec; Vojtěch Tláskal; Michaela Urbanová; Lukáš Vlk; Jana Voříšková; Lucia Žifčáková; Petr Baldrian

doi:10.1038/s41597-020-0567-7

. 2020 Jul 13;7:228. doi: 10.1038/s41597-020-0567-7

GlobalFungi, a global database of fungal occurrences from high-throughput-sequencing metabarcoding studies

Tomáš Větrovský ^1,^#, Daniel Morais ^1,^#, Petr Kohout ^1,^#, Clémentine Lepinay ^1,^#, Camelia Algora ¹, Sandra Awokunle Hollá ¹, Barbara Doreen Bahnmann ¹, Květa Bílohnědá ¹, Vendula Brabcová ¹, Federica D’Alò ², Zander Rainier Human ¹, Mayuko Jomura ³, Miroslav Kolařík ¹, Jana Kvasničková ¹, Salvador Lladó ¹, Rubén López-Mondéjar ¹, Tijana Martinović ¹, Tereza Mašínová ¹, Lenka Meszárošová ¹, Lenka Michalčíková ¹, Tereza Michalová ¹, Sunil Mundra ^4,⁵, Diana Navrátilová ¹, Iñaki Odriozola ¹, Sarah Piché-Choquette ¹, Martina Štursová ¹, Karel Švec ¹, Vojtěch Tláskal ¹, Michaela Urbanová ¹, Lukáš Vlk ¹, Jana Voříšková ¹, Lucia Žifčáková ¹, Petr Baldrian ^1,^✉

PMCID: PMC7359306 PMID: 32661237

Abstract

Fungi are key players in vital ecosystem services, spanning carbon cycling, decomposition, symbiotic associations with cultivated and wild plants and pathogenicity. The high importance of fungi in ecosystem processes contrasts with the incompleteness of our understanding of the patterns of fungal biogeography and the environmental factors that drive those patterns. To reduce this gap of knowledge, we collected and validated data published on the composition of soil fungal communities in terrestrial environments including soil and plant-associated habitats and made them publicly accessible through a user interface at https://globalfungi.com. The GlobalFungi database contains over 600 million observations of fungal sequences across > 17 000 samples with geographical locations and additional metadata contained in 178 original studies with millions of unique nucleotide sequences (sequence variants) of the fungal internal transcribed spacers (ITS) 1 and 2 representing fungal species and genera. The study represents the most comprehensive atlas of global fungal distribution, and it is framed in such a way that third-party data addition is possible.

Subject terms: Fungal ecology, Biogeography

Measurement(s)	internal_transcribed_spacer_region
Technology Type(s)	digital curation
Factor Type(s)	geographic location • sample type • biome • sampling year
Sample Characteristic - Organism	Fungi
Sample Characteristic - Environment	terrestrial biome

Open in a new tab

Machine-accessible metadata file describing the reported data: 10.6084/m9.figshare.12481946

Background & Summary

Fungi play fundamental roles in the ecosystem processes across all terrestrial biomes. As plant symbionts, pathogens or major decomposers of organic matter they substantially influence plant primary production, carbon mineralization and sequestration, and act as crucial regulators of the soil carbon balance^1,2. The activities of fungal communities contribute to the production of clean water, food, and air and the suppression of disease-causing soil organisms. Soil fungal biodiversity is thus increasingly recognized to provide services critical to food safety and human health³.

It is of high importance to determine how environmental factors affect the diversity and distribution of fungal communities. So far, only a few studies have focused on fungal distribution and diversity on global scale^4–6. Importantly, these single survey studies focused either on a limited number of biomes^4,5, fairly narrow groups within the fungal kingdom⁶, or were restricted only to fungi inhabiting soil. Although individual studies have the advantage of standardized methodology across their whole dataset, their limitation is in the limited sampling efforts in space and time that do not allow general conclusions on distribution of fungal taxa. On the other hand, since the advent of high-throughput-sequencing methods, large amounts of sequencing data on fungi from terrestrial environments accumulated along with metadata across numerous studies and allow interesting analyses when combined⁷. As an example of this approach, the meta-analysis of 36 papers made it possible to map global diversity of soil fungi collected in >3000 samples and indicated that climate is an important factor for the global distribution of soil fungi⁸. This approach clearly demonstrated the utility of a meta-study approach to address fungal biogeography, ecology and diversity. In addition, the compilation of these data demonstrated the fact that symbiotic mycorrhizal fungi that aid cultivated and wild plants to access nutrients, are more likely to be affected by rapid changes of climate than other guilds of fungi, including plant pathogens⁸ and helped to identify which fungi tend to follow alien plants invading new environments⁹.

Here, we have undertaken a comprehensive collection and validation of data published on the composition of fungal communities in terrestrial environments including soil and plant-associated habitats. This approach enabled us to construct the GlobalFungi database containing, on March 16, 2020, over 110 million unique sequence variants¹⁰ (i.e., unique nucleotide sequences) of the fungal nuclear ribosomal internal transcribed spacers (ITS) 1 and 2, covering > 17 000 samples contained in 178 original studies (Fig. 1). The ITS region has been used as molecular marker because it is a universal barcode for fungi¹¹.The dataset of sequence variant frequencies across samples, accompanied by metadata retrieved from published papers and in global climate databases is made publicly available at https://globalfungi.com. To achieve the goal to make published data findable, accessible, interoperable and reusable, the user interface at the above address allows the users to search for individual sequences, fungal species hypotheses¹², species or genera, to get a visual representation of their distribution in the environment and to access and download sequence data and metadata. In addition, the user interface also allows authors to submit data from studies not yet covered and in this way to help to build the resource for the community of researchers in systematics, biogeography, and ecology of fungi.

Fig. 1 — Map of locations of samples contained in the GlobalFungi database. Each point represents one or several samples where fungal community composition was reported using high-throughput-sequencing methods targeting the ITS1 or ITS2 marker of fungi. The map was created using the ‘leaflet’ package that uses an open-source JavaScript library for mobile-friendly interactive maps (Leaflet 1.6.0, GNU General Public License).

Methods

Data selection

We explored papers fitting with a main criterion, i.e., high-throughput sequencing for the analysis of fungal communities thanks to the ITS region, and that were published up to the beginning of 2019; in total, we explored 843 papers. The following selection criteria were used for the inclusion of samples (and, consequently, studies) into the dataset: (1) samples came from terrestrial biomes of soil, dead or live plant material (e.g., soil, litter, rhizosphere soil, topsoil, lichen, deadwood, root, and shoot) and were not subject to experimental treatment that artificially modifies the fungal community composition (e.g., temperature or nitrogen increase experiment, greenhouse controlled experiment were excluded); (2) the precise geographic location of each sample was recorded and released using GPS coordinates; (3) the whole fungal community was subject to amplicon sequencing (studies using group-specific primers were excluded); (4) the internal transcribed spacer regions (ITS1, ITS2, or both) were subject to amplification; (5) sequencing data (either in fasta with phred scores reported or fastq format) were publicly available or provided by the authors of the study upon request, and the sequences were unambiguously assigned to samples; (6) the samples could be assigned to biomes according to the Environment Ontology (http://www.ontobee.org/ontology/ENVO)⁸. In total, 178 publications contained samples that matched our criteria.

Processing of sequencing data

For the processing of data, see Fig. 2 and Code Availability section. Raw datasets from 178 studies, covering 17 242 individual samples were quality filtered by removing all sequences with the mean quality phred scores below 20. Each sequence was labelled using the combination of a sample ID and sequence ID, and the full ITS1 or ITS2 fungal region was extracted using Perl script ITSx v1.0.11¹³. ITS extraction resulted in a total of 416 291 533 full ITS1 and 231 278 756 full ITS2 sequences. The extracted ITS sequences were classified according to the representative sequence of the closest UNITE species hypothesis (SH) using BLASTn¹⁴, using the SH created considering a 98.5% similarity threshold (BLASTDBv5, general release 8.1 from 2.2.2019¹²). A sequence was classified to the best best hit SH only when the following thresholds were met: e-value < 10e⁻⁵⁰, sequence similarity > = 98.5%. All representative sequences annotated as nonfungal were discarded. All representative sequences classified to any fungal SH and all unclassified sequences were used to build database library of unique nucleotide sequences (sequence variants). The number of sequence variants accessible through the database is 113 423 871.

Sample metadata

Sample metadata were collected from the published papers and/or public repositories where they were submitted by the authors. In some cases, metadata were obtained from the authors of individual studies upon request. The samples were assigned to continents, countries, and specific locations when available, and all sites were categorized into biomes following the classification of Environment Ontology to a maximum achievable depth for each sample. The complete list of metadata included in the database is presented in Table 1.

Table 1.

List of metadata contained in the GlobalFungi database.

Metadata identifier	Unit	Description of content	Source
Sample ID		unique identifier	generated
Longitude	degrees	Geographical longitude	original paper
Latitude	degrees	Geographical latitude	original paper
Continent		One of the following: Africa/Antarctica/Asia/Australia/Europe/North America/South America	original paper
Sample type		One of the following: soil/rhizosphere soil/litter/litter + humus/deadwood/lichen/shoot/root	original paper
Biome		One of the following: forest biome/woodland biome/shrubland biome/grassland biome/desert biome/tundra biome/mangrove biome/anthropogenic terrestrial biome/marine biome/freshwater biome/polar desert biome	original paper
Sampling year		Year of sample collection	original paper
Primers		Primers used	original paper
pH		pH	original paper
ITS total		Number of full ITS sequences extracted	generated
MAT (°C)	°C	Mean annual temperature from CHELSA database	CHELSA
MAP (mm)	mm	Mean annual precipitation from CHELSA database	CHELSA

Open in a new tab

The table lists identifiers, units and sources of metadata contained in the database with the description of their content. The data source “original paper” may also represent additional metadata provided by the authors of the paper.

In addition to the metadata provided by the authors of each study, we also extracted bioclimatic variables from the global CHELSA¹⁵ and WorldClim 2¹⁶ databases for each sample based on its GPS location. Since the results based on CHELSA and WorldClim 2 were comparable, we decided to include those from CHELSA, because precipitation patterns are better captured in the CHELSA dataset, in particular for mountain sites¹⁵.

For each sequence variant that was classified to SH, fungal species name and genus name was retrieved from the UNITE database¹², when available.

Data Records

The raw sequencing reads used to create the database are available at different locations (see Table 2).

Table 2.

List of identifiers and source database of the raw sequencing datasets used.

Database	Accession Identifiers (in superscripts, respectively: dataset reference, study reference(s))
National Center for Biotechnology Information Sequence Read Archive	SRP001058^19,20 SRP001175^21,22, SRP006078^23,24, SRP012868^25,26, SRP013695^27,28, SRP013944^29,30, SRP015735^31,32, SRP016090^33,34, SRP026207^35,36, SRP028404^37,38, SRP033719^39,40, SRP035356^41,42, SRP040314^43,44, SRP040786^45,46, SRP041347^47,48, SRP043106^49,50, SRP043706^4,51–53, SRP043982^54,55, SRP044665^56,57, SRP045166^58,59, SRP045587^60,61, SRP045746^62,63, SRP045933^64,65, SRP046049^66,67, SRP048036^68–70, SRP048856^71,72, SRP049544^73,74, SRP051033^75,76, SRP052222^77,78, SRP052716^79,80, SRP055957^81,82, SRP057433^83,84, SRP057541^85,86, SRP058508^87,88, SRP058555^89,90, SRP058851^91,92, SRP059280^93,94, SRP060838^95,96, SRP061179^97,98, SRP061305^99,100, SRP061904^101,102, SRP062647^103,104, SRP063711^105,106, SRP064158^107,108, SRP065817^109,110, SRP066030^111,112, SRP066284^113,114, SRP066331^115,116, SRP067301^117,118, SRP067367^119,120, SRP068514^121,122, SRP068608^123,124, SRP068620^125,126, SRP068654^127,128, SRP069065^129,130, SRP069742^131,132, SRP070568^133,134, SRP073070^135,136, SRP073265^137,138, SRP074055^139,140, SRP074496^141,142, SRP075989^143,144, SRP079403^145,146, SRP079521^147,148, SRP080210^149,150, SRP080428^151,152, SRP080680^153,154, SRP082472^155,156, SRP082976^157,158, SRP083394^159,160, SRP083434^160,161, SRP083901^162,163, SRP087715^164,165, SRP090261^166,167, SRP090335^168,169, SRP090490^170,171, SRP090651^172,173, SRP091741^174,175, SRP091855^176,177, SRP091867^178,179, SRP092609^180,181, SRP092777^182,183, SRP093592^184,185, SRP093928^186,187, SRP094708^188–190, SRP097883^191,192, SRP101553^193,194, SRP101605^195,196, SRP102378^197,198, SRP102417^199,200, SRP102775^201,202, SRP106137^203,204, SRP106774^205,206, SRP107174^207,208, SRP107743^209,210, SRP109164^211,212, SRP109773^213,214, SRP110522^215,216, SRP110810^217,218, SRP113348^219,220, SRP114697^221,222, SRP114821^223,224, SRP115350^225,226, SRP115464^227,228, SRP115599^229,230, SRP117302^231,232, SRP118875^233,234, SRP118960^235,236, SRP119174^237,238, SRP125864^239,240, SRP132277^241,242, SRP132591^243,244, SRP132598^244,245, SRP136886^246,247, SRP139483^248,249, SRP142723^250,251, SRP148813^252,253, SRP150527^254,255, SRP151262^256,257, SRP153934^258,259, SRP160913^260,261, SRP161632^262,263, SRP195764^264,265
European Nucleotide Archive Sequence Read Archive	ERP001713^266,267, ERP003251^268,269, ERP003790^270,271, ERP005177^272,273, ERP005905^274,275, ERP009341^276,277, ERP010027^278,279, ERP010084^280,281, ERP010743^282,283, ERP011924^284,285, ERP012017^286,287, ERP013208^288,289, ERP013987^290,291, ERP014227^292,293, ERP017480^294,295, ERP017851^296,297, ERP017915^298,299, ERP019580^300,301, ERP019924^302,303, ERP020657^304,305, ERP022511^306,307, ERP022742^308,309, ERP023275^310,311, ERP023718^312,313, ERP023855^314,315, ERP106131^316,317, ERP107634^318,319, ERP107636^319,320, ERP110188^321,322, ERP112007^323,324
DNA Data Bank of Japan	DRA000926^325,326, DRA000937^327,328, DRA001737^329,330, DRA002424^331,332, DRA002469^333,334, DRA003024^335,336, DRA003730^337,338, DRA004913^339,340, DRA006519^341,342, DRP002783^343,344, DRP003138^345,346, DRP005365^347,348
Dryad Digital Repository	10.5061/dryad.2fc32^349,350, 10.5061/dryad.n82g9^351,352, 10.5061/dryad.2343k^353,354, 10.5061/dryad.gp302^355,356, 10.5061/dryad.cq2rb^357,358, 10.5061/dryad.8fn8j^359,360, 10.5061/dryad.216tp^361,362
GenBank	KAYV00000000.1^363,364, KAYU00000000.1^364,365, KAYT00000000.1^364,366, SAMN02934078^367,368, SAMN02934079^368,369
Australian Antarctic Data Center database	10.4225/15/526f42ada05b1^370,371
Supplemental Data	Hartmann et al. (2012)^{Supplementary_Data2,}³⁷², Rime et al. (2016)^{Fungi_SeqsID,}³⁷³

Open in a new tab

The database contains two data types: sequence variants (individual nucleotide sequences) and samples. For each sequence variant, the following information is stored: sequence variant code, identification of samples where sequence variant occurs and the number of observations, the SH of best hit (when available), fungal species name (when available), fungal genus name (when available). For each sample, metadata information is stored (Table 1). Sequence data and metadata are accessible at Figshare¹⁷ (GlobalFungi_ITS_variants.zip, GlobalFungi_metadata.xlsx). All database content is accessible using a public graphical user interface at https://globalfungi.com.

Technical Validation

The technical validation included the screening of the data sources, sequencing data and data reliability. Regarding the data source screening, the data sources (published papers) were screened to fulfil the criteria outlined in the Methods section. The dataset was thoroughly checked for duplicates, and for all records that appeared in multiple publications, only the first original publication of the dataset was considered as a data source. Considering sequence quality, we have only utilized those primer pairs that are generally accepted to target general fungi (see Online-Only Table 1)^7,18. Sequences were quality filtered by removing all sequences with the mean quality phred scores below 20 and sequences that did not represent complete ITS1 or ITS2 after extraction or those that were identified as chimeric by the ITS extraction software¹³ were removed. All representative sequences where the BLASTn search against the UNITE database¹² resulted in a nonfungal organism, were discarded.

Online-only Table 1.

List of primer pairs to amplify general fungal communities in the samples included in this Data Descriptor^7,17.

Primer pair	Sequence
1737F / 2043 R	GGAAGTAAAAGTCGTAACAAGG / GCTGCGTTCTTCATCGATGC
18S-F / 5.3S-R	GTAAAAGTCGTAACAAGGTTTC / GTTCAAAGAYTCGATGATTCAC
58A2F / ITS4	ATCGATGAAGAACGCAG / TCCTCCGCTTATTGATATGC
fITS7 / ITS4	GTGARTCATCGAATCTTTG / TCCTCCGCTTATTGATATGC
fITS9 / ITS4	GAACACAGCGAAATGTGA / TCCTCCGCTTATTGATATGC
gITS7 / ITS4	GTGARTCATCGARTCTTTG / TCCTCCGCTTATTGATATGC
gITS7 / ITS4ngs	GTGARTCATCGARTCTTTG / TTCCTSCGCTTATTGATATGC
ITS1 / ITS2	TCCGTAGGTGAACCTGCGG / GCTGCGTTCTTCATCGATGC
ITS1 / ITS4	TCCGTAGGTGAACCTGCGG / TCCTCCGCTTATTGATATGC
ITS1F / 58A2R	CTTGGTCATTTAGAGGAAGTAA / CTGCGTTCTTCATCGAT
ITS1F / gITS7	CTTGGTCATTTAGAGGAAGTAA / GTGARTCATCGARTCTTTG
ITS1F / ITS2	CTTGGTCATTTAGAGGAAGTAA / GCTGCGTTCTTCATCGATGC
ITS1F / ITS3R	CTTGGTCATTTAGAGGAAGTAA / TCCTCCGCTTATTGATATGC
ITS1F / ITS4	CTTGGTCATTTAGAGGAAGTAA / TCCTCCGCTTATTGATATGC
ITS1F_KYO1 / ITS2_KYO1	CTHGGTCATTTAGAGGAASTAA / CTRYGTTCTTCATCGDT
ITS1F_KYO1 / ITS2_KYO2	CTHGGTCATTTAGAGGAASTAA / TTYRCTRCGTTCTTCATC
ITS1F_KYO2 / ITS2_KYO2	TAGAGGAAGTAAAAGTCGTAA / TTYRCTRCGTTCTTCATC
ITS1F_KYO2 / LR3	TAGAGGAAGTAAAAGTCGTAA / CCGTGTTTCAAGACGGG
ITS1FI2 / 5.8 S	GAACCWGCGGARGGATCA / CGCTGCGTTCTTCATCG
ITS1FI2 / ITS2	GAACCWGCGGARGGATCA / GCTGCGTTCTTCATCGATGC
ITS1Fngs / ITS2	GGTCATTTAGAGGAAGTAA / GCTGCGTTCTTCATCGATGC
ITS1ngs / ITS2	TCCGTAGGTGAACCTGC / GCTGCGTTCTTCATCGATGC
ITS1-OF / ITS4	AACT(C)GG(C)CATTTAGAGGAAGT / TCCTCCGCTTATTGATATGC
ITS2 / ITS4	GCTGCGTTCTTCATCGATGC / TCCTCCGCTTATTGATATGC
ITS2 / ITS5	GCTGCGTTCTTCATCGATGC / GGAAGTAAAAGTCGTAACAAGG
ITS2F / ITS2R	GCATCGATGAAGAACGC / CCTCCGCTTATTGATATGC
ITS3 / ITS4	GCATCGATGAAGAACGCAGC / TCCTCCGCTTATTGATATGC
ITS3_KYO2 / ITS4	GATGAAGAACGYAGYRAA / TCCTCCGCTTATTGATATGC
ITS3_KYO2 / ITS4F	GATGAAGAACGYAGYRAA / CGCTTATTRATATGCTTAAXGXT
ITS3_KYO2 / LR_KYO1b	GATGAAGAACGYAGYRAA / MGCWGCATTCCCAAACWA
ITS3ngs mix / ITS4ngr mix + ARCH-ITS4-F1	CA(T)CGATGAAGAACG(C)(A)G / TCCT(S)(C)(G)CTTATTGATATGC
ITS3ngs1 to ITS3ngs11 / ITS4ngs	(C)(A)(T)CGATGAAGA(A)CG(C)(A)G / TCCTSCGCTTATTGATATGC
ITS3tagmix1 to ITS3tagmix5 / ITS4ngs	CTAGACTCGTCA(T)CGATGAAGAACG(CA)G / TTCCTSCGCTTATTGATATGC
ITS4 / fITS9	TCCTCCGCTTATTGATATGC / GAACACAGCGAAATGTGA
ITS4 / ITS3_KYO2	TCCTCCGCTTATTGATATGC / GATGAAGAACGYAGYRAA
ITS4 / ITS5	TCCTCCGCTTATTGATATGC / GGAAGTAAAAGTCGTAACAAGG
ITS4 / ITS9	TCCTCCGCTTATTGATATGC / GCATTAGAAACTGCTCGTAATG
ITS5 / 5.8S_fungi	GGAAGTAAAAGTCGTAACAAGG / CAAGAGATCCGTTGTTGAAAGTT
ITS5 / ITS2	GGAAGTAAAAGTCGTAACAAGG / GCTGCGTTCTTCATCGATGC
ITS5 / ITS2_KYO2	GGAAGTAAAAGTCGTAACAAGG / TTYRCTRCGTTCTTCATC
ITS5 / ITS4	GGAAGTAAAAGTCGTAACAAGG / TCCTCCGCTTATTGATATGC
ITS7o / ITS4	GTGAATCATCRAATYTTTG / TCCTCCGCTTATTGATATGC
ITS86F / ITS4	GTGAATCATCGAATCTTTGAA / TCCTCCGCTTATTGATATGC
ITS9 / ITS4	GCATTAGAAACTGCTCGTAATG / TCCTCCGCTTATTGATATGC
ITS9F / ITS4	CCATCTCATCCCTGCGTGTCTCCGACTCAG / TCCTCCGCTTATTGATATGC

Open in a new tab

For data reliability, the geographic location represented by the GPS coordinates was validated first. For each sample set, the geographic location of the sample described in the text of the study was confronted with the location on the map. For those samples where disagreement was recorded (e.g., terrestrial samples positioned in the ocean or located in another region than described in the text), the authors of each study were asked for correction. Studies or samples that could not be reconciled in this way were excluded from the database. The quality of sample metadata was checked and if they were outside the acceptable range (such as content of elements or organic matter > 100%), these invalid metadata were removed.

Usage Notes

The user interface at https://globalfungi.com enables the users to access the database in several ways (Fig. 3). In the taxon search, it is possible to search for genera or species of fungi or for the 98.5% SH species hypotheses of UNITE, contained in the general release 8.1 from 2.2.2019. The search results open the options to download the corresponding SH or the corresponding sequence variants. It is also possible to view a breakdown of samples by type, biome, mean annual temperature, mean annual precipitation, pH, and continents. The results also contain an interactive map of the taxon distribution with relative abundances of sequences of the taxon across samples and a list of samples with metadata. Several modes of filtering of results are available as well.

In the sequence search, it is possible to search for multiple nucleotide sequences by choosing if the result will be the exact match or a BLAST result. The BLAST option gives the possibility to retrieve the sequence variant best hit in the database, or, when only one sequence is submitted, it is possible to display multiple ranked high score hits among the sequence variants.

It is also possible to open individual studies and access their content. Finally, in the Geosearch, users can select a group of samples on the map, with a range of tools, and retrieve data for these samples (such as the FASTA file with all occurring sequence variants).

Importantly, the database is intended to grow, both by the continuing activity of the authors and by using the help of the scientific community. For that, the “Submit your study” section of the web interface enabling the submission of studies not yet represented is available to users. The submission tool guides the submitting person through the steps where details about the publication, samples, sample metadata and sequences are sequentially submitted. The submitted data will be used to update the database twice a year after processing and validation by the authors. Thus, users submitting their data, besides a precious contribution to mycological progress, will benefit from making their data accessible to the international scientific community in an easily accessible form and increasing the visibility of their results. Users can also maximize their visibility by approving to add their name and affiliation to the online list of collaborators and/or to the GlobalFungi Group Author’ list that will be mentioned in future publications describing the database content, its development, or metastudies using the whole database.

Among the possible uses of the GlobalFungi Database, fungal ecologists will be able to link fungal diversity data with the panel of collected metadata, which should allow them to determine the environmental factors driving the fungal diversity. This kind of study can be done at different geographic levels, from country scale up to the entire world, and for all the fungal communities or by focusing on some ecosystem compartments. This should lead to a better understanding of the biogeography of the fungal diversity. Větrovský et al.⁸ brought interesting findings by doing this for soil fungal communities at the scale of the globe. The evolutionary biologists could study, for example, the effect of global change on the fungal diversity by comparing the natural versus anthropogenic biomes. In addition to focus on the fungal diversity, some studies could trigger specific fungi. Thus, mycologists could determine the biogeography of one specific fungal species. They could also determine the composition of the fungal communities associated with the focused species and detect some potential recurrent fungal associations. The GlobalFungi Database could also speed up the progress in fungal taxonomy by highlighting the existence of a high number of fungal sequences not currently assigned to species along with environmental metadata promoting thus the interest in their description.

Acknowledgements

We acknowledge funding from the Czech Science Foundation Grant No 18–26191S. ELIXIR CZ research infrastructure project LM2015047 by the Ministry of Education, Youth and Sports of the Czech Republic is acknowledged for hosting the database. All corresponding authors of published studies that provided additional information on the samples included in the database are gratefully acknowledged.

Online-only Table

Author contributions

T.V., P.K. and P.B. jointly conceived the study. C.L. and coordinated data acquisition, T.V., D.M., M.K. and P.B. designed the database, T.V. and D.M. developed the database and created the user interface. C.A.G., S.A.H., B.D.B., K.B., V.B., F.D., R.Z.H., M.J., J.K., C.L., S.L., R.L.M., T. Mar., T. Maš., L. Me., L. Mi., T. Mi., S.M., D.N., I.O., S.P.C., M.Š., K.Š., V.T., M.U., L.V., J.V. and L.Ž. identified data sources, processed and analysed sequencing information, collated and analysed metadata. P.B. drafted the manuscript along with T.V., C.L. and P.K. All authors wrote and reviewed the manuscript.

Code availability

The workflow included several custom made python scripts (labelled by star in the Fig. 2) which are accessible here: https://github.com/VetrovskyTomas/GlobalFungi.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Tomáš Větrovský, Daniel Morais, Petr Kohout, Clémentine Lepinay.

References

1.Crowther TW, et al. Quantifying global soil carbon losses in response to warming. Nature. 2016;540:104–108. doi: 10.1038/nature20150. [DOI] [PubMed] [Google Scholar]
2.Peay KG, Kennedy PG, Talbot JM. Dimensions of biodiversity in the Earth mycobiome. Nature Rev. Microbiol. 2016;14:434–447. doi: 10.1038/nrmicro.2016.59. [DOI] [PubMed] [Google Scholar]
3.Wall DH, Nielsen UN, Six J. Soil biodiversity and human health. Nature. 2015;528:69–76. doi: 10.1038/nature15744. [DOI] [PubMed] [Google Scholar]
4.Tedersoo L, et al. Global diversity and geography of soil fungi. Science. 2014;346:1256688. doi: 10.1126/science.1256688. [DOI] [PubMed] [Google Scholar]
5.Bahram M, et al. Structure and function of the global topsoil microbiome. Nature. 2018;560:233–237. doi: 10.1038/s41586-018-0386-6. [DOI] [PubMed] [Google Scholar]
6.Egidi E, et al. A few Ascomycota taxa dominate soil fungal communities worldwide. Nature Commun. 2019;10:2369. doi: 10.1038/s41467-019-10373-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Nilsson RH, et al. Mycobiome diversity: high-throughput sequencing and identification of fungi. Nature Rev. Microbiol. 2019;17:95–109. doi: 10.1038/s41579-018-0116-y. [DOI] [PubMed] [Google Scholar]
8.Větrovský T, et al. A meta-analysis of global fungal distribution reveals climate-driven patterns. Nature Commun. 2019;10:5142. doi: 10.1038/s41467-019-13164-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Vlk, L. et al. Early successional ectomycorrhizal fungi are more likely to naturalize outside their native range than other ectomycorrhizal fungi. New Phytol., 10.1111/nph.16557 (2020). [DOI] [PubMed]
10.Thompson LR, et al. A communal catalogue reveals Earth’s multiscale microbial diversity. Nature. 2017;551:457–463. doi: 10.1038/nature24621. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Schoch CL, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA. 2012;109:6241–6246. doi: 10.1073/pnas.1117018109. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Nilsson RH, et al. The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019;47:D259–D264. doi: 10.1093/nar/gky1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Bengtsson-Palme J, et al. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Meth. Ecol. Evol. 2013;4:914–919. [Google Scholar]
14.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
15.Karger DN, et al. Data Descriptor: Climatologies at high resolution for the earth’s land surface areas. Scientific Data. 2017;4:170122. doi: 10.1038/sdata.2017.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Fick SE, Hijmans RJ. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 2017;37:4302–4315. [Google Scholar]
17.Baldrian P, 2020. GlobalFungi: Global database of fungal records from high-throughput-sequencing metabarcoding studies. figshare. [DOI] [PMC free article] [PubMed]
18.Anslan S, et al. Great differences in performance and outcome of high-throughput sequencing data analysis platforms for fungal metabarcoding. Mycokeys. 2018;39:29–40. doi: 10.3897/mycokeys.39.28109. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.2010. NCBI Sequence Read Archive. SRP001058
20.Jumpponen A, Jones KL. Seasonally dynamic fungal communities in the Quercus macrocarpa phyllosphere differ between urban and nonurban environments. New Phytol. 2010;186:496–513. doi: 10.1111/j.1469-8137.2010.03197.x. [DOI] [PubMed] [Google Scholar]
21.2010. NCBI Sequence Read Archive. SRP001175
22.Jumpponen A, Jones KL, Mattox JD, Yaege C. Massively parallel 454-sequencing of fungal communities in Quercus spp ectomycorrhizas indicates seasonal dynamics in urban and rural sites. Mol. Ecol. 2010;19:41–53. doi: 10.1111/j.1365-294X.2009.04483.x. [DOI] [PubMed] [Google Scholar]
23.2011. NCBI Sequence Read Archive. SRP006078
24.Mello A, et al. ITS-1 versus ITS-2 pyrosequencing: a comparison of fungal populations in truffle grounds. Mycologia. 2011;103:1184–1193. doi: 10.3852/11-027. [DOI] [PubMed] [Google Scholar]
25.2012. NCBI Sequence Read Archive. SRP012868
26.Ihrmark K, et al. New primers to amplify the fungal ITS2 region - evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol. Ecol. 2012;82:666–677. doi: 10.1111/j.1574-6941.2012.01437.x. [DOI] [PubMed] [Google Scholar]
27.2012. NCBI Sequence Read Archive. SRP013695
28.Zimmerman NB, Vitousek PM. Fungal endophyte communities reflect environmental structuring across a Hawaiian landscape. Proc. Natl. Acad. Sci. USA. 2012;109:13022–13027. doi: 10.1073/pnas.1209872109. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.2016. NCBI Sequence Read Archive. SRP013944
30.Uroz S, et al. Specific impacts of beech and Norway spruce on the structure and diversity of the rhizosphere and soil microbial communities. Sci. Rep. 2016;6:27756. doi: 10.1038/srep27756. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.2015. NCBI Sequence Read Archive. SRP015735
32.Gao C, et al. Community assembly of ectomycorrhizal fungi along a subtropical secondary forest succession. New Phytol. 2015;205:771–785. doi: 10.1111/nph.13068. [DOI] [PubMed] [Google Scholar]
33.2015. NCBI Sequence Read Archive. SRP016090
34.Clemmensen KE, et al. Carbon sequestration is related to mycorrhizal fungal community shifts during long-term succession in boreal forests. New Phytol. 2015;205:1525–1536. doi: 10.1111/nph.13208. [DOI] [PubMed] [Google Scholar]
35.2014. NCBI Sequence Read Archive. SRP026207
36.De Beeck MO, et al. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies. PLoS One. 2014;9:e97629. doi: 10.1371/journal.pone.0097629. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.2015. NCBI Sequence Read Archive. SRP028404
38.De Beeck MO, et al. Impact of metal pollution on fungal diversity and community structures. Environ. Microbiol. 2015;17:2035–2047. doi: 10.1111/1462-2920.12547. [DOI] [PubMed] [Google Scholar]
39.2015. NCBI Sequence Read Archive. SRP033719
40.Chaput DL, Hansel CM, Burgos WD, Santelli CM. Profiling microbial communities in manganese remediation systems treating coal mine drainage. Appl. Environ. Microbiol. 2015;81:2189–2198. doi: 10.1128/AEM.03643-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.2015. NCBI Sequence Read Archive. SRP035356
42.Sterkenburg E, Bahr A, Brandström Durling M, Clemmensen KE, Lindahl BD. Changes in fungal communities along a boreal forest soil fertility gradient. New Phytol. 2015;207:1145–1158. doi: 10.1111/nph.13426. [DOI] [PubMed] [Google Scholar]
43.2014. NCBI Sequence Read Archive. SRP040314
44.Talbot JM, et al. Endemism and functional convergence across the North American soil mycobiome. Proc. Natl. Acad. Sci. USA. 2014;111:6341–6346. doi: 10.1073/pnas.1402584111. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.2015. NCBI Sequence Read Archive. SRP040786
46.Saravesi K, et al. Moth outbreaks alter root-associated fungal communities in subarctic mountain birch forests. Microb. Ecol. 2015;69:788–797. doi: 10.1007/s00248-015-0577-8. [DOI] [PubMed] [Google Scholar]
47.2015. NCBI Sequence Read Archive. SRP041347
48.Liu J, et al. Soil carbon content drives the biogeographical distribution of fungal communities in the black soil zone of northeast China. Soil Biol. Biochem. 2015;83:29–39. [Google Scholar]
49.2015. NCBI Sequence Read Archive. SRP043106
50.Hoppe B, et al. Linking molecular deadwood-inhabiting fungal diversity and community dynamics to ecosystem functions and processes in Central European forests. Fungal Divers. 2015;77:367–379. [Google Scholar]
51.2017. NCBI Sequence Read Archive. SRP043706
52.Hiiesalu I, Bahram M, Tedersoo L. Plant species richness and productivity determine the diversity of soil fungal guilds in temperate coniferous forest and bog habitats. Mol. Ecol. 2017;26:4846–4858. doi: 10.1111/mec.14246. [DOI] [PubMed] [Google Scholar]
53.Tedersoo L, et al. Tree diversity and species identity effects on soil fungi, protists and animals are context dependent. ISME J. 2016;10:346–362. doi: 10.1038/ismej.2015.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.2015. NCBI Sequence Read Archive. SRP043982
55.Jarvis SG, Woodward S, Taylor AF. Strong altitudinal partitioning in the distributions of ectomycorrhizal fungi along a short (300 m) elevation gradient. New Phytol. 2015;206:1145–1155. doi: 10.1111/nph.13315. [DOI] [PubMed] [Google Scholar]
56.2016. NCBI Sequence Read Archive. SRP044665
57.Nacke H, et al. Fine spatial scale variation of soil microbial communities under European Beech and Norway Spruce. Front. Microbiol. 2016;7:2067. doi: 10.3389/fmicb.2016.02067. [DOI] [PMC free article] [PubMed] [Google Scholar]
58.2015. NCBI Sequence Read Archive. SRP045166
59.Rincón A, et al. Compartmentalized and contrasted response of ectomycorrhizal and soil fungal communities of Scots pine forests along elevation gradients in France and Spain. Environ. Microbiol. 2015;17:3009–3024. doi: 10.1111/1462-2920.12894. [DOI] [PubMed] [Google Scholar]
60.2016. NCBI Sequence Read Archive. SRP045587
61.Bahram M, et al. Stochastic distribution of small soil eukaryotes resulting from high dispersal and drift in a local environment. ISME J. 2016;10:885–896. doi: 10.1038/ismej.2015.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
62.2014. NCBI Sequence Read Archive. SRP045746
63.Walker DM, et al. A metagenomics-based approach to the top-down effect on the detritivore food web: a salamanders influence on fungal communities within a deciduous forest. Ecol. Evol. 2014;4:4106–4116. doi: 10.1002/ece3.1259. [DOI] [PMC free article] [PubMed] [Google Scholar]
64.2015. NCBI Sequence Read Archive. SRP045933
65.Zhang T, Wei XL, Zhang YQ, Liu HY, Yu LY. Diversity and distribution of lichen-associated fungi in the Ny-Alesund Region (Svalbard, High Arctic) as revealed by 454 pyrosequencing. Sci. Rep. 2015;5:14850. doi: 10.1038/srep14850. [DOI] [PMC free article] [PubMed] [Google Scholar]
66.2016. NCBI Sequence Read Archive. SRP046049
67.Oh SY, Fong JJ, Park MS, Lim YW. Distinctive feature of microbial communities and bacterial functional profiles in Tricholoma matsutake dominant soil. PLoS One. 2016;11:e0168573. doi: 10.1371/journal.pone.0168573. [DOI] [PMC free article] [PubMed] [Google Scholar]
68.2016. NCBI Sequence Read Archive. SRP048036
69.Yang T, et al. Carbon constrains fungal endophyte assemblages along the timberline. Environ. Microbiol. 2016;18:2455–2469. doi: 10.1111/1462-2920.13153. [DOI] [PubMed] [Google Scholar]
70.Yang T, Sun H, Shen C, Chu H. Fungal assemblages in different habitats in an Erman’s Birch forest. Front. Microbiol. 2016;7:1368. doi: 10.3389/fmicb.2016.01368. [DOI] [PMC free article] [PubMed] [Google Scholar]
71.2015. NCBI Sequence Read Archive. SRP048856
72.Elliott DR, Caporn SJ, Nwaishi F, Nilsson RH, Sen R. Bacterial and fungal communities in a degraded ombrotrophic peatland undergoing natural and managed re-vegetation. PLoS One. 2015;10:e0124726. doi: 10.1371/journal.pone.0124726. [DOI] [PMC free article] [PubMed] [Google Scholar]
73.2015. NCBI Sequence Read Archive. SRP049544
74.Goldmann K, Schöning I, Buscot F, Wubet T. Forest management type influences diversity and community composition of soil fungi across temperate forest ecosystems. Front. Microbiol. 2015;6:1300. doi: 10.3389/fmicb.2015.01300. [DOI] [PMC free article] [PubMed] [Google Scholar]
75.2016. NCBI Sequence Read Archive. SRP051033
76.Roy-Bolduc A, Laliberté E, Boudreau S, Hijri M. Strong linkage between plant and soil fungal communities along a successional coastal dune system. FEMS Microbiol. Ecol. 2016;92:fiw156. doi: 10.1093/femsec/fiw156. [DOI] [PubMed] [Google Scholar]
77.2017. NCBI Sequence Read Archive. SRP052222
78.Fernández-Martínez MA, et al. Microbial succession dynamics along glacier forefield chronosequences in Tierra del Fuego (Chile) Polar Biol. 2017;40:1939–1957. [Google Scholar]
79.2015. NCBI Sequence Read Archive. SRP052716
80.Leff JW, et al. Consistent responses of soil microbial communities to elevated nutrient inputs in grasslands across the globe. Proc. Natl. Acad. Sci. USA. 2015;112:10967–10972. doi: 10.1073/pnas.1508382112. [DOI] [PMC free article] [PubMed] [Google Scholar]
81.2015. NCBI Sequence Read Archive. SRP055957
82.Tedersoo L, et al. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. Mycokeys. 2015;10:1–43. [Google Scholar]
83.2016. NCBI Sequence Read Archive. SRP057433
84.Wang W, Zhai Y, Cao L, Tan H, Zhang R. Endophytic bacterial and fungal microbiota in sprouts, roots and stems of rice (Oryza sativa L.) Microbiol. Res. 2016;188:1–8. doi: 10.1016/j.micres.2016.04.009. [DOI] [PubMed] [Google Scholar]
85.2016. NCBI Sequence Read Archive. SRP057541
86.Waring BG, Adams R, Branco S, Powers JS. Scale-dependent variation in nitrogen cycling and soil fungal communities along gradients of forest composition and age in regenerating tropical dry forests. New Phytol. 2016;209:845–854. doi: 10.1111/nph.13654. [DOI] [PubMed] [Google Scholar]
87.2016. NCBI Sequence Read Archive. SRP058508
88.Glassman SI, Levine CR, DiRocco AM, Battles JJ, Bruns TD. Ectomycorrhizal fungal spore bank recovery after a severe forest fire: some like it hot. ISME J. 2016;10:1228–1239. doi: 10.1038/ismej.2015.182. [DOI] [PMC free article] [PubMed] [Google Scholar]
89.2016. NCBI Sequence Read Archive. SRP058555
90.De Gannes V, et al. Microbial community structure and function of soil following ecosystem conversion from native forests to Teak plantation forests. Front. Microbiol. 2016;7:1976. doi: 10.3389/fmicb.2016.01976. [DOI] [PMC free article] [PubMed] [Google Scholar]
91.2018. NCBI Sequence Read Archive. SRP058851
92.Bach EM, Williams RJ, Hargreaves SK, Yang F, Hofmockel KS. Greatest soil microbial diversity found in micro-habitats. Soil Biol. Biochem. 2018;118:217–226. [Google Scholar]
93.2016. NCBI Sequence Read Archive. SRP059280
94.Roy‐Bolduc A, Laliberté E, Hijri M. High richness of ectomycorrhizal fungi and low host specificity in a coastal sand dune ecosystem revealed by network analysis. Ecol. Evol. 2016;6:349–362. doi: 10.1002/ece3.1881. [DOI] [PMC free article] [PubMed] [Google Scholar]
95.2016. NCBI Sequence Read Archive. SRP060838
96.He F, et al. Changes in composition and diversity of fungal communities along Quercus mongolica forests developments in Northeast China. Appl. Soil Ecol. 2016;100:162–171. [Google Scholar]
97.2016. NCBI Sequence Read Archive. SRP061179
98.Valverde A, et al. Specific microbial communities associate with the rhizosphere of Welwitschia mirabilis, a living fossil. PLoS One. 2016;11:e0153353. doi: 10.1371/journal.pone.0153353. [DOI] [PMC free article] [PubMed] [Google Scholar]
99.2017. NCBI Sequence Read Archive. SRP061305
100.Yao F, et al. Microbial taxa distribution is associated with ecological trophic cascades along an elevation gradient. Front. Microbiol. 2017;8:2071. doi: 10.3389/fmicb.2017.02071. [DOI] [PMC free article] [PubMed] [Google Scholar]
101.2015. NCBI Sequence Read Archive. SRP061904
102.Veach AM, Dodds WK, Jumpponen A. Woody plant encroachment, and its removal, impact bacterial and fungal communities across stream and terrestrial habitats in a tallgrass prairie ecosystem. FEMS Microbiol. Ecol. 2015;91:fiv109. doi: 10.1093/femsec/fiv109. [DOI] [PubMed] [Google Scholar]
103.2016. NCBI Sequence Read Archive. SRP062647
104.Newsham KK, et al. Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nat. Clim. Change. 2016;6:182. [Google Scholar]
105.2017. NCBI Sequence Read Archive. SRP063711
106.Poosakkannu A, Nissinen R, Männistö M, Kytöviita MM. Microbial community composition but not diversity changes along succession in arctic sand dunes. Environ. Microbiol. 2017;19:698–709. doi: 10.1111/1462-2920.13599. [DOI] [PubMed] [Google Scholar]
107.2017. NCBI Sequence Read Archive. SRP064158
108.Tian J, et al. Patterns and drivers of fungal diversity along an altitudinal gradient on Mount Gongga, China. J. Soil. Sediment. 2017;17:2856–2865. [Google Scholar]
109.2017. NCBI Sequence Read Archive. SRP065817
110.Zhang W, Lu Z, Yang K, Zhu J. Impacts of conversion from secondary forests to larch plantations on the structure and function of microbial communities. Appl. Soil Ecol. 2017;111:73–83. [Google Scholar]
111.2016. NCBI Sequence Read Archive. SRP066030
112.Porter TM, Shokralla S, Baird D, Golding GB, Hajibabaei M. Ribosomal DNA and plastid markers used to sample fungal and plant communities from wetland soils reveals complementary biotas. PLoS One. 2016;11:e0142759. doi: 10.1371/journal.pone.0142759. [DOI] [PMC free article] [PubMed] [Google Scholar]
113.2017. NCBI Sequence Read Archive. SRP066284
114.Wang M, et al. Influence of Peanut cultivars and environmental conditions on the diversity and community composition of Pod Rot soil fungi in China. Mycobiology. 2017;45:392–400. doi: 10.5941/MYCO.2017.45.4.392. [DOI] [PMC free article] [PubMed] [Google Scholar]
115.2017. NCBI Sequence Read Archive. SRP066331
116.Delgado‐Baquerizo M, et al. Soil microbial communities drive the resistance of ecosystem multifunctionality to global change in drylands across the globe. Ecol. Lett. 2017;20:1295–1305. doi: 10.1111/ele.12826. [DOI] [PubMed] [Google Scholar]
117.2017. NCBI Sequence Read Archive. SRP067301
118.Cross H, et al. Fungal diversity and seasonal succession in ash leaves infected by the invasive ascomycete Hymenoscyphus fraxineus. New Phytol. 2017;213:1405–1417. doi: 10.1111/nph.14204. [DOI] [PMC free article] [PubMed] [Google Scholar]
119.2016. NCBI Sequence Read Archive. SRP067367
120.Zhang T, Wang NF, Liu HY, Zhang YQ, Yu LY. Soil pH is a key determinant of soil fungal community composition in the Ny-Alesund region, Svalbard (High Arctic) Front. Microbiol. 2016;7:227. doi: 10.3389/fmicb.2016.00227. [DOI] [PMC free article] [PubMed] [Google Scholar]
121.2016. NCBI Sequence Read Archive. SRP068514
122.Gehring CA, et al. Cheatgrass invasion alters the abundance and composition of dark septate fungal communities in sagebrush steppe. Botany. 2016;94:481–491. [Google Scholar]
123.2016. NCBI Sequence Read Archive. SRP068608
124.Li Y, et al. Changes of soil microbial community under different degraded gradients of alpine meadow. Agric. Ecosyst. Environ. 2016;222:213–222. [Google Scholar]
125.2016. NCBI Sequence Read Archive. SRP068620
126.Zhou J, et al. Temperature mediates continental-scale diversity of microbes in forest soils. Nat. Commun. 2016;7:12083. doi: 10.1038/ncomms12083. [DOI] [PMC free article] [PubMed] [Google Scholar]
127.2016. NCBI Sequence Read Archive. SRP068654
128.Cox F, Newsham KK, Bol R, Dungait JA, Robinson CH. Not poles apart: Antarctic soil fungal communities show similarities to those of the distant Arctic. Ecol. Lett. 2016;19:528–536. doi: 10.1111/ele.12587. [DOI] [PubMed] [Google Scholar]
129.2017. NCBI Sequence Read Archive. SRP069065
130.Bergottini VM, et al. Exploring the diversity of the root-associated microbiome of Ilex paraguariensis St. Hil. (Yerba Mate) Appl. Soil Ecol. 2017;109:23–31. [Google Scholar]
131.2017. NCBI Sequence Read Archive. SRP069742
132.Moussa TA, Al-Zahrani HS, Almaghrabi OA, Abdelmoneim TS, Fuller MP. Comparative metagenomics approaches to characterize the soil fungal communities of western coastal region, Saudi Arabia. PLoS One. 2017;12:e0185096. doi: 10.1371/journal.pone.0185096. [DOI] [PMC free article] [PubMed] [Google Scholar]
133.2016. NCBI Sequence Read Archive. SRP070568
134.Goldmann K, et al. Divergent habitat filtering of root and soil fungal communities in temperate beech forests. Sci. Rep. 2016;11:31439. doi: 10.1038/srep31439. [DOI] [PMC free article] [PubMed] [Google Scholar]
135.2016. NCBI Sequence Read Archive. SRP073070
136.Liu C, et al. The influence of soil properties on the size and structure of bacterial and fungal communities along a paddy soil chronosequence. Eur. J. Soil Biol. 2016;76:9–18. [Google Scholar]
137.2017. NCBI Sequence Read Archive. SRP073265
138.Smith ME, et al. Investigating niche partitioning of ectomycorrhizal fungi in specialized rooting zones of the monodominant leguminous tree Dicymbe corymbosa. New Phytol. 2017;215:443–453. doi: 10.1111/nph.14570. [DOI] [PubMed] [Google Scholar]
139.2016. NCBI Sequence Read Archive. SRP074055
140.Bissett A, et al. Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. GigaScience. 2016;5:21. doi: 10.1186/s13742-016-0126-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
141.2016. NCBI Sequence Read Archive. SRP074496
142.Vannette RL, Leopold DR, Fukami T. Forest area and connectivity influence root-associated fungal communities in a fragmented landscape. Ecology. 2016;97:2374–2383. doi: 10.1002/ecy.1472. [DOI] [PubMed] [Google Scholar]
143.2017. NCBI Sequence Read Archive. SRP075989
144.Zhou X, et al. Rhizospheric fungi and their link with the nitrogen-fixing Frankia harbored in host plant Hippophae rhamnoides L. J. Basic Microbiol. 2017;57:1055–1064. doi: 10.1002/jobm.201700312. [DOI] [PubMed] [Google Scholar]
145.2017. NCBI Sequence Read Archive. SRP079403
146.Glassman SI, Wang IJ, Bruns TD. Environmental filtering by pH and soil nutrients drives community assembly in fungi at fine spatial scales. Mol. Ecol. 2017;26:6960–6973. doi: 10.1111/mec.14414. [DOI] [PubMed] [Google Scholar]
147.2018. NCBI Sequence Read Archive. SRP079521
148.Cline LC, Schilling JS, Menke J, Groenhof E, Kennedy PG. Ecological and functional effects of fungal endophytes on wood decomposition. Funct. Ecol. 2018;32:181–191. [Google Scholar]
149.2016. NCBI Sequence Read Archive. SRP080210
150.Johansen RB, et al. A native and an invasive dune grass share similar, patchily distributed, root-associated fungal communities. Fungal Ecol. 2016;23:141–155. [Google Scholar]
151.2017. NCBI Sequence Read Archive. SRP080428
152.Zhang S, Chen X, Zhong Q, Huang Z, Bai Z. Relations among epiphytic microbial communities from soil, leaves and grapes of the grapevine. Front. Life Sci. 2017;10:73–83. [Google Scholar]
153.2017. NCBI Sequence Read Archive. SRP080680
154.Fernandez CW, et al. Ectomycorrhizal fungal response to warming is linked to poor host performance at the boreal-temperate ecotone. Glob. Change Biol. 2017;23:1598–1609. doi: 10.1111/gcb.13510. [DOI] [PubMed] [Google Scholar]
155.2017. NCBI Sequence Read Archive. SRP082472
156.Zhang Z, et al. Fungal communities in ancient peatlands developed from different periods in the Sanjiang Plain, China. PLoS One. 2017;12:e0187575. doi: 10.1371/journal.pone.0187575. [DOI] [PMC free article] [PubMed] [Google Scholar]
157.2017. NCBI Sequence Read Archive. SRP082976
158.Gomes SI, Merckx VS, Saavedra S. Fungal-host diversity among mycoheterotrophic plants increases proportionally to their fungal-host overlap. Ecol. Evol. 2017;7:3623–3630. doi: 10.1002/ece3.2974. [DOI] [PMC free article] [PubMed] [Google Scholar]
159.2017. NCBI Sequence Read Archive. SRP083394
160.Zhou X, et al. Conversion from long-term cultivated wheat field to Jerusalem artichoke plantation changed soil fungal communities. Sci. Rep. 2017;7:41502. doi: 10.1038/srep41502. [DOI] [PMC free article] [PubMed] [Google Scholar]
161.2017. NCBI Sequence Read Archive. SRP083434
162.2017. NCBI Sequence Read Archive. SRP083901
163.Gomes SI, Aguirre‐Gutiérrez J, Bidartondo MI, Merckx VS. Arbuscular mycorrhizal interactions of mycoheterotrophic Thismia are more specialized than in autotrophic plants. New Phytol. 2017;213:1418–1427. doi: 10.1111/nph.14249. [DOI] [PMC free article] [PubMed] [Google Scholar]
164.2017. NCBI Sequence Read Archive. SRP087715
165.Tian H, et al. Changes in soil microbial communities after 10 years of winter wheat cultivation versus fallow in an organic-poor soil in the Loess Plateau of China. PLoS One. 2017;12:e0184223. doi: 10.1371/journal.pone.0184223. [DOI] [PMC free article] [PubMed] [Google Scholar]
166.2016. NCBI Sequence Read Archive. SRP090261
167.Gourmelon V, et al. Environmental and geographical factors structure soil microbial diversity in New Caledonian ultramafic substrates: a metagenomic approach. PLoS One. 2016;11:e0167405. doi: 10.1371/journal.pone.0167405. [DOI] [PMC free article] [PubMed] [Google Scholar]
168.2017. NCBI Sequence Read Archive. SRP090335
169.Younginger BS, Ballhorn DJ. Fungal endophyte communities in the temperate fern Polystichum munitum show early colonization and extensive temporal turnover. Am. J. Bot. 2017;104:1188–1194. doi: 10.3732/ajb.1700149. [DOI] [PubMed] [Google Scholar]
170.2017. NCBI Sequence Read Archive. SRP090490
171.Kamutando CN, et al. Soil nutritional status and biogeography influence rhizosphere microbial communities associated with the invasive tree Acacia dealbata. Sci. Rep. 2017;7:6472. doi: 10.1038/s41598-017-07018-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
172.2017. NCBI Sequence Read Archive. SRP090651
173.Anthony MA, Frey SD, Stinson KA. Fungal community homogenization, shift in dominant trophic guild, and appearance of novel taxa with biotic invasion. Ecosphere. 2017;8:e01951. [Google Scholar]
174.2017. NCBI Sequence Read Archive. SRP091741
175.Ge ZW, Brenneman T, Bonito G, Smith ME. Soil pH and mineral nutrients strongly influence truffles and other ectomycorrhizal fungi associated with commercial pecans (Carya illinoinensis) Plant Soil. 2017;418:493–505. [Google Scholar]
176.2018. NCBI Sequence Read Archive. SRP091855
177.Mirmajlessi SM, et al. Survey of soil fungal communities in Strawberry fields by Illumina amplicon sequencing. Eurasian Soil Sci. 2018;51:682–691. [Google Scholar]
178.2016. NCBI Sequence Read Archive. SRP091867
179.Harrison JG, Forister ML, Parchman TL, Koch GW. Vertical stratification of the foliar fungal community in the world’s tallest trees. Am. J. Bot. 2016;103:2087–2095. doi: 10.3732/ajb.1600277. [DOI] [PubMed] [Google Scholar]
180.2019. NCBI Sequence Read Archive. SRP092609
181.Semenova‐Nelsen TA, Platt WJ, Patterson TR, Huffman J, Sikes BA. Frequent fire reorganizes fungal communities and slows decomposition across a heterogeneous pine savanna landscape. New Phytol. 2019;224:916–927. doi: 10.1111/nph.16096. [DOI] [PubMed] [Google Scholar]
182.2017. NCBI Sequence Read Archive. SRP092777
183.Dean SL, et al. A study of Glycine max (soybean) fungal communities under different agricultural practices. Plant Gene. 2017;11:8–16. [Google Scholar]
184.2017. NCBI Sequence Read Archive. SRP093592
185.Kyaschenko J, Clemmensen KE, Hagenbo A, Karltun E, Lindahl BD. Shift in fungal communities and associated enzyme activities along an age gradient of managed Pinus sylvestris stands. ISME J. 2017;11:863–874. doi: 10.1038/ismej.2016.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
186.2017. NCBI Sequence Read Archive. SRP093928
187.Tian J, et al. Ecological succession pattern of fungal community in soil along a retreating glacier. Front. Microbiol. 2017;8:1028. doi: 10.3389/fmicb.2017.01028. [DOI] [PMC free article] [PubMed] [Google Scholar]
188.2017. NCBI Sequence Read Archive. SRP094708
189.Oono R, Rasmussen A, Lefèvre E. Distance decay relationships in foliar fungal endophytes are driven by rare taxa. Environ. Microbiol. 2017;19:2794–2805. doi: 10.1111/1462-2920.13799. [DOI] [PubMed] [Google Scholar]
190.Oono R. A confidence interval analysis of sampling effort, sequencing depth, and taxonomic resolution of fungal community ecology in the era of high-throughput sequencing. PLoS One. 2017;12:e0189796. doi: 10.1371/journal.pone.0189796. [DOI] [PMC free article] [PubMed] [Google Scholar]
191.2017. NCBI Sequence Read Archive. SRP097883
192.Marín C, et al. Functional land-use change effects on soil fungal communities in Chilean temperate rainforests. J. Soil Sci. Plant Nut. 2017;17:985–1002. [Google Scholar]
193.2017. NCBI Sequence Read Archive. SRP101553
194.Siles JA, Margesin R. Seasonal soil microbial responses are limited to changes in functionality at two Alpine forest sites differing in altitude and vegetation. Sci. Rep. 2017;7:2204. doi: 10.1038/s41598-017-02363-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
195.2018. NCBI Sequence Read Archive. SRP101605
196.Kazartsev I, Shorohova E, Kapitsa E, Kushnevskaya H. Decaying Picea abies log bark hosts diverse fungal communities. Fungal Ecol. 2018;33:1–12. [Google Scholar]
197.2017. NCBI Sequence Read Archive. SRP102378
198.Peay KG, et al. Convergence and contrast in the community structure of bacteria, fungi and archaea along a tropical elevation-climate gradient. FEMS Microbiol. Ecol. 2017;93:fix045. doi: 10.1093/femsec/fix045. [DOI] [PubMed] [Google Scholar]
199.2018. NCBI Sequence Read Archive. SRP102417
200.Coleine C, et al. Antarctic cryptoendolithic fungal communities are highly adapted and dominated by Lecanoromycetes and Dothideomycetes. Front. Microbiol. 2018;9:1392. doi: 10.3389/fmicb.2018.01392. [DOI] [PMC free article] [PubMed] [Google Scholar]
201.2018. NCBI Sequence Read Archive. SRP102775
202.Park MS, et al. Diversity of fungi associated with roots of Calanthe orchid species in Korea. J. Microbiol. 2018;56:49–55. doi: 10.1007/s12275-018-7319-9. [DOI] [PubMed] [Google Scholar]
203.2018. NCBI Sequence Read Archive. SRP106137
204.Glynou K, Nam B, Thines M, Maciá‐Vicente JG. Facultative root-colonizing fungi dominate endophytic assemblages in roots of nonmycorrhizal Microthlaspi species. New Phytol. 2018;217:1190–1202. doi: 10.1111/nph.14873. [DOI] [PubMed] [Google Scholar]
205.2018. NCBI Sequence Read Archive. SRP106774
206.Saitta A, Anslan S, Bahram M, Brocca L, Tedersoo L. Tree species identity and diversity drive fungal richness and community composition along an elevational gradient in a Mediterranean ecosystem. Mycorrhiza. 2018;28:39–47. doi: 10.1007/s00572-017-0806-8. [DOI] [PubMed] [Google Scholar]
207.2017. NCBI Sequence Read Archive. SRP107174
208.Almario J, et al. Root-associated fungal microbiota of nonmycorrhizal Arabis alpina and its contribution to plant phosphorus nutrition. Proc. Natl. Acad. Sci. USA. 2017;114:E9403–E9412. doi: 10.1073/pnas.1710455114. [DOI] [PMC free article] [PubMed] [Google Scholar]
209.2017. NCBI Sequence Read Archive. SRP107743
210.Fernández‐Mendoza F, Fleischhacker A, Kopun T, Grube M, Muggia L. ITS1 metabarcoding highlights low specificity of lichen mycobiomes at a local scale. Mol. Ecol. 2017;26:4811–4830. doi: 10.1111/mec.14244. [DOI] [PubMed] [Google Scholar]
211.2017. NCBI Sequence Read Archive. SRP109164
212.Varenius K, Lindahl BD, Dahlberg A. Retention of seed trees fails to lifeboat ectomycorrhizal fungal diversity in harvested Scots pine forests. FEMS Microbiol. Ecol. 2017;93:fix105. doi: 10.1093/femsec/fix105. [DOI] [PubMed] [Google Scholar]
213.2017. NCBI Sequence Read Archive. SRP109773
214.He D, et al. Diversity and co-occurrence network of soil fungi are more responsive than those of bacteria to shifts in precipitation seasonality in a subtropical forest. Soil Biol. Biochem. 2017;115:499–510. [Google Scholar]
215.2017. NCBI Sequence Read Archive. SRP110522
216.Mendoza JR, Kok CR, Stratton J, Bianchini A, Hallen-Adams HE. Understanding the mycobiota of maize from the highlands of Guatemala, and implications for maize quality and safety. Crop Prot. 2017;101:5–11. [Google Scholar]
217.2017. NCBI Sequence Read Archive. SRP110810
218.Miura T, Sánchez R, Castañeda LE, Godoy K, Barbosa O. Is microbial terroir related to geographic distance between vineyards? Environ. Microbiol. Rep. 2017;9:742–749. doi: 10.1111/1758-2229.12589. [DOI] [PubMed] [Google Scholar]
219.2018. NCBI Sequence Read Archive. SRP113348
220.Zhang J, et al. Distinct large-scale biogeographic patterns of fungal communities in bulk soil and soybean rhizosphere in China. Sci. Total Environ. 2018;644:791–800. doi: 10.1016/j.scitotenv.2018.07.016. [DOI] [PubMed] [Google Scholar]
221.2017. NCBI Sequence Read Archive. SRP114697
222.Sharma-Poudyal D, Schlatter D, Yin C, Hulbert S, Paulitz T. Long-term no-till: A major driver of fungal communities in dryland wheat cropping systems. PLoS One. 2017;12:e0184611. doi: 10.1371/journal.pone.0184611. [DOI] [PMC free article] [PubMed] [Google Scholar]
223.2018. NCBI Sequence Read Archive. SRP114821
224.Ren C, et al. Differential responses of soil microbial biomass, diversity, and compositions to altitudinal gradients depend on plant and soil characteristics. Sci. Total Environ. 2018;610:750–758. doi: 10.1016/j.scitotenv.2017.08.110. [DOI] [PubMed] [Google Scholar]
225.2018. NCBI Sequence Read Archive. SRP115350
226.Schneider-Maunoury L, et al. Is Tuber melanosporum colonizing the roots of herbaceous, non-ectomycorrhizal plants? Fungal Ecol. 2018;31:59–68. [Google Scholar]
227.2018. NCBI Sequence Read Archive. SRP115464
228.Sapkota R, Nicolaisen M. Cropping history shapes fungal, oomycete and nematode communities in arable soils and affects cavity spot in carrot. Agric. Ecosyst. Environ. 2018;257:120–131. [Google Scholar]
229.2018. NCBI Sequence Read Archive. SRP115599
230.Schroeder JW, et al. Community composition and diversity of Neotropical root‐associated fungi in common and rare trees. Biotropica. 2018;50:694–703. [Google Scholar]
231.2018. NCBI Sequence Read Archive. SRP117302
232.Fan K, Weisenhorn P, Gilbert JA, Chu H. Wheat rhizosphere harbors a less complex and more stable microbial co-occurrence pattern than bulk soil. Soil Biol. Biochem. 2018;125:251–260. [Google Scholar]
233.2018. NCBI Sequence Read Archive. SRP118875
234.Montagna M, et al. Differential biodiversity responses between kingdoms (plants, fungi, bacteria and metazoa) along an Alpine succession gradient. Mol. Ecol. 2018;27:3671–3685. doi: 10.1111/mec.14817. [DOI] [PubMed] [Google Scholar]
235.2018. NCBI Sequence Read Archive. SRP118960
236.Schön ME, Nieselt K, Garnica S. Belowground fungal community diversity and composition associated with Norway spruce along an altitudinal gradient. PLoS One. 2018;13:e0208493. doi: 10.1371/journal.pone.0208493. [DOI] [PMC free article] [PubMed] [Google Scholar]
237.2017. NCBI Sequence Read Archive. SRP119174
238.Thiem D, Piernik A, Hrynkiewicz K. Ectomycorrhizal and endophytic fungi associated with Alnus glutinosa growing in a saline area of central Poland. Symbiosis. 2017;75:17–28. doi: 10.1007/s13199-017-0512-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
239.2016. NCBI Sequence Read Archive. SRP125864
240.Barnes CJ, Maldonado C, Frøslev TG, Antonelli A, Rønsted N. Unexpectedly high beta-diversity of root-associated fungal communities in the Bolivian Andes. Front. Microbiol. 2016;7:1377. doi: 10.3389/fmicb.2016.01377. [DOI] [PMC free article] [PubMed] [Google Scholar]
241.2018. NCBI Sequence Read Archive. SRP132277
242.Schlatter DC, Kahl K, Carlson B, Huggins DR, Paulitz T. Fungal community composition and diversity vary with soil depth and landscape position in a no-till wheat-based cropping system. FEMS Microbiol. Ecol. 2018;94:fiy098. doi: 10.1093/femsec/fiy098. [DOI] [PubMed] [Google Scholar]
243.2018. NCBI Sequence Read Archive. SRP132591
244.Rasmussen PU, et al. Multiscale patterns and drivers of arbuscular mycorrhizal fungal communities in the roots and root-associated soil of a wild perennial herb. New Phytol. 2018;220:1248–1261. doi: 10.1111/nph.15088. [DOI] [PMC free article] [PubMed] [Google Scholar]
245.2018. NCBI Sequence Read Archive. SRP132598
246.2012. NCBI Sequence Read Archive. SRP136886
247.Guo J, et al. Soil fungal assemblage complexity is dependent on soil fertility and dominated by deterministic processes. New Phytol. 2019;226:232–243. doi: 10.1111/nph.16345. [DOI] [PubMed] [Google Scholar]
248.2019. NCBI Sequence Read Archive. SRP139483
249.Song H, et al. Tropical forest conversion to rubber plantation in southwest China results in lower fungal beta diversity and reduced network complexity. FEMS Microbiol. Ecol. 2019;95:fiz092. doi: 10.1093/femsec/fiz092. [DOI] [PubMed] [Google Scholar]
250.2018. NCBI Sequence Read Archive. SRP142723
251.Rogers TJ, et al. Exploring variation in phyllosphere microbial communities across four hemlock species. Ecosphere. 2018;9:e02524. [Google Scholar]
252.2018. NCBI Sequence Read Archive. SRP148813
253.Schlegel M, Queloz V, Sieber TN. The endophytic mycobiome of European Ash and Sycamore Maple leaves – geographic patterns, host specificity and influence of Ash Dieback. Front. Microbiol. 2018;9:2345. doi: 10.3389/fmicb.2018.02345. [DOI] [PMC free article] [PubMed] [Google Scholar]
254.2019. NCBI Sequence Read Archive. SRP150527
255.Truong C, et al. Ectomycorrhizal fungi and soil enzymes exhibit contrasting patterns along elevation gradients in southern Patagonia. New Phytol. 2019;222:1936–1950. doi: 10.1111/nph.15714. [DOI] [PubMed] [Google Scholar]
256.2018. NCBI Sequence Read Archive. SRP151262
257.Jiao S, et al. Soil microbiomes with distinct assemblies through vertical soil profiles drive the cycling of multiple nutrients in reforested ecosystems. Microbiome. 2018;6:146. doi: 10.1186/s40168-018-0526-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
258.2018. NCBI Sequence Read Archive. SRP153934
259.Marasco R, et al. Rhizosheath microbial community assembly of sympatric desert speargrasses is independent of the plant host. Microbiome. 2018;6:215. doi: 10.1186/s40168-018-0597-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
260.2018. NCBI Sequence Read Archive. SRP160913
261.Bickford WA, Goldberg DE, Kowalski KP, Zak DR. Root endophytes and invasiveness: no difference between native and non‐native Phragmites in the Great Lakes region. Ecosphere. 2018;9:e02526. [Google Scholar]
262.2018. NCBI Sequence Read Archive. SRP161632
263.Si P, et al. Rhizosphere microenvironments of eight common deciduous fruit trees were shaped by microbes in Northern China. Front. Microbiol. 2018;9:3147. doi: 10.3389/fmicb.2018.03147. [DOI] [PMC free article] [PubMed] [Google Scholar]
264.2019. NCBI Sequence Read Archive. SRP195764
265.Purahong W, Wu YT, Chen CT, Mapook A. Characterization of the Castanopsis carlesii deadwood mycobiome by Pacbio sequencing of the full-length fungal nuclear ribosomal internal transcribed spacer (ITS) Front. Microbiol. 2019;10:983. doi: 10.3389/fmicb.2019.00983. [DOI] [PMC free article] [PubMed] [Google Scholar]
266.2014. European Nucleotide Archive. ERP001713
267.Geml J, et al. The contribution of DNA metabarcoding to fungal conservation: diversity assessment, habitat partitioning and mapping red-listed fungi in protected coastal Salix repens communities in the Netherlands. PLoS One. 2014;9:e99852. doi: 10.1371/journal.pone.0099852. [DOI] [PMC free article] [PubMed] [Google Scholar]
268.2013. European Nucleotide Archive. ERP003251
269.Schmidt PA, et al. Illumina metabarcoding of a soil fungal community. Soil Biol. Biochem. 2013;65:128–132. [Google Scholar]
270.2015. European Nucleotide Archive. ERP003790
271.van der Wal A, Ottosson E, De Boer W. Neglected role of fungal community composition in explaining variation in wood decay rates. Ecology. 2015;96:124–133. doi: 10.1890/14-0242.1. [DOI] [PubMed] [Google Scholar]
272.2015. European Nucleotide Archive. ERP005177
273.Muller LA, Hilger HH. Insights into the effects of serpentine soil conditions on the community composition of fungal symbionts in the roots of Onosma echioides. Soil Biol. Biochem. 2015;81:1–8. [Google Scholar]
274.2015. European Nucleotide Archive. ERP005905
275.Sun H, et al. Fungal community shifts in structure and function across a boreal forest fire chronosequence. Appl. Environ. Microbiol. 2015;81:7869–7880. doi: 10.1128/AEM.02063-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
276.2015. European Nucleotide Archive. ERP009341
277.Rajala T, Tuomivirta T, Pennanen T, Mäkipää R. Habitat models of wood-inhabiting fungi along a decay gradient of Norway spruce logs. Fungal Ecol. 2015;18:48–55. [Google Scholar]
278.2017. European Nucleotide Archive. ERP010027
279.Purahong W, et al. Characterization of unexplored deadwood mycobiome in highly diverse subtropical forests using culture-independent molecular technique. Front. Microbiol. 2017;8:574. doi: 10.3389/fmicb.2017.00574. [DOI] [PMC free article] [PubMed] [Google Scholar]
280.2016. European Nucleotide Archive. ERP010084
281.van der Wal A, Gunnewiek PJK, Cornelissen JHC, Crowther TW, de Boer W. Patterns of natural fungal community assembly during initial decay of coniferous and broadleaf tree logs. Ecosphere. 2016;7:e01393. [Google Scholar]
282.2016. European Nucleotide Archive. ERP010743
283.Reese AT, et al. Urban stress is associated with variation in microbial species composition-but not richness-in Manhattan. ISME J. 2016;10:751–760. doi: 10.1038/ismej.2015.152. [DOI] [PMC free article] [PubMed] [Google Scholar]
284.2016. European Nucleotide Archive. ERP011924
285.Kielak AM, Scheublin TR, Mendes LW, Van Veen JA, Kuramae EE. Bacterial community succession in Pine-wood decomposition. Front. Microbiol. 2016;7:231. doi: 10.3389/fmicb.2016.00231. [DOI] [PMC free article] [PubMed] [Google Scholar]
286.2016. European Nucleotide Archive. ERP012017
287.Santalahti, M., Sun, H., Jumpponen, A., Pennanen, T. & Heinonsalo, J. Vertical and seasonal dynamics of fungal communities in boreal Scots pine forest soil. FEMS Microbiol. Ecol. 92, fiw170 (2016). [DOI] [PubMed]
288.2016. European Nucleotide Archive. ERP013208
289.Frey B, et al. Microbial diversity in European alpine permafrost and active layers. FEMS Microbiol. Ecol. 2016;92:fiw018. doi: 10.1093/femsec/fiw018. [DOI] [PubMed] [Google Scholar]
290.2017. European Nucleotide Archive. ERP013987
291.Wilhelm RC, et al. A metagenomic survey of forest soil microbial communities more than a decade after timber harvesting. Sci. Data. 2017;4:170092. doi: 10.1038/sdata.2017.92. [DOI] [PMC free article] [PubMed] [Google Scholar]
292.2016. European Nucleotide Archive. ERP014227
293.Lanzén A, et al. Multi-targeted metagenetic analysis of the influence of climate and environmental parameters on soil microbial communities along an elevational gradient. Sci. Rep. 2016;6:28257. doi: 10.1038/srep28257. [DOI] [PMC free article] [PubMed] [Google Scholar]
294.2018. European Nucleotide Archive. ERP017480
295.Purahong W, et al. Increasing N deposition impacts neither diversity nor functions of deadwood‐inhabiting fungal communities, but adaptation and functional redundancy ensure ecosystem function. Environ. Microbiol. 2018;20:1693–1710. doi: 10.1111/1462-2920.14081. [DOI] [PubMed] [Google Scholar]
296.2017. European Nucleotide Archive. ERP017851
297.Yang T, et al. Soil fungal diversity in natural grasslands of the Tibetan Plateau: associations with plant diversity and productivity. New Phytol. 2017;215:756–765. doi: 10.1111/nph.14606. [DOI] [PubMed] [Google Scholar]
298.2017. European Nucleotide Archive. ERP017915
299.Nguyen D, et al. Foliar fungi of Betula pendula: impact of tree species mixtures and assessment methods. Sci. Rep. 2017;7:41801. doi: 10.1038/srep41801. [DOI] [PMC free article] [PubMed] [Google Scholar]
300.2017. European Nucleotide Archive. ERP019580
301.Tu B, et al. Microbial diversity in chinese temperate steppe: unveiling the most influential environmental drivers. FEMS Microbiol. Ecol. 2017;93:fix031. doi: 10.1093/femsec/fix031. [DOI] [PubMed] [Google Scholar]
302.2017. European Nucleotide Archive. ERP019924
303.Yang T, et al. Fungal community assemblages in a high elevation desert environment: absence of dispersal limitation and edaphic effects in surface soil. Soil Biol. Biochem. 2017;115:393–402. [Google Scholar]
304.2017. European Nucleotide Archive. ERP020657
305.van der Wal A, Gunnewiek PK, de Hollander M, de Boer W. Fungal diversity and potential tree pathogens in decaying logs and stumps. Forest Ecol. Manag. 2017;406:266–273. [Google Scholar]
306.2019. European Nucleotide Archive. ERP022511
307.Alzarhani AK, et al. Are drivers of root-associated fungal community structure context specific? ISME J. 2019;13:1330–1344. doi: 10.1038/s41396-019-0350-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
308.2017. European Nucleotide Archive. ERP022742
309.van der Wal A, Gunnewiek PK, de Boer W. Soil-wood interactions: Influence of decaying coniferous and broadleaf logs on composition of soil fungal communities. Fungal Ecol. 2017;30:132–134. [Google Scholar]
310.2018. European Nucleotide Archive. ERP023275
311.Purahong W, et al. Determinants of deadwood-inhabiting fungal communities in temperate forests: molecular evidence from a large scale deadwood decomposition experiment. Front. Microbiol. 2018;9:2120. doi: 10.3389/fmicb.2018.02120. [DOI] [PMC free article] [PubMed] [Google Scholar]
312.2018. European Nucleotide Archive. ERP023718
313.Sun R, et al. Tillage changes vertical distribution of soil bacterial and fungal communities. Front. Microbiol. 2018;9:699. doi: 10.3389/fmicb.2018.00699. [DOI] [PMC free article] [PubMed] [Google Scholar]
314.2018. European Nucleotide Archive. ERP023855
315.Santalahti M, et al. Reindeer grazing alter soil fungal community structure and litter decomposition related enzyme activities in boreal coniferous forests in finnish lapland. Appl. Soil Ecol. 2018;132:74–82. [Google Scholar]
316.2018. European Nucleotide Archive. ERP106131
317.Gałązka A, Grządziel J. Fungal genetics and functional diversity of microbial communities in the soil under long-term monoculture of Maize using different cultivation techniques. Front. Microbiol. 2018;9:76. doi: 10.3389/fmicb.2018.00076. [DOI] [PMC free article] [PubMed] [Google Scholar]
318.2019. European Nucleotide Archive. ERP107634
319.Ramirez KS, et al. Range-expansion effects on the belowground plant microbiome. Nat. Ecol. Evol. 2019;3:604. doi: 10.1038/s41559-019-0828-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
320.2019. European Nucleotide Archive. ERP107636
321.2019. European Nucleotide Archive. ERP110188
322.George PB, et al. Divergent national-scale trends of microbial and animal biodiversity revealed across diverse temperate soil ecosystems. Nat. Commun. 2019;10:1107. doi: 10.1038/s41467-019-09031-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
323.2019. European Nucleotide Archive. ERP112007
324.Álvarez-Garrido L, Viñegla B, Hortal S, Powell JR, Carreira JA. Distributional shifts in ectomycorrizhal fungal communities lag behind climate-driven tree upward migration in a conifer forest-high elevation shrubland ecotone. Soil Biol. Biochem. 2019;137:107545. [Google Scholar]
325.2014. DNA Data Bank of Japan. DRA000926
326.Yamamoto S, et al. Spatial segregation and aggregation of ectomycorrhizal and root-endophytic fungi in the seedlings of two Quercus species. PLoS One. 2014;9:e96363. doi: 10.1371/journal.pone.0096363. [DOI] [PMC free article] [PubMed] [Google Scholar]
327.2014. DNA Data Bank of Japan. DRA000937
328.Kadowaki K, et al. Detection of the horizontal spatial structure of soil fungal communities in a natural forest. Popul. Ecol. 2014;56:301–310. [Google Scholar]
329.2016. DNA Data Bank of Japan. DRA001737
330.Izuno A, et al. Structure of phyllosphere fungal communities in a tropical dipterocarp plantation: A massively parallel next-generation sequencing analysis. Mycoscience. 2016;57:171–180. [Google Scholar]
331.2016. DNA Data Bank of Japan. DRA002424
332.Matsuoka S, Kawaguchi E, Osono T. Temporal distance decay of similarity of ectomycorrhizal fungal community composition in a subtropical evergreen forest in Japan. FEMS Microbiol. Ecol. 2016;92:fiw061. doi: 10.1093/femsec/fiw061. [DOI] [PubMed] [Google Scholar]
333.2016. DNA Data Bank of Japan. DRA002469
334.Izuno A, Kanzaki M, Artchawakom T, Wachrinrat C, Isagi Y. Vertical structure of phyllosphere fungal communities in a tropical forest in Thailand uncovered by high-throughput sequencing. PLoS One. 2016;11:e0166669. doi: 10.1371/journal.pone.0166669. [DOI] [PMC free article] [PubMed] [Google Scholar]
335.2016. DNA Data Bank of Japan. DRA003024
336.Matsuoka S, Mori AS, Kawaguchi E, Hobara S, Osono T. Disentangling the relative importance of host tree community, abiotic environment and spatial factors on ectomycorrhizal fungal assemblages along an elevation gradient. FEMS Microbiol. Ecol. 2016;92:fiw044. doi: 10.1093/femsec/fiw044. [DOI] [PubMed] [Google Scholar]
337.2016. DNA Data Bank of Japan. DRA003730
338.Toju H, Yamamoto S, Tanabe AS, Hayakawa T, Ishii HS. Network modules and hubs in plant-root fungal biomes. J. R. Soc. Interface. 2016;13:20151097. doi: 10.1098/rsif.2015.1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
339.2017. DNA Data Bank of Japan. DRA004913
340.Shen Z, et al. Banana Fusarium Wilt disease incidence is influenced by shifts of soil microbial communities under different monoculture spans. Microb. Ecol. 2017;75:739–750. doi: 10.1007/s00248-017-1052-5. [DOI] [PubMed] [Google Scholar]
341.2018. DNA Data Bank of Japan. DRA006519
342.Matsuoka S, Ogisu Y, Sakoh S, Hobara S, Osono T. Taxonomic, functional, and phylogenetic diversity of fungi along primary successional and elevational gradients near Mount Robson, British Columbia. Polar Sci. 2018;21:165–171. [Google Scholar]
343.2015. DNA Data Bank of Japan. DRP002783
344.Fukasawa Y, Matsuoka S. Communities of wood-inhabiting fungi in dead pine logs along a geographical gradient in Japan. Fungal Ecol. 2015;18:75–82. [Google Scholar]
345.2016. DNA Data Bank of Japan. DRP003138
346.Toju H, Tanabe AS, Ishii HS. Ericaceous plant-fungus network in a harsh alpine-subalpine environment. Mol. Ecol. 2016;25:3242–3257. doi: 10.1111/mec.13680. [DOI] [PubMed] [Google Scholar]
347.2019. DNA Data Bank of Japan. DRP005365
348.Shigyo N, Umeki K, Hirao T. Seasonal dynamics of soil fungal and bacterial communities in cool-temperate montane forests. Front. Microbiol. 2019;10:1944. doi: 10.3389/fmicb.2019.01944. [DOI] [PMC free article] [PubMed] [Google Scholar]
349.Semenova TA, 2014. Data from: Long-term experimental warming alters community composition of ascomycetes in Alaskan moist and dry arctic tundra. Dryad. [DOI] [PubMed]
350.Geml J, et al. Long-term warming alters richness and composition of taxonomic and functional groups of arctic fungi. FEMS Microbiol. Ecol. 2015;91:fiv095. doi: 10.1093/femsec/fiv095. [DOI] [PubMed] [Google Scholar]
351.Oriol G, 2017. Data from: Abrupt changes in the composition and function of fungal communities along an environmental gradient in the High. Arctic. Dryad. [DOI] [PubMed]
352.Grau O, et al. Abrupt changes in the composition and function of fungal communities along an environmental gradient in the high Arctic. Mol. Ecol. 2017;26:4798–4810. doi: 10.1111/mec.14227. [DOI] [PubMed] [Google Scholar]
353.Mundra S, 2015. Data from: Arctic fungal communities associated with roots of Bistorta vivipara do not respond to the same fine-scale edaphic gradients as the above-ground vegetation. Dryad. [DOI] [PubMed]
354.Mundra S, et al. Arctic fungal communities associated with roots of Bistorta vivipara do not respond to the same fine-scale edaphic gradients as the aboveground vegetation. New Phytol. 2015;205:1587–1597. doi: 10.1111/nph.13216. [DOI] [PubMed] [Google Scholar]
355.Rime T, 2014. Data from: Vertical distribution of the soil microbiota along a successional gradient in a glacier forefield. Dryad. [DOI] [PubMed]
356.Rime T, et al. Vertical distribution of the soil microbiota along a successional gradient in a glacier forefield. Mol. Ecol. 2015;24:1091–1108. doi: 10.1111/mec.13051. [DOI] [PubMed] [Google Scholar]
357.Semenova TA, 2017. Data from: Compositional and functional shifts in arctic fungal communities in response to experimentally increased snow depth. Dryad. [DOI]
358.Semenova TA, et al. Compositional and functional shifts in arctic fungal communities in response to experimentally increased snow depth. Soil Biol. Biochem. 2016;100:201–209. [Google Scholar]
359.Geml J, 2014. Data from: Large-scale fungal diversity assessment in the Andean Yungas forests reveals strong community turnover among forest types along an altitudinal gradient. Dryad. [DOI] [PubMed]
360.Wicaksono CY, et al. Contracting montane cloud forests: a case study of the Andean alder (Alnusacuminata) and associated fungi in the Yungas. Biotropica. 2017;49:141–152. [Google Scholar]
361.Yao F, 2013. Data from: Substantial compositional turnover of fungal communities in an alpine ridge-to-snowbed gradient. Dryad. [DOI] [PubMed]
362.Yao F, et al. Substantial compositional turnover of fungal communities in an alpine ridge-to-snowbed gradient. Mol. Ecol. 2013;22:5040–5052. doi: 10.1111/mec.12437. [DOI] [PubMed] [Google Scholar]
363.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYV00000000.1
364.Schappe T, et al. The role of soil chemistry and plant neighbourhoods in structuring fungal communities in three Panamanian rainforests. J. Ecol. 2017;105:569–579. [Google Scholar]
365.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYU00000000.1
366.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYT00000000.1
367.Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934078
368.Vaz AB, et al. Using Next-Generation Sequencing (NGS) to uncover diversity of wood-decaying fungi in neotropical atlantic forests. Phytotaxa. 2017;295:1–21. [Google Scholar]
369.Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934079
370.Siciliano S, 2014. Polar soil bacterial and fungal biodiversity survey. Australian Antarctic Data Centre. [DOI]
371.Ji M, et al. Microbial diversity at Mitchell Peninsula, Eastern Antarctica: a potential biodiversity “hotspot”. Polar Biol. 2016;39:237–249. [Google Scholar]
372.Hartmann M, et al. Significant and persistent impact of timber harvesting on soil microbial communities in Northern coniferous forests. ISME J. 2012;6:2199–2218. doi: 10.1038/ismej.2012.84. [DOI] [PMC free article] [PubMed] [Google Scholar]
373.Rime T, Hartmann M, Frey B. Potential sources of microbial colonizers in an initial soil ecosystem after retreat of an alpine glacier. ISME J. 2016;10:1625–1641. doi: 10.1038/ismej.2015.238. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

Baldrian P, 2020. GlobalFungi: Global database of fungal records from high-throughput-sequencing metabarcoding studies. figshare. [DOI] [PMC free article] [PubMed]
2010. NCBI Sequence Read Archive. SRP001058
2010. NCBI Sequence Read Archive. SRP001175
2011. NCBI Sequence Read Archive. SRP006078
2012. NCBI Sequence Read Archive. SRP012868
2012. NCBI Sequence Read Archive. SRP013695
2016. NCBI Sequence Read Archive. SRP013944
2015. NCBI Sequence Read Archive. SRP015735
2015. NCBI Sequence Read Archive. SRP016090
2014. NCBI Sequence Read Archive. SRP026207
2015. NCBI Sequence Read Archive. SRP028404
2015. NCBI Sequence Read Archive. SRP033719
2015. NCBI Sequence Read Archive. SRP035356
2014. NCBI Sequence Read Archive. SRP040314
2015. NCBI Sequence Read Archive. SRP040786
2015. NCBI Sequence Read Archive. SRP041347
2015. NCBI Sequence Read Archive. SRP043106
2017. NCBI Sequence Read Archive. SRP043706
2015. NCBI Sequence Read Archive. SRP043982
2016. NCBI Sequence Read Archive. SRP044665
2015. NCBI Sequence Read Archive. SRP045166
2016. NCBI Sequence Read Archive. SRP045587
2014. NCBI Sequence Read Archive. SRP045746
2015. NCBI Sequence Read Archive. SRP045933
2016. NCBI Sequence Read Archive. SRP046049
2016. NCBI Sequence Read Archive. SRP048036
2015. NCBI Sequence Read Archive. SRP048856
2015. NCBI Sequence Read Archive. SRP049544
2016. NCBI Sequence Read Archive. SRP051033
2017. NCBI Sequence Read Archive. SRP052222
2015. NCBI Sequence Read Archive. SRP052716
2015. NCBI Sequence Read Archive. SRP055957
2016. NCBI Sequence Read Archive. SRP057433
2016. NCBI Sequence Read Archive. SRP057541
2016. NCBI Sequence Read Archive. SRP058508
2016. NCBI Sequence Read Archive. SRP058555
2018. NCBI Sequence Read Archive. SRP058851
2016. NCBI Sequence Read Archive. SRP059280
2016. NCBI Sequence Read Archive. SRP060838
2016. NCBI Sequence Read Archive. SRP061179
2017. NCBI Sequence Read Archive. SRP061305
2015. NCBI Sequence Read Archive. SRP061904
2016. NCBI Sequence Read Archive. SRP062647
2017. NCBI Sequence Read Archive. SRP063711
2017. NCBI Sequence Read Archive. SRP064158
2017. NCBI Sequence Read Archive. SRP065817
2016. NCBI Sequence Read Archive. SRP066030
2017. NCBI Sequence Read Archive. SRP066284
2017. NCBI Sequence Read Archive. SRP066331
2017. NCBI Sequence Read Archive. SRP067301
2016. NCBI Sequence Read Archive. SRP067367
2016. NCBI Sequence Read Archive. SRP068514
2016. NCBI Sequence Read Archive. SRP068608
2016. NCBI Sequence Read Archive. SRP068620
2016. NCBI Sequence Read Archive. SRP068654
2017. NCBI Sequence Read Archive. SRP069065
2017. NCBI Sequence Read Archive. SRP069742
2016. NCBI Sequence Read Archive. SRP070568
2016. NCBI Sequence Read Archive. SRP073070
2017. NCBI Sequence Read Archive. SRP073265
2016. NCBI Sequence Read Archive. SRP074055
2016. NCBI Sequence Read Archive. SRP074496
2017. NCBI Sequence Read Archive. SRP075989
2017. NCBI Sequence Read Archive. SRP079403
2018. NCBI Sequence Read Archive. SRP079521
2016. NCBI Sequence Read Archive. SRP080210
2017. NCBI Sequence Read Archive. SRP080428
2017. NCBI Sequence Read Archive. SRP080680
2017. NCBI Sequence Read Archive. SRP082472
2017. NCBI Sequence Read Archive. SRP082976
2017. NCBI Sequence Read Archive. SRP083394
2017. NCBI Sequence Read Archive. SRP083434
2017. NCBI Sequence Read Archive. SRP083901
2017. NCBI Sequence Read Archive. SRP087715
2016. NCBI Sequence Read Archive. SRP090261
2017. NCBI Sequence Read Archive. SRP090335
2017. NCBI Sequence Read Archive. SRP090490
2017. NCBI Sequence Read Archive. SRP090651
2017. NCBI Sequence Read Archive. SRP091741
2018. NCBI Sequence Read Archive. SRP091855
2016. NCBI Sequence Read Archive. SRP091867
2019. NCBI Sequence Read Archive. SRP092609
2017. NCBI Sequence Read Archive. SRP092777
2017. NCBI Sequence Read Archive. SRP093592
2017. NCBI Sequence Read Archive. SRP093928
2017. NCBI Sequence Read Archive. SRP094708
2017. NCBI Sequence Read Archive. SRP097883
2017. NCBI Sequence Read Archive. SRP101553
2018. NCBI Sequence Read Archive. SRP101605
2017. NCBI Sequence Read Archive. SRP102378
2018. NCBI Sequence Read Archive. SRP102417
2018. NCBI Sequence Read Archive. SRP102775
2018. NCBI Sequence Read Archive. SRP106137
2018. NCBI Sequence Read Archive. SRP106774
2017. NCBI Sequence Read Archive. SRP107174
2017. NCBI Sequence Read Archive. SRP107743
2017. NCBI Sequence Read Archive. SRP109164
2017. NCBI Sequence Read Archive. SRP109773
2017. NCBI Sequence Read Archive. SRP110522
2017. NCBI Sequence Read Archive. SRP110810
2018. NCBI Sequence Read Archive. SRP113348
2017. NCBI Sequence Read Archive. SRP114697
2018. NCBI Sequence Read Archive. SRP114821
2018. NCBI Sequence Read Archive. SRP115350
2018. NCBI Sequence Read Archive. SRP115464
2018. NCBI Sequence Read Archive. SRP115599
2018. NCBI Sequence Read Archive. SRP117302
2018. NCBI Sequence Read Archive. SRP118875
2018. NCBI Sequence Read Archive. SRP118960
2017. NCBI Sequence Read Archive. SRP119174
2016. NCBI Sequence Read Archive. SRP125864
2018. NCBI Sequence Read Archive. SRP132277
2018. NCBI Sequence Read Archive. SRP132591
2018. NCBI Sequence Read Archive. SRP132598
2012. NCBI Sequence Read Archive. SRP136886
2019. NCBI Sequence Read Archive. SRP139483
2018. NCBI Sequence Read Archive. SRP142723
2018. NCBI Sequence Read Archive. SRP148813
2019. NCBI Sequence Read Archive. SRP150527
2018. NCBI Sequence Read Archive. SRP151262
2018. NCBI Sequence Read Archive. SRP153934
2018. NCBI Sequence Read Archive. SRP160913
2018. NCBI Sequence Read Archive. SRP161632
2019. NCBI Sequence Read Archive. SRP195764
2014. European Nucleotide Archive. ERP001713
2013. European Nucleotide Archive. ERP003251
2015. European Nucleotide Archive. ERP003790
2015. European Nucleotide Archive. ERP005177
2015. European Nucleotide Archive. ERP005905
2015. European Nucleotide Archive. ERP009341
2017. European Nucleotide Archive. ERP010027
2016. European Nucleotide Archive. ERP010084
2016. European Nucleotide Archive. ERP010743
2016. European Nucleotide Archive. ERP011924
2016. European Nucleotide Archive. ERP012017
2016. European Nucleotide Archive. ERP013208
2017. European Nucleotide Archive. ERP013987
2016. European Nucleotide Archive. ERP014227
2018. European Nucleotide Archive. ERP017480
2017. European Nucleotide Archive. ERP017851
2017. European Nucleotide Archive. ERP017915
2017. European Nucleotide Archive. ERP019580
2017. European Nucleotide Archive. ERP019924
2017. European Nucleotide Archive. ERP020657
2019. European Nucleotide Archive. ERP022511
2017. European Nucleotide Archive. ERP022742
2018. European Nucleotide Archive. ERP023275
2018. European Nucleotide Archive. ERP023718
2018. European Nucleotide Archive. ERP023855
2018. European Nucleotide Archive. ERP106131
2019. European Nucleotide Archive. ERP107634
2019. European Nucleotide Archive. ERP107636
2019. European Nucleotide Archive. ERP110188
2019. European Nucleotide Archive. ERP112007
2014. DNA Data Bank of Japan. DRA000926
2014. DNA Data Bank of Japan. DRA000937
2016. DNA Data Bank of Japan. DRA001737
2016. DNA Data Bank of Japan. DRA002424
2016. DNA Data Bank of Japan. DRA002469
2016. DNA Data Bank of Japan. DRA003024
2016. DNA Data Bank of Japan. DRA003730
2017. DNA Data Bank of Japan. DRA004913
2018. DNA Data Bank of Japan. DRA006519
2015. DNA Data Bank of Japan. DRP002783
2016. DNA Data Bank of Japan. DRP003138
2019. DNA Data Bank of Japan. DRP005365
Semenova TA, 2014. Data from: Long-term experimental warming alters community composition of ascomycetes in Alaskan moist and dry arctic tundra. Dryad. [DOI] [PubMed]
Oriol G, 2017. Data from: Abrupt changes in the composition and function of fungal communities along an environmental gradient in the High. Arctic. Dryad. [DOI] [PubMed]
Mundra S, 2015. Data from: Arctic fungal communities associated with roots of Bistorta vivipara do not respond to the same fine-scale edaphic gradients as the above-ground vegetation. Dryad. [DOI] [PubMed]
Rime T, 2014. Data from: Vertical distribution of the soil microbiota along a successional gradient in a glacier forefield. Dryad. [DOI] [PubMed]
Semenova TA, 2017. Data from: Compositional and functional shifts in arctic fungal communities in response to experimentally increased snow depth. Dryad. [DOI]
Geml J, 2014. Data from: Large-scale fungal diversity assessment in the Andean Yungas forests reveals strong community turnover among forest types along an altitudinal gradient. Dryad. [DOI] [PubMed]
Yao F, 2013. Data from: Substantial compositional turnover of fungal communities in an alpine ridge-to-snowbed gradient. Dryad. [DOI] [PubMed]
Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYV00000000.1
Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYU00000000.1
Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYT00000000.1
Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934078
Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934079
Siciliano S, 2014. Polar soil bacterial and fungal biodiversity survey. Australian Antarctic Data Centre. [DOI]

Data Availability Statement

The workflow included several custom made python scripts (labelled by star in the Fig. 2) which are accessible here: https://github.com/VetrovskyTomas/GlobalFungi.

[CR1] 1.Crowther TW, et al. Quantifying global soil carbon losses in response to warming. Nature. 2016;540:104–108. doi: 10.1038/nature20150. [DOI] [PubMed] [Google Scholar]

[CR2] 2.Peay KG, Kennedy PG, Talbot JM. Dimensions of biodiversity in the Earth mycobiome. Nature Rev. Microbiol. 2016;14:434–447. doi: 10.1038/nrmicro.2016.59. [DOI] [PubMed] [Google Scholar]

[CR3] 3.Wall DH, Nielsen UN, Six J. Soil biodiversity and human health. Nature. 2015;528:69–76. doi: 10.1038/nature15744. [DOI] [PubMed] [Google Scholar]

[CR4] 4.Tedersoo L, et al. Global diversity and geography of soil fungi. Science. 2014;346:1256688. doi: 10.1126/science.1256688. [DOI] [PubMed] [Google Scholar]

[CR5] 5.Bahram M, et al. Structure and function of the global topsoil microbiome. Nature. 2018;560:233–237. doi: 10.1038/s41586-018-0386-6. [DOI] [PubMed] [Google Scholar]

[CR6] 6.Egidi E, et al. A few Ascomycota taxa dominate soil fungal communities worldwide. Nature Commun. 2019;10:2369. doi: 10.1038/s41467-019-10373-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR7] 7.Nilsson RH, et al. Mycobiome diversity: high-throughput sequencing and identification of fungi. Nature Rev. Microbiol. 2019;17:95–109. doi: 10.1038/s41579-018-0116-y. [DOI] [PubMed] [Google Scholar]

[CR8] 8.Větrovský T, et al. A meta-analysis of global fungal distribution reveals climate-driven patterns. Nature Commun. 2019;10:5142. doi: 10.1038/s41467-019-13164-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR9] 9.Vlk, L. et al. Early successional ectomycorrhizal fungi are more likely to naturalize outside their native range than other ectomycorrhizal fungi. New Phytol., 10.1111/nph.16557 (2020). [DOI] [PubMed]

[CR10] 10.Thompson LR, et al. A communal catalogue reveals Earth’s multiscale microbial diversity. Nature. 2017;551:457–463. doi: 10.1038/nature24621. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR11] 11.Schoch CL, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA. 2012;109:6241–6246. doi: 10.1073/pnas.1117018109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR12] 12.Nilsson RH, et al. The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019;47:D259–D264. doi: 10.1093/nar/gky1022. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR13] 13.Bengtsson-Palme J, et al. Improved software detection and extraction of ITS1 and ITS2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. Meth. Ecol. Evol. 2013;4:914–919. [Google Scholar]

[CR14] 14.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]

[CR15] 15.Karger DN, et al. Data Descriptor: Climatologies at high resolution for the earth’s land surface areas. Scientific Data. 2017;4:170122. doi: 10.1038/sdata.2017.122. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR16] 16.Fick SE, Hijmans RJ. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 2017;37:4302–4315. [Google Scholar]

[CR17] 17.Baldrian P, 2020. GlobalFungi: Global database of fungal records from high-throughput-sequencing metabarcoding studies. figshare. [DOI] [PMC free article] [PubMed]

[CR18] 18.Anslan S, et al. Great differences in performance and outcome of high-throughput sequencing data analysis platforms for fungal metabarcoding. Mycokeys. 2018;39:29–40. doi: 10.3897/mycokeys.39.28109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR19] 19.2010. NCBI Sequence Read Archive. SRP001058

[CR20] 20.Jumpponen A, Jones KL. Seasonally dynamic fungal communities in the Quercus macrocarpa phyllosphere differ between urban and nonurban environments. New Phytol. 2010;186:496–513. doi: 10.1111/j.1469-8137.2010.03197.x. [DOI] [PubMed] [Google Scholar]

[CR21] 21.2010. NCBI Sequence Read Archive. SRP001175

[CR22] 22.Jumpponen A, Jones KL, Mattox JD, Yaege C. Massively parallel 454-sequencing of fungal communities in Quercus spp ectomycorrhizas indicates seasonal dynamics in urban and rural sites. Mol. Ecol. 2010;19:41–53. doi: 10.1111/j.1365-294X.2009.04483.x. [DOI] [PubMed] [Google Scholar]

[CR23] 23.2011. NCBI Sequence Read Archive. SRP006078

[CR24] 24.Mello A, et al. ITS-1 versus ITS-2 pyrosequencing: a comparison of fungal populations in truffle grounds. Mycologia. 2011;103:1184–1193. doi: 10.3852/11-027. [DOI] [PubMed] [Google Scholar]

[CR25] 25.2012. NCBI Sequence Read Archive. SRP012868

[CR26] 26.Ihrmark K, et al. New primers to amplify the fungal ITS2 region - evaluation by 454-sequencing of artificial and natural communities. FEMS Microbiol. Ecol. 2012;82:666–677. doi: 10.1111/j.1574-6941.2012.01437.x. [DOI] [PubMed] [Google Scholar]

[CR27] 27.2012. NCBI Sequence Read Archive. SRP013695

[CR28] 28.Zimmerman NB, Vitousek PM. Fungal endophyte communities reflect environmental structuring across a Hawaiian landscape. Proc. Natl. Acad. Sci. USA. 2012;109:13022–13027. doi: 10.1073/pnas.1209872109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR29] 29.2016. NCBI Sequence Read Archive. SRP013944

[CR30] 30.Uroz S, et al. Specific impacts of beech and Norway spruce on the structure and diversity of the rhizosphere and soil microbial communities. Sci. Rep. 2016;6:27756. doi: 10.1038/srep27756. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR31] 31.2015. NCBI Sequence Read Archive. SRP015735

[CR32] 32.Gao C, et al. Community assembly of ectomycorrhizal fungi along a subtropical secondary forest succession. New Phytol. 2015;205:771–785. doi: 10.1111/nph.13068. [DOI] [PubMed] [Google Scholar]

[CR33] 33.2015. NCBI Sequence Read Archive. SRP016090

[CR34] 34.Clemmensen KE, et al. Carbon sequestration is related to mycorrhizal fungal community shifts during long-term succession in boreal forests. New Phytol. 2015;205:1525–1536. doi: 10.1111/nph.13208. [DOI] [PubMed] [Google Scholar]

[CR35] 35.2014. NCBI Sequence Read Archive. SRP026207

[CR36] 36.De Beeck MO, et al. Comparison and validation of some ITS primer pairs useful for fungal metabarcoding studies. PLoS One. 2014;9:e97629. doi: 10.1371/journal.pone.0097629. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR37] 37.2015. NCBI Sequence Read Archive. SRP028404

[CR38] 38.De Beeck MO, et al. Impact of metal pollution on fungal diversity and community structures. Environ. Microbiol. 2015;17:2035–2047. doi: 10.1111/1462-2920.12547. [DOI] [PubMed] [Google Scholar]

[CR39] 39.2015. NCBI Sequence Read Archive. SRP033719

[CR40] 40.Chaput DL, Hansel CM, Burgos WD, Santelli CM. Profiling microbial communities in manganese remediation systems treating coal mine drainage. Appl. Environ. Microbiol. 2015;81:2189–2198. doi: 10.1128/AEM.03643-14. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR41] 41.2015. NCBI Sequence Read Archive. SRP035356

[CR42] 42.Sterkenburg E, Bahr A, Brandström Durling M, Clemmensen KE, Lindahl BD. Changes in fungal communities along a boreal forest soil fertility gradient. New Phytol. 2015;207:1145–1158. doi: 10.1111/nph.13426. [DOI] [PubMed] [Google Scholar]

[CR43] 43.2014. NCBI Sequence Read Archive. SRP040314

[CR44] 44.Talbot JM, et al. Endemism and functional convergence across the North American soil mycobiome. Proc. Natl. Acad. Sci. USA. 2014;111:6341–6346. doi: 10.1073/pnas.1402584111. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR45] 45.2015. NCBI Sequence Read Archive. SRP040786

[CR46] 46.Saravesi K, et al. Moth outbreaks alter root-associated fungal communities in subarctic mountain birch forests. Microb. Ecol. 2015;69:788–797. doi: 10.1007/s00248-015-0577-8. [DOI] [PubMed] [Google Scholar]

[CR47] 47.2015. NCBI Sequence Read Archive. SRP041347

[CR48] 48.Liu J, et al. Soil carbon content drives the biogeographical distribution of fungal communities in the black soil zone of northeast China. Soil Biol. Biochem. 2015;83:29–39. [Google Scholar]

[CR49] 49.2015. NCBI Sequence Read Archive. SRP043106

[CR50] 50.Hoppe B, et al. Linking molecular deadwood-inhabiting fungal diversity and community dynamics to ecosystem functions and processes in Central European forests. Fungal Divers. 2015;77:367–379. [Google Scholar]

[CR51] 51.2017. NCBI Sequence Read Archive. SRP043706

[CR52] 52.Hiiesalu I, Bahram M, Tedersoo L. Plant species richness and productivity determine the diversity of soil fungal guilds in temperate coniferous forest and bog habitats. Mol. Ecol. 2017;26:4846–4858. doi: 10.1111/mec.14246. [DOI] [PubMed] [Google Scholar]

[CR53] 53.Tedersoo L, et al. Tree diversity and species identity effects on soil fungi, protists and animals are context dependent. ISME J. 2016;10:346–362. doi: 10.1038/ismej.2015.116. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR54] 54.2015. NCBI Sequence Read Archive. SRP043982

[CR55] 55.Jarvis SG, Woodward S, Taylor AF. Strong altitudinal partitioning in the distributions of ectomycorrhizal fungi along a short (300 m) elevation gradient. New Phytol. 2015;206:1145–1155. doi: 10.1111/nph.13315. [DOI] [PubMed] [Google Scholar]

[CR56] 56.2016. NCBI Sequence Read Archive. SRP044665

[CR57] 57.Nacke H, et al. Fine spatial scale variation of soil microbial communities under European Beech and Norway Spruce. Front. Microbiol. 2016;7:2067. doi: 10.3389/fmicb.2016.02067. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR58] 58.2015. NCBI Sequence Read Archive. SRP045166

[CR59] 59.Rincón A, et al. Compartmentalized and contrasted response of ectomycorrhizal and soil fungal communities of Scots pine forests along elevation gradients in France and Spain. Environ. Microbiol. 2015;17:3009–3024. doi: 10.1111/1462-2920.12894. [DOI] [PubMed] [Google Scholar]

[CR60] 60.2016. NCBI Sequence Read Archive. SRP045587

[CR61] 61.Bahram M, et al. Stochastic distribution of small soil eukaryotes resulting from high dispersal and drift in a local environment. ISME J. 2016;10:885–896. doi: 10.1038/ismej.2015.164. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR62] 62.2014. NCBI Sequence Read Archive. SRP045746

[CR63] 63.Walker DM, et al. A metagenomics-based approach to the top-down effect on the detritivore food web: a salamanders influence on fungal communities within a deciduous forest. Ecol. Evol. 2014;4:4106–4116. doi: 10.1002/ece3.1259. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR64] 64.2015. NCBI Sequence Read Archive. SRP045933

[CR65] 65.Zhang T, Wei XL, Zhang YQ, Liu HY, Yu LY. Diversity and distribution of lichen-associated fungi in the Ny-Alesund Region (Svalbard, High Arctic) as revealed by 454 pyrosequencing. Sci. Rep. 2015;5:14850. doi: 10.1038/srep14850. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR66] 66.2016. NCBI Sequence Read Archive. SRP046049

[CR67] 67.Oh SY, Fong JJ, Park MS, Lim YW. Distinctive feature of microbial communities and bacterial functional profiles in Tricholoma matsutake dominant soil. PLoS One. 2016;11:e0168573. doi: 10.1371/journal.pone.0168573. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR68] 68.2016. NCBI Sequence Read Archive. SRP048036

[CR69] 69.Yang T, et al. Carbon constrains fungal endophyte assemblages along the timberline. Environ. Microbiol. 2016;18:2455–2469. doi: 10.1111/1462-2920.13153. [DOI] [PubMed] [Google Scholar]

[CR70] 70.Yang T, Sun H, Shen C, Chu H. Fungal assemblages in different habitats in an Erman’s Birch forest. Front. Microbiol. 2016;7:1368. doi: 10.3389/fmicb.2016.01368. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR71] 71.2015. NCBI Sequence Read Archive. SRP048856

[CR72] 72.Elliott DR, Caporn SJ, Nwaishi F, Nilsson RH, Sen R. Bacterial and fungal communities in a degraded ombrotrophic peatland undergoing natural and managed re-vegetation. PLoS One. 2015;10:e0124726. doi: 10.1371/journal.pone.0124726. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR73] 73.2015. NCBI Sequence Read Archive. SRP049544

[CR74] 74.Goldmann K, Schöning I, Buscot F, Wubet T. Forest management type influences diversity and community composition of soil fungi across temperate forest ecosystems. Front. Microbiol. 2015;6:1300. doi: 10.3389/fmicb.2015.01300. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR75] 75.2016. NCBI Sequence Read Archive. SRP051033

[CR76] 76.Roy-Bolduc A, Laliberté E, Boudreau S, Hijri M. Strong linkage between plant and soil fungal communities along a successional coastal dune system. FEMS Microbiol. Ecol. 2016;92:fiw156. doi: 10.1093/femsec/fiw156. [DOI] [PubMed] [Google Scholar]

[CR77] 77.2017. NCBI Sequence Read Archive. SRP052222

[CR78] 78.Fernández-Martínez MA, et al. Microbial succession dynamics along glacier forefield chronosequences in Tierra del Fuego (Chile) Polar Biol. 2017;40:1939–1957. [Google Scholar]

[CR79] 79.2015. NCBI Sequence Read Archive. SRP052716

[CR80] 80.Leff JW, et al. Consistent responses of soil microbial communities to elevated nutrient inputs in grasslands across the globe. Proc. Natl. Acad. Sci. USA. 2015;112:10967–10972. doi: 10.1073/pnas.1508382112. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR81] 81.2015. NCBI Sequence Read Archive. SRP055957

[CR82] 82.Tedersoo L, et al. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. Mycokeys. 2015;10:1–43. [Google Scholar]

[CR83] 83.2016. NCBI Sequence Read Archive. SRP057433

[CR84] 84.Wang W, Zhai Y, Cao L, Tan H, Zhang R. Endophytic bacterial and fungal microbiota in sprouts, roots and stems of rice (Oryza sativa L.) Microbiol. Res. 2016;188:1–8. doi: 10.1016/j.micres.2016.04.009. [DOI] [PubMed] [Google Scholar]

[CR85] 85.2016. NCBI Sequence Read Archive. SRP057541

[CR86] 86.Waring BG, Adams R, Branco S, Powers JS. Scale-dependent variation in nitrogen cycling and soil fungal communities along gradients of forest composition and age in regenerating tropical dry forests. New Phytol. 2016;209:845–854. doi: 10.1111/nph.13654. [DOI] [PubMed] [Google Scholar]

[CR87] 87.2016. NCBI Sequence Read Archive. SRP058508

[CR88] 88.Glassman SI, Levine CR, DiRocco AM, Battles JJ, Bruns TD. Ectomycorrhizal fungal spore bank recovery after a severe forest fire: some like it hot. ISME J. 2016;10:1228–1239. doi: 10.1038/ismej.2015.182. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR89] 89.2016. NCBI Sequence Read Archive. SRP058555

[CR90] 90.De Gannes V, et al. Microbial community structure and function of soil following ecosystem conversion from native forests to Teak plantation forests. Front. Microbiol. 2016;7:1976. doi: 10.3389/fmicb.2016.01976. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR91] 91.2018. NCBI Sequence Read Archive. SRP058851

[CR92] 92.Bach EM, Williams RJ, Hargreaves SK, Yang F, Hofmockel KS. Greatest soil microbial diversity found in micro-habitats. Soil Biol. Biochem. 2018;118:217–226. [Google Scholar]

[CR93] 93.2016. NCBI Sequence Read Archive. SRP059280

[CR94] 94.Roy‐Bolduc A, Laliberté E, Hijri M. High richness of ectomycorrhizal fungi and low host specificity in a coastal sand dune ecosystem revealed by network analysis. Ecol. Evol. 2016;6:349–362. doi: 10.1002/ece3.1881. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR95] 95.2016. NCBI Sequence Read Archive. SRP060838

[CR96] 96.He F, et al. Changes in composition and diversity of fungal communities along Quercus mongolica forests developments in Northeast China. Appl. Soil Ecol. 2016;100:162–171. [Google Scholar]

[CR97] 97.2016. NCBI Sequence Read Archive. SRP061179

[CR98] 98.Valverde A, et al. Specific microbial communities associate with the rhizosphere of Welwitschia mirabilis, a living fossil. PLoS One. 2016;11:e0153353. doi: 10.1371/journal.pone.0153353. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR99] 99.2017. NCBI Sequence Read Archive. SRP061305

[CR100] 100.Yao F, et al. Microbial taxa distribution is associated with ecological trophic cascades along an elevation gradient. Front. Microbiol. 2017;8:2071. doi: 10.3389/fmicb.2017.02071. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR101] 101.2015. NCBI Sequence Read Archive. SRP061904

[CR102] 102.Veach AM, Dodds WK, Jumpponen A. Woody plant encroachment, and its removal, impact bacterial and fungal communities across stream and terrestrial habitats in a tallgrass prairie ecosystem. FEMS Microbiol. Ecol. 2015;91:fiv109. doi: 10.1093/femsec/fiv109. [DOI] [PubMed] [Google Scholar]

[CR103] 103.2016. NCBI Sequence Read Archive. SRP062647

[CR104] 104.Newsham KK, et al. Relationship between soil fungal diversity and temperature in the maritime Antarctic. Nat. Clim. Change. 2016;6:182. [Google Scholar]

[CR105] 105.2017. NCBI Sequence Read Archive. SRP063711

[CR106] 106.Poosakkannu A, Nissinen R, Männistö M, Kytöviita MM. Microbial community composition but not diversity changes along succession in arctic sand dunes. Environ. Microbiol. 2017;19:698–709. doi: 10.1111/1462-2920.13599. [DOI] [PubMed] [Google Scholar]

[CR107] 107.2017. NCBI Sequence Read Archive. SRP064158

[CR108] 108.Tian J, et al. Patterns and drivers of fungal diversity along an altitudinal gradient on Mount Gongga, China. J. Soil. Sediment. 2017;17:2856–2865. [Google Scholar]

[CR109] 109.2017. NCBI Sequence Read Archive. SRP065817

[CR110] 110.Zhang W, Lu Z, Yang K, Zhu J. Impacts of conversion from secondary forests to larch plantations on the structure and function of microbial communities. Appl. Soil Ecol. 2017;111:73–83. [Google Scholar]

[CR111] 111.2016. NCBI Sequence Read Archive. SRP066030

[CR112] 112.Porter TM, Shokralla S, Baird D, Golding GB, Hajibabaei M. Ribosomal DNA and plastid markers used to sample fungal and plant communities from wetland soils reveals complementary biotas. PLoS One. 2016;11:e0142759. doi: 10.1371/journal.pone.0142759. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR113] 113.2017. NCBI Sequence Read Archive. SRP066284

[CR114] 114.Wang M, et al. Influence of Peanut cultivars and environmental conditions on the diversity and community composition of Pod Rot soil fungi in China. Mycobiology. 2017;45:392–400. doi: 10.5941/MYCO.2017.45.4.392. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR115] 115.2017. NCBI Sequence Read Archive. SRP066331

[CR116] 116.Delgado‐Baquerizo M, et al. Soil microbial communities drive the resistance of ecosystem multifunctionality to global change in drylands across the globe. Ecol. Lett. 2017;20:1295–1305. doi: 10.1111/ele.12826. [DOI] [PubMed] [Google Scholar]

[CR117] 117.2017. NCBI Sequence Read Archive. SRP067301

[CR118] 118.Cross H, et al. Fungal diversity and seasonal succession in ash leaves infected by the invasive ascomycete Hymenoscyphus fraxineus. New Phytol. 2017;213:1405–1417. doi: 10.1111/nph.14204. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR119] 119.2016. NCBI Sequence Read Archive. SRP067367

[CR120] 120.Zhang T, Wang NF, Liu HY, Zhang YQ, Yu LY. Soil pH is a key determinant of soil fungal community composition in the Ny-Alesund region, Svalbard (High Arctic) Front. Microbiol. 2016;7:227. doi: 10.3389/fmicb.2016.00227. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR121] 121.2016. NCBI Sequence Read Archive. SRP068514

[CR122] 122.Gehring CA, et al. Cheatgrass invasion alters the abundance and composition of dark septate fungal communities in sagebrush steppe. Botany. 2016;94:481–491. [Google Scholar]

[CR123] 123.2016. NCBI Sequence Read Archive. SRP068608

[CR124] 124.Li Y, et al. Changes of soil microbial community under different degraded gradients of alpine meadow. Agric. Ecosyst. Environ. 2016;222:213–222. [Google Scholar]

[CR125] 125.2016. NCBI Sequence Read Archive. SRP068620

[CR126] 126.Zhou J, et al. Temperature mediates continental-scale diversity of microbes in forest soils. Nat. Commun. 2016;7:12083. doi: 10.1038/ncomms12083. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR127] 127.2016. NCBI Sequence Read Archive. SRP068654

[CR128] 128.Cox F, Newsham KK, Bol R, Dungait JA, Robinson CH. Not poles apart: Antarctic soil fungal communities show similarities to those of the distant Arctic. Ecol. Lett. 2016;19:528–536. doi: 10.1111/ele.12587. [DOI] [PubMed] [Google Scholar]

[CR129] 129.2017. NCBI Sequence Read Archive. SRP069065

[CR130] 130.Bergottini VM, et al. Exploring the diversity of the root-associated microbiome of Ilex paraguariensis St. Hil. (Yerba Mate) Appl. Soil Ecol. 2017;109:23–31. [Google Scholar]

[CR131] 131.2017. NCBI Sequence Read Archive. SRP069742

[CR132] 132.Moussa TA, Al-Zahrani HS, Almaghrabi OA, Abdelmoneim TS, Fuller MP. Comparative metagenomics approaches to characterize the soil fungal communities of western coastal region, Saudi Arabia. PLoS One. 2017;12:e0185096. doi: 10.1371/journal.pone.0185096. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR133] 133.2016. NCBI Sequence Read Archive. SRP070568

[CR134] 134.Goldmann K, et al. Divergent habitat filtering of root and soil fungal communities in temperate beech forests. Sci. Rep. 2016;11:31439. doi: 10.1038/srep31439. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR135] 135.2016. NCBI Sequence Read Archive. SRP073070

[CR136] 136.Liu C, et al. The influence of soil properties on the size and structure of bacterial and fungal communities along a paddy soil chronosequence. Eur. J. Soil Biol. 2016;76:9–18. [Google Scholar]

[CR137] 137.2017. NCBI Sequence Read Archive. SRP073265

[CR138] 138.Smith ME, et al. Investigating niche partitioning of ectomycorrhizal fungi in specialized rooting zones of the monodominant leguminous tree Dicymbe corymbosa. New Phytol. 2017;215:443–453. doi: 10.1111/nph.14570. [DOI] [PubMed] [Google Scholar]

[CR139] 139.2016. NCBI Sequence Read Archive. SRP074055

[CR140] 140.Bissett A, et al. Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. GigaScience. 2016;5:21. doi: 10.1186/s13742-016-0126-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR141] 141.2016. NCBI Sequence Read Archive. SRP074496

[CR142] 142.Vannette RL, Leopold DR, Fukami T. Forest area and connectivity influence root-associated fungal communities in a fragmented landscape. Ecology. 2016;97:2374–2383. doi: 10.1002/ecy.1472. [DOI] [PubMed] [Google Scholar]

[CR143] 143.2017. NCBI Sequence Read Archive. SRP075989

[CR144] 144.Zhou X, et al. Rhizospheric fungi and their link with the nitrogen-fixing Frankia harbored in host plant Hippophae rhamnoides L. J. Basic Microbiol. 2017;57:1055–1064. doi: 10.1002/jobm.201700312. [DOI] [PubMed] [Google Scholar]

[CR145] 145.2017. NCBI Sequence Read Archive. SRP079403

[CR146] 146.Glassman SI, Wang IJ, Bruns TD. Environmental filtering by pH and soil nutrients drives community assembly in fungi at fine spatial scales. Mol. Ecol. 2017;26:6960–6973. doi: 10.1111/mec.14414. [DOI] [PubMed] [Google Scholar]

[CR147] 147.2018. NCBI Sequence Read Archive. SRP079521

[CR148] 148.Cline LC, Schilling JS, Menke J, Groenhof E, Kennedy PG. Ecological and functional effects of fungal endophytes on wood decomposition. Funct. Ecol. 2018;32:181–191. [Google Scholar]

[CR149] 149.2016. NCBI Sequence Read Archive. SRP080210

[CR150] 150.Johansen RB, et al. A native and an invasive dune grass share similar, patchily distributed, root-associated fungal communities. Fungal Ecol. 2016;23:141–155. [Google Scholar]

[CR151] 151.2017. NCBI Sequence Read Archive. SRP080428

[CR152] 152.Zhang S, Chen X, Zhong Q, Huang Z, Bai Z. Relations among epiphytic microbial communities from soil, leaves and grapes of the grapevine. Front. Life Sci. 2017;10:73–83. [Google Scholar]

[CR153] 153.2017. NCBI Sequence Read Archive. SRP080680

[CR154] 154.Fernandez CW, et al. Ectomycorrhizal fungal response to warming is linked to poor host performance at the boreal-temperate ecotone. Glob. Change Biol. 2017;23:1598–1609. doi: 10.1111/gcb.13510. [DOI] [PubMed] [Google Scholar]

[CR155] 155.2017. NCBI Sequence Read Archive. SRP082472

[CR156] 156.Zhang Z, et al. Fungal communities in ancient peatlands developed from different periods in the Sanjiang Plain, China. PLoS One. 2017;12:e0187575. doi: 10.1371/journal.pone.0187575. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR157] 157.2017. NCBI Sequence Read Archive. SRP082976

[CR158] 158.Gomes SI, Merckx VS, Saavedra S. Fungal-host diversity among mycoheterotrophic plants increases proportionally to their fungal-host overlap. Ecol. Evol. 2017;7:3623–3630. doi: 10.1002/ece3.2974. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR159] 159.2017. NCBI Sequence Read Archive. SRP083394

[CR160] 160.Zhou X, et al. Conversion from long-term cultivated wheat field to Jerusalem artichoke plantation changed soil fungal communities. Sci. Rep. 2017;7:41502. doi: 10.1038/srep41502. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR161] 161.2017. NCBI Sequence Read Archive. SRP083434

[CR162] 162.2017. NCBI Sequence Read Archive. SRP083901

[CR163] 163.Gomes SI, Aguirre‐Gutiérrez J, Bidartondo MI, Merckx VS. Arbuscular mycorrhizal interactions of mycoheterotrophic Thismia are more specialized than in autotrophic plants. New Phytol. 2017;213:1418–1427. doi: 10.1111/nph.14249. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR164] 164.2017. NCBI Sequence Read Archive. SRP087715

[CR165] 165.Tian H, et al. Changes in soil microbial communities after 10 years of winter wheat cultivation versus fallow in an organic-poor soil in the Loess Plateau of China. PLoS One. 2017;12:e0184223. doi: 10.1371/journal.pone.0184223. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR166] 166.2016. NCBI Sequence Read Archive. SRP090261

[CR167] 167.Gourmelon V, et al. Environmental and geographical factors structure soil microbial diversity in New Caledonian ultramafic substrates: a metagenomic approach. PLoS One. 2016;11:e0167405. doi: 10.1371/journal.pone.0167405. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR168] 168.2017. NCBI Sequence Read Archive. SRP090335

[CR169] 169.Younginger BS, Ballhorn DJ. Fungal endophyte communities in the temperate fern Polystichum munitum show early colonization and extensive temporal turnover. Am. J. Bot. 2017;104:1188–1194. doi: 10.3732/ajb.1700149. [DOI] [PubMed] [Google Scholar]

[CR170] 170.2017. NCBI Sequence Read Archive. SRP090490

[CR171] 171.Kamutando CN, et al. Soil nutritional status and biogeography influence rhizosphere microbial communities associated with the invasive tree Acacia dealbata. Sci. Rep. 2017;7:6472. doi: 10.1038/s41598-017-07018-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR172] 172.2017. NCBI Sequence Read Archive. SRP090651

[CR173] 173.Anthony MA, Frey SD, Stinson KA. Fungal community homogenization, shift in dominant trophic guild, and appearance of novel taxa with biotic invasion. Ecosphere. 2017;8:e01951. [Google Scholar]

[CR174] 174.2017. NCBI Sequence Read Archive. SRP091741

[CR175] 175.Ge ZW, Brenneman T, Bonito G, Smith ME. Soil pH and mineral nutrients strongly influence truffles and other ectomycorrhizal fungi associated with commercial pecans (Carya illinoinensis) Plant Soil. 2017;418:493–505. [Google Scholar]

[CR176] 176.2018. NCBI Sequence Read Archive. SRP091855

[CR177] 177.Mirmajlessi SM, et al. Survey of soil fungal communities in Strawberry fields by Illumina amplicon sequencing. Eurasian Soil Sci. 2018;51:682–691. [Google Scholar]

[CR178] 178.2016. NCBI Sequence Read Archive. SRP091867

[CR179] 179.Harrison JG, Forister ML, Parchman TL, Koch GW. Vertical stratification of the foliar fungal community in the world’s tallest trees. Am. J. Bot. 2016;103:2087–2095. doi: 10.3732/ajb.1600277. [DOI] [PubMed] [Google Scholar]

[CR180] 180.2019. NCBI Sequence Read Archive. SRP092609

[CR181] 181.Semenova‐Nelsen TA, Platt WJ, Patterson TR, Huffman J, Sikes BA. Frequent fire reorganizes fungal communities and slows decomposition across a heterogeneous pine savanna landscape. New Phytol. 2019;224:916–927. doi: 10.1111/nph.16096. [DOI] [PubMed] [Google Scholar]

[CR182] 182.2017. NCBI Sequence Read Archive. SRP092777

[CR183] 183.Dean SL, et al. A study of Glycine max (soybean) fungal communities under different agricultural practices. Plant Gene. 2017;11:8–16. [Google Scholar]

[CR184] 184.2017. NCBI Sequence Read Archive. SRP093592

[CR185] 185.Kyaschenko J, Clemmensen KE, Hagenbo A, Karltun E, Lindahl BD. Shift in fungal communities and associated enzyme activities along an age gradient of managed Pinus sylvestris stands. ISME J. 2017;11:863–874. doi: 10.1038/ismej.2016.184. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR186] 186.2017. NCBI Sequence Read Archive. SRP093928

[CR187] 187.Tian J, et al. Ecological succession pattern of fungal community in soil along a retreating glacier. Front. Microbiol. 2017;8:1028. doi: 10.3389/fmicb.2017.01028. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR188] 188.2017. NCBI Sequence Read Archive. SRP094708

[CR189] 189.Oono R, Rasmussen A, Lefèvre E. Distance decay relationships in foliar fungal endophytes are driven by rare taxa. Environ. Microbiol. 2017;19:2794–2805. doi: 10.1111/1462-2920.13799. [DOI] [PubMed] [Google Scholar]

[CR190] 190.Oono R. A confidence interval analysis of sampling effort, sequencing depth, and taxonomic resolution of fungal community ecology in the era of high-throughput sequencing. PLoS One. 2017;12:e0189796. doi: 10.1371/journal.pone.0189796. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR191] 191.2017. NCBI Sequence Read Archive. SRP097883

[CR192] 192.Marín C, et al. Functional land-use change effects on soil fungal communities in Chilean temperate rainforests. J. Soil Sci. Plant Nut. 2017;17:985–1002. [Google Scholar]

[CR193] 193.2017. NCBI Sequence Read Archive. SRP101553

[CR194] 194.Siles JA, Margesin R. Seasonal soil microbial responses are limited to changes in functionality at two Alpine forest sites differing in altitude and vegetation. Sci. Rep. 2017;7:2204. doi: 10.1038/s41598-017-02363-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR195] 195.2018. NCBI Sequence Read Archive. SRP101605

[CR196] 196.Kazartsev I, Shorohova E, Kapitsa E, Kushnevskaya H. Decaying Picea abies log bark hosts diverse fungal communities. Fungal Ecol. 2018;33:1–12. [Google Scholar]

[CR197] 197.2017. NCBI Sequence Read Archive. SRP102378

[CR198] 198.Peay KG, et al. Convergence and contrast in the community structure of bacteria, fungi and archaea along a tropical elevation-climate gradient. FEMS Microbiol. Ecol. 2017;93:fix045. doi: 10.1093/femsec/fix045. [DOI] [PubMed] [Google Scholar]

[CR199] 199.2018. NCBI Sequence Read Archive. SRP102417

[CR200] 200.Coleine C, et al. Antarctic cryptoendolithic fungal communities are highly adapted and dominated by Lecanoromycetes and Dothideomycetes. Front. Microbiol. 2018;9:1392. doi: 10.3389/fmicb.2018.01392. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR201] 201.2018. NCBI Sequence Read Archive. SRP102775

[CR202] 202.Park MS, et al. Diversity of fungi associated with roots of Calanthe orchid species in Korea. J. Microbiol. 2018;56:49–55. doi: 10.1007/s12275-018-7319-9. [DOI] [PubMed] [Google Scholar]

[CR203] 203.2018. NCBI Sequence Read Archive. SRP106137

[CR204] 204.Glynou K, Nam B, Thines M, Maciá‐Vicente JG. Facultative root-colonizing fungi dominate endophytic assemblages in roots of nonmycorrhizal Microthlaspi species. New Phytol. 2018;217:1190–1202. doi: 10.1111/nph.14873. [DOI] [PubMed] [Google Scholar]

[CR205] 205.2018. NCBI Sequence Read Archive. SRP106774

[CR206] 206.Saitta A, Anslan S, Bahram M, Brocca L, Tedersoo L. Tree species identity and diversity drive fungal richness and community composition along an elevational gradient in a Mediterranean ecosystem. Mycorrhiza. 2018;28:39–47. doi: 10.1007/s00572-017-0806-8. [DOI] [PubMed] [Google Scholar]

[CR207] 207.2017. NCBI Sequence Read Archive. SRP107174

[CR208] 208.Almario J, et al. Root-associated fungal microbiota of nonmycorrhizal Arabis alpina and its contribution to plant phosphorus nutrition. Proc. Natl. Acad. Sci. USA. 2017;114:E9403–E9412. doi: 10.1073/pnas.1710455114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR209] 209.2017. NCBI Sequence Read Archive. SRP107743

[CR210] 210.Fernández‐Mendoza F, Fleischhacker A, Kopun T, Grube M, Muggia L. ITS1 metabarcoding highlights low specificity of lichen mycobiomes at a local scale. Mol. Ecol. 2017;26:4811–4830. doi: 10.1111/mec.14244. [DOI] [PubMed] [Google Scholar]

[CR211] 211.2017. NCBI Sequence Read Archive. SRP109164

[CR212] 212.Varenius K, Lindahl BD, Dahlberg A. Retention of seed trees fails to lifeboat ectomycorrhizal fungal diversity in harvested Scots pine forests. FEMS Microbiol. Ecol. 2017;93:fix105. doi: 10.1093/femsec/fix105. [DOI] [PubMed] [Google Scholar]

[CR213] 213.2017. NCBI Sequence Read Archive. SRP109773

[CR214] 214.He D, et al. Diversity and co-occurrence network of soil fungi are more responsive than those of bacteria to shifts in precipitation seasonality in a subtropical forest. Soil Biol. Biochem. 2017;115:499–510. [Google Scholar]

[CR215] 215.2017. NCBI Sequence Read Archive. SRP110522

[CR216] 216.Mendoza JR, Kok CR, Stratton J, Bianchini A, Hallen-Adams HE. Understanding the mycobiota of maize from the highlands of Guatemala, and implications for maize quality and safety. Crop Prot. 2017;101:5–11. [Google Scholar]

[CR217] 217.2017. NCBI Sequence Read Archive. SRP110810

[CR218] 218.Miura T, Sánchez R, Castañeda LE, Godoy K, Barbosa O. Is microbial terroir related to geographic distance between vineyards? Environ. Microbiol. Rep. 2017;9:742–749. doi: 10.1111/1758-2229.12589. [DOI] [PubMed] [Google Scholar]

[CR219] 219.2018. NCBI Sequence Read Archive. SRP113348

[CR220] 220.Zhang J, et al. Distinct large-scale biogeographic patterns of fungal communities in bulk soil and soybean rhizosphere in China. Sci. Total Environ. 2018;644:791–800. doi: 10.1016/j.scitotenv.2018.07.016. [DOI] [PubMed] [Google Scholar]

[CR221] 221.2017. NCBI Sequence Read Archive. SRP114697

[CR222] 222.Sharma-Poudyal D, Schlatter D, Yin C, Hulbert S, Paulitz T. Long-term no-till: A major driver of fungal communities in dryland wheat cropping systems. PLoS One. 2017;12:e0184611. doi: 10.1371/journal.pone.0184611. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR223] 223.2018. NCBI Sequence Read Archive. SRP114821

[CR224] 224.Ren C, et al. Differential responses of soil microbial biomass, diversity, and compositions to altitudinal gradients depend on plant and soil characteristics. Sci. Total Environ. 2018;610:750–758. doi: 10.1016/j.scitotenv.2017.08.110. [DOI] [PubMed] [Google Scholar]

[CR225] 225.2018. NCBI Sequence Read Archive. SRP115350

[CR226] 226.Schneider-Maunoury L, et al. Is Tuber melanosporum colonizing the roots of herbaceous, non-ectomycorrhizal plants? Fungal Ecol. 2018;31:59–68. [Google Scholar]

[CR227] 227.2018. NCBI Sequence Read Archive. SRP115464

[CR228] 228.Sapkota R, Nicolaisen M. Cropping history shapes fungal, oomycete and nematode communities in arable soils and affects cavity spot in carrot. Agric. Ecosyst. Environ. 2018;257:120–131. [Google Scholar]

[CR229] 229.2018. NCBI Sequence Read Archive. SRP115599

[CR230] 230.Schroeder JW, et al. Community composition and diversity of Neotropical root‐associated fungi in common and rare trees. Biotropica. 2018;50:694–703. [Google Scholar]

[CR231] 231.2018. NCBI Sequence Read Archive. SRP117302

[CR232] 232.Fan K, Weisenhorn P, Gilbert JA, Chu H. Wheat rhizosphere harbors a less complex and more stable microbial co-occurrence pattern than bulk soil. Soil Biol. Biochem. 2018;125:251–260. [Google Scholar]

[CR233] 233.2018. NCBI Sequence Read Archive. SRP118875

[CR234] 234.Montagna M, et al. Differential biodiversity responses between kingdoms (plants, fungi, bacteria and metazoa) along an Alpine succession gradient. Mol. Ecol. 2018;27:3671–3685. doi: 10.1111/mec.14817. [DOI] [PubMed] [Google Scholar]

[CR235] 235.2018. NCBI Sequence Read Archive. SRP118960

[CR236] 236.Schön ME, Nieselt K, Garnica S. Belowground fungal community diversity and composition associated with Norway spruce along an altitudinal gradient. PLoS One. 2018;13:e0208493. doi: 10.1371/journal.pone.0208493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR237] 237.2017. NCBI Sequence Read Archive. SRP119174

[CR238] 238.Thiem D, Piernik A, Hrynkiewicz K. Ectomycorrhizal and endophytic fungi associated with Alnus glutinosa growing in a saline area of central Poland. Symbiosis. 2017;75:17–28. doi: 10.1007/s13199-017-0512-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR239] 239.2016. NCBI Sequence Read Archive. SRP125864

[CR240] 240.Barnes CJ, Maldonado C, Frøslev TG, Antonelli A, Rønsted N. Unexpectedly high beta-diversity of root-associated fungal communities in the Bolivian Andes. Front. Microbiol. 2016;7:1377. doi: 10.3389/fmicb.2016.01377. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR241] 241.2018. NCBI Sequence Read Archive. SRP132277

[CR242] 242.Schlatter DC, Kahl K, Carlson B, Huggins DR, Paulitz T. Fungal community composition and diversity vary with soil depth and landscape position in a no-till wheat-based cropping system. FEMS Microbiol. Ecol. 2018;94:fiy098. doi: 10.1093/femsec/fiy098. [DOI] [PubMed] [Google Scholar]

[CR243] 243.2018. NCBI Sequence Read Archive. SRP132591

[CR244] 244.Rasmussen PU, et al. Multiscale patterns and drivers of arbuscular mycorrhizal fungal communities in the roots and root-associated soil of a wild perennial herb. New Phytol. 2018;220:1248–1261. doi: 10.1111/nph.15088. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR245] 245.2018. NCBI Sequence Read Archive. SRP132598

[CR246] 246.2012. NCBI Sequence Read Archive. SRP136886

[CR247] 247.Guo J, et al. Soil fungal assemblage complexity is dependent on soil fertility and dominated by deterministic processes. New Phytol. 2019;226:232–243. doi: 10.1111/nph.16345. [DOI] [PubMed] [Google Scholar]

[CR248] 248.2019. NCBI Sequence Read Archive. SRP139483

[CR249] 249.Song H, et al. Tropical forest conversion to rubber plantation in southwest China results in lower fungal beta diversity and reduced network complexity. FEMS Microbiol. Ecol. 2019;95:fiz092. doi: 10.1093/femsec/fiz092. [DOI] [PubMed] [Google Scholar]

[CR250] 250.2018. NCBI Sequence Read Archive. SRP142723

[CR251] 251.Rogers TJ, et al. Exploring variation in phyllosphere microbial communities across four hemlock species. Ecosphere. 2018;9:e02524. [Google Scholar]

[CR252] 252.2018. NCBI Sequence Read Archive. SRP148813

[CR253] 253.Schlegel M, Queloz V, Sieber TN. The endophytic mycobiome of European Ash and Sycamore Maple leaves – geographic patterns, host specificity and influence of Ash Dieback. Front. Microbiol. 2018;9:2345. doi: 10.3389/fmicb.2018.02345. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR254] 254.2019. NCBI Sequence Read Archive. SRP150527

[CR255] 255.Truong C, et al. Ectomycorrhizal fungi and soil enzymes exhibit contrasting patterns along elevation gradients in southern Patagonia. New Phytol. 2019;222:1936–1950. doi: 10.1111/nph.15714. [DOI] [PubMed] [Google Scholar]

[CR256] 256.2018. NCBI Sequence Read Archive. SRP151262

[CR257] 257.Jiao S, et al. Soil microbiomes with distinct assemblies through vertical soil profiles drive the cycling of multiple nutrients in reforested ecosystems. Microbiome. 2018;6:146. doi: 10.1186/s40168-018-0526-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR258] 258.2018. NCBI Sequence Read Archive. SRP153934

[CR259] 259.Marasco R, et al. Rhizosheath microbial community assembly of sympatric desert speargrasses is independent of the plant host. Microbiome. 2018;6:215. doi: 10.1186/s40168-018-0597-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR260] 260.2018. NCBI Sequence Read Archive. SRP160913

[CR261] 261.Bickford WA, Goldberg DE, Kowalski KP, Zak DR. Root endophytes and invasiveness: no difference between native and non‐native Phragmites in the Great Lakes region. Ecosphere. 2018;9:e02526. [Google Scholar]

[CR262] 262.2018. NCBI Sequence Read Archive. SRP161632

[CR263] 263.Si P, et al. Rhizosphere microenvironments of eight common deciduous fruit trees were shaped by microbes in Northern China. Front. Microbiol. 2018;9:3147. doi: 10.3389/fmicb.2018.03147. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR264] 264.2019. NCBI Sequence Read Archive. SRP195764

[CR265] 265.Purahong W, Wu YT, Chen CT, Mapook A. Characterization of the Castanopsis carlesii deadwood mycobiome by Pacbio sequencing of the full-length fungal nuclear ribosomal internal transcribed spacer (ITS) Front. Microbiol. 2019;10:983. doi: 10.3389/fmicb.2019.00983. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR266] 266.2014. European Nucleotide Archive. ERP001713

[CR267] 267.Geml J, et al. The contribution of DNA metabarcoding to fungal conservation: diversity assessment, habitat partitioning and mapping red-listed fungi in protected coastal Salix repens communities in the Netherlands. PLoS One. 2014;9:e99852. doi: 10.1371/journal.pone.0099852. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR268] 268.2013. European Nucleotide Archive. ERP003251

[CR269] 269.Schmidt PA, et al. Illumina metabarcoding of a soil fungal community. Soil Biol. Biochem. 2013;65:128–132. [Google Scholar]

[CR270] 270.2015. European Nucleotide Archive. ERP003790

[CR271] 271.van der Wal A, Ottosson E, De Boer W. Neglected role of fungal community composition in explaining variation in wood decay rates. Ecology. 2015;96:124–133. doi: 10.1890/14-0242.1. [DOI] [PubMed] [Google Scholar]

[CR272] 272.2015. European Nucleotide Archive. ERP005177

[CR273] 273.Muller LA, Hilger HH. Insights into the effects of serpentine soil conditions on the community composition of fungal symbionts in the roots of Onosma echioides. Soil Biol. Biochem. 2015;81:1–8. [Google Scholar]

[CR274] 274.2015. European Nucleotide Archive. ERP005905

[CR275] 275.Sun H, et al. Fungal community shifts in structure and function across a boreal forest fire chronosequence. Appl. Environ. Microbiol. 2015;81:7869–7880. doi: 10.1128/AEM.02063-15. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR276] 276.2015. European Nucleotide Archive. ERP009341

[CR277] 277.Rajala T, Tuomivirta T, Pennanen T, Mäkipää R. Habitat models of wood-inhabiting fungi along a decay gradient of Norway spruce logs. Fungal Ecol. 2015;18:48–55. [Google Scholar]

[CR278] 278.2017. European Nucleotide Archive. ERP010027

[CR279] 279.Purahong W, et al. Characterization of unexplored deadwood mycobiome in highly diverse subtropical forests using culture-independent molecular technique. Front. Microbiol. 2017;8:574. doi: 10.3389/fmicb.2017.00574. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR280] 280.2016. European Nucleotide Archive. ERP010084

[CR281] 281.van der Wal A, Gunnewiek PJK, Cornelissen JHC, Crowther TW, de Boer W. Patterns of natural fungal community assembly during initial decay of coniferous and broadleaf tree logs. Ecosphere. 2016;7:e01393. [Google Scholar]

[CR282] 282.2016. European Nucleotide Archive. ERP010743

[CR283] 283.Reese AT, et al. Urban stress is associated with variation in microbial species composition-but not richness-in Manhattan. ISME J. 2016;10:751–760. doi: 10.1038/ismej.2015.152. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR284] 284.2016. European Nucleotide Archive. ERP011924

[CR285] 285.Kielak AM, Scheublin TR, Mendes LW, Van Veen JA, Kuramae EE. Bacterial community succession in Pine-wood decomposition. Front. Microbiol. 2016;7:231. doi: 10.3389/fmicb.2016.00231. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR286] 286.2016. European Nucleotide Archive. ERP012017

[CR287] 287.Santalahti, M., Sun, H., Jumpponen, A., Pennanen, T. & Heinonsalo, J. Vertical and seasonal dynamics of fungal communities in boreal Scots pine forest soil. FEMS Microbiol. Ecol. 92, fiw170 (2016). [DOI] [PubMed]

[CR288] 288.2016. European Nucleotide Archive. ERP013208

[CR289] 289.Frey B, et al. Microbial diversity in European alpine permafrost and active layers. FEMS Microbiol. Ecol. 2016;92:fiw018. doi: 10.1093/femsec/fiw018. [DOI] [PubMed] [Google Scholar]

[CR290] 290.2017. European Nucleotide Archive. ERP013987

[CR291] 291.Wilhelm RC, et al. A metagenomic survey of forest soil microbial communities more than a decade after timber harvesting. Sci. Data. 2017;4:170092. doi: 10.1038/sdata.2017.92. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR292] 292.2016. European Nucleotide Archive. ERP014227

[CR293] 293.Lanzén A, et al. Multi-targeted metagenetic analysis of the influence of climate and environmental parameters on soil microbial communities along an elevational gradient. Sci. Rep. 2016;6:28257. doi: 10.1038/srep28257. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR294] 294.2018. European Nucleotide Archive. ERP017480

[CR295] 295.Purahong W, et al. Increasing N deposition impacts neither diversity nor functions of deadwood‐inhabiting fungal communities, but adaptation and functional redundancy ensure ecosystem function. Environ. Microbiol. 2018;20:1693–1710. doi: 10.1111/1462-2920.14081. [DOI] [PubMed] [Google Scholar]

[CR296] 296.2017. European Nucleotide Archive. ERP017851

[CR297] 297.Yang T, et al. Soil fungal diversity in natural grasslands of the Tibetan Plateau: associations with plant diversity and productivity. New Phytol. 2017;215:756–765. doi: 10.1111/nph.14606. [DOI] [PubMed] [Google Scholar]

[CR298] 298.2017. European Nucleotide Archive. ERP017915

[CR299] 299.Nguyen D, et al. Foliar fungi of Betula pendula: impact of tree species mixtures and assessment methods. Sci. Rep. 2017;7:41801. doi: 10.1038/srep41801. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR300] 300.2017. European Nucleotide Archive. ERP019580

[CR301] 301.Tu B, et al. Microbial diversity in chinese temperate steppe: unveiling the most influential environmental drivers. FEMS Microbiol. Ecol. 2017;93:fix031. doi: 10.1093/femsec/fix031. [DOI] [PubMed] [Google Scholar]

[CR302] 302.2017. European Nucleotide Archive. ERP019924

[CR303] 303.Yang T, et al. Fungal community assemblages in a high elevation desert environment: absence of dispersal limitation and edaphic effects in surface soil. Soil Biol. Biochem. 2017;115:393–402. [Google Scholar]

[CR304] 304.2017. European Nucleotide Archive. ERP020657

[CR305] 305.van der Wal A, Gunnewiek PK, de Hollander M, de Boer W. Fungal diversity and potential tree pathogens in decaying logs and stumps. Forest Ecol. Manag. 2017;406:266–273. [Google Scholar]

[CR306] 306.2019. European Nucleotide Archive. ERP022511

[CR307] 307.Alzarhani AK, et al. Are drivers of root-associated fungal community structure context specific? ISME J. 2019;13:1330–1344. doi: 10.1038/s41396-019-0350-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR308] 308.2017. European Nucleotide Archive. ERP022742

[CR309] 309.van der Wal A, Gunnewiek PK, de Boer W. Soil-wood interactions: Influence of decaying coniferous and broadleaf logs on composition of soil fungal communities. Fungal Ecol. 2017;30:132–134. [Google Scholar]

[CR310] 310.2018. European Nucleotide Archive. ERP023275

[CR311] 311.Purahong W, et al. Determinants of deadwood-inhabiting fungal communities in temperate forests: molecular evidence from a large scale deadwood decomposition experiment. Front. Microbiol. 2018;9:2120. doi: 10.3389/fmicb.2018.02120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR312] 312.2018. European Nucleotide Archive. ERP023718

[CR313] 313.Sun R, et al. Tillage changes vertical distribution of soil bacterial and fungal communities. Front. Microbiol. 2018;9:699. doi: 10.3389/fmicb.2018.00699. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR314] 314.2018. European Nucleotide Archive. ERP023855

[CR315] 315.Santalahti M, et al. Reindeer grazing alter soil fungal community structure and litter decomposition related enzyme activities in boreal coniferous forests in finnish lapland. Appl. Soil Ecol. 2018;132:74–82. [Google Scholar]

[CR316] 316.2018. European Nucleotide Archive. ERP106131

[CR317] 317.Gałązka A, Grządziel J. Fungal genetics and functional diversity of microbial communities in the soil under long-term monoculture of Maize using different cultivation techniques. Front. Microbiol. 2018;9:76. doi: 10.3389/fmicb.2018.00076. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR318] 318.2019. European Nucleotide Archive. ERP107634

[CR319] 319.Ramirez KS, et al. Range-expansion effects on the belowground plant microbiome. Nat. Ecol. Evol. 2019;3:604. doi: 10.1038/s41559-019-0828-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR320] 320.2019. European Nucleotide Archive. ERP107636

[CR321] 321.2019. European Nucleotide Archive. ERP110188

[CR322] 322.George PB, et al. Divergent national-scale trends of microbial and animal biodiversity revealed across diverse temperate soil ecosystems. Nat. Commun. 2019;10:1107. doi: 10.1038/s41467-019-09031-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR323] 323.2019. European Nucleotide Archive. ERP112007

[CR324] 324.Álvarez-Garrido L, Viñegla B, Hortal S, Powell JR, Carreira JA. Distributional shifts in ectomycorrizhal fungal communities lag behind climate-driven tree upward migration in a conifer forest-high elevation shrubland ecotone. Soil Biol. Biochem. 2019;137:107545. [Google Scholar]

[CR325] 325.2014. DNA Data Bank of Japan. DRA000926

[CR326] 326.Yamamoto S, et al. Spatial segregation and aggregation of ectomycorrhizal and root-endophytic fungi in the seedlings of two Quercus species. PLoS One. 2014;9:e96363. doi: 10.1371/journal.pone.0096363. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR327] 327.2014. DNA Data Bank of Japan. DRA000937

[CR328] 328.Kadowaki K, et al. Detection of the horizontal spatial structure of soil fungal communities in a natural forest. Popul. Ecol. 2014;56:301–310. [Google Scholar]

[CR329] 329.2016. DNA Data Bank of Japan. DRA001737

[CR330] 330.Izuno A, et al. Structure of phyllosphere fungal communities in a tropical dipterocarp plantation: A massively parallel next-generation sequencing analysis. Mycoscience. 2016;57:171–180. [Google Scholar]

[CR331] 331.2016. DNA Data Bank of Japan. DRA002424

[CR332] 332.Matsuoka S, Kawaguchi E, Osono T. Temporal distance decay of similarity of ectomycorrhizal fungal community composition in a subtropical evergreen forest in Japan. FEMS Microbiol. Ecol. 2016;92:fiw061. doi: 10.1093/femsec/fiw061. [DOI] [PubMed] [Google Scholar]

[CR333] 333.2016. DNA Data Bank of Japan. DRA002469

[CR334] 334.Izuno A, Kanzaki M, Artchawakom T, Wachrinrat C, Isagi Y. Vertical structure of phyllosphere fungal communities in a tropical forest in Thailand uncovered by high-throughput sequencing. PLoS One. 2016;11:e0166669. doi: 10.1371/journal.pone.0166669. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR335] 335.2016. DNA Data Bank of Japan. DRA003024

[CR336] 336.Matsuoka S, Mori AS, Kawaguchi E, Hobara S, Osono T. Disentangling the relative importance of host tree community, abiotic environment and spatial factors on ectomycorrhizal fungal assemblages along an elevation gradient. FEMS Microbiol. Ecol. 2016;92:fiw044. doi: 10.1093/femsec/fiw044. [DOI] [PubMed] [Google Scholar]

[CR337] 337.2016. DNA Data Bank of Japan. DRA003730

[CR338] 338.Toju H, Yamamoto S, Tanabe AS, Hayakawa T, Ishii HS. Network modules and hubs in plant-root fungal biomes. J. R. Soc. Interface. 2016;13:20151097. doi: 10.1098/rsif.2015.1097. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR339] 339.2017. DNA Data Bank of Japan. DRA004913

[CR340] 340.Shen Z, et al. Banana Fusarium Wilt disease incidence is influenced by shifts of soil microbial communities under different monoculture spans. Microb. Ecol. 2017;75:739–750. doi: 10.1007/s00248-017-1052-5. [DOI] [PubMed] [Google Scholar]

[CR341] 341.2018. DNA Data Bank of Japan. DRA006519

[CR342] 342.Matsuoka S, Ogisu Y, Sakoh S, Hobara S, Osono T. Taxonomic, functional, and phylogenetic diversity of fungi along primary successional and elevational gradients near Mount Robson, British Columbia. Polar Sci. 2018;21:165–171. [Google Scholar]

[CR343] 343.2015. DNA Data Bank of Japan. DRP002783

[CR344] 344.Fukasawa Y, Matsuoka S. Communities of wood-inhabiting fungi in dead pine logs along a geographical gradient in Japan. Fungal Ecol. 2015;18:75–82. [Google Scholar]

[CR345] 345.2016. DNA Data Bank of Japan. DRP003138

[CR346] 346.Toju H, Tanabe AS, Ishii HS. Ericaceous plant-fungus network in a harsh alpine-subalpine environment. Mol. Ecol. 2016;25:3242–3257. doi: 10.1111/mec.13680. [DOI] [PubMed] [Google Scholar]

[CR347] 347.2019. DNA Data Bank of Japan. DRP005365

[CR348] 348.Shigyo N, Umeki K, Hirao T. Seasonal dynamics of soil fungal and bacterial communities in cool-temperate montane forests. Front. Microbiol. 2019;10:1944. doi: 10.3389/fmicb.2019.01944. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR349] 349.Semenova TA, 2014. Data from: Long-term experimental warming alters community composition of ascomycetes in Alaskan moist and dry arctic tundra. Dryad. [DOI] [PubMed]

[CR350] 350.Geml J, et al. Long-term warming alters richness and composition of taxonomic and functional groups of arctic fungi. FEMS Microbiol. Ecol. 2015;91:fiv095. doi: 10.1093/femsec/fiv095. [DOI] [PubMed] [Google Scholar]

[CR351] 351.Oriol G, 2017. Data from: Abrupt changes in the composition and function of fungal communities along an environmental gradient in the High. Arctic. Dryad. [DOI] [PubMed]

[CR352] 352.Grau O, et al. Abrupt changes in the composition and function of fungal communities along an environmental gradient in the high Arctic. Mol. Ecol. 2017;26:4798–4810. doi: 10.1111/mec.14227. [DOI] [PubMed] [Google Scholar]

[CR353] 353.Mundra S, 2015. Data from: Arctic fungal communities associated with roots of Bistorta vivipara do not respond to the same fine-scale edaphic gradients as the above-ground vegetation. Dryad. [DOI] [PubMed]

[CR354] 354.Mundra S, et al. Arctic fungal communities associated with roots of Bistorta vivipara do not respond to the same fine-scale edaphic gradients as the aboveground vegetation. New Phytol. 2015;205:1587–1597. doi: 10.1111/nph.13216. [DOI] [PubMed] [Google Scholar]

[CR355] 355.Rime T, 2014. Data from: Vertical distribution of the soil microbiota along a successional gradient in a glacier forefield. Dryad. [DOI] [PubMed]

[CR356] 356.Rime T, et al. Vertical distribution of the soil microbiota along a successional gradient in a glacier forefield. Mol. Ecol. 2015;24:1091–1108. doi: 10.1111/mec.13051. [DOI] [PubMed] [Google Scholar]

[CR357] 357.Semenova TA, 2017. Data from: Compositional and functional shifts in arctic fungal communities in response to experimentally increased snow depth. Dryad. [DOI]

[CR358] 358.Semenova TA, et al. Compositional and functional shifts in arctic fungal communities in response to experimentally increased snow depth. Soil Biol. Biochem. 2016;100:201–209. [Google Scholar]

[CR359] 359.Geml J, 2014. Data from: Large-scale fungal diversity assessment in the Andean Yungas forests reveals strong community turnover among forest types along an altitudinal gradient. Dryad. [DOI] [PubMed]

[CR360] 360.Wicaksono CY, et al. Contracting montane cloud forests: a case study of the Andean alder (Alnusacuminata) and associated fungi in the Yungas. Biotropica. 2017;49:141–152. [Google Scholar]

[CR361] 361.Yao F, 2013. Data from: Substantial compositional turnover of fungal communities in an alpine ridge-to-snowbed gradient. Dryad. [DOI] [PubMed]

[CR362] 362.Yao F, et al. Substantial compositional turnover of fungal communities in an alpine ridge-to-snowbed gradient. Mol. Ecol. 2013;22:5040–5052. doi: 10.1111/mec.12437. [DOI] [PubMed] [Google Scholar]

[CR363] 363.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYV00000000.1

[CR364] 364.Schappe T, et al. The role of soil chemistry and plant neighbourhoods in structuring fungal communities in three Panamanian rainforests. J. Ecol. 2017;105:569–579. [Google Scholar]

[CR365] 365.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYU00000000.1

[CR366] 366.Schappe T, 2017. Uncultured fungus internal transcribed spacer 1, targeted locus study. GenBank. KAYT00000000.1

[CR367] 367.Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934078

[CR368] 368.Vaz AB, et al. Using Next-Generation Sequencing (NGS) to uncover diversity of wood-decaying fungi in neotropical atlantic forests. Phytotaxa. 2017;295:1–21. [Google Scholar]

[CR369] 369.Vaz AB, 2017. MIMS Environmental/Metagenome sample from biofilm metagenome. BioSample. SAMN02934079

[CR370] 370.Siciliano S, 2014. Polar soil bacterial and fungal biodiversity survey. Australian Antarctic Data Centre. [DOI]

[CR371] 371.Ji M, et al. Microbial diversity at Mitchell Peninsula, Eastern Antarctica: a potential biodiversity “hotspot”. Polar Biol. 2016;39:237–249. [Google Scholar]

[CR372] 372.Hartmann M, et al. Significant and persistent impact of timber harvesting on soil microbial communities in Northern coniferous forests. ISME J. 2012;6:2199–2218. doi: 10.1038/ismej.2012.84. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR373] 373.Rime T, Hartmann M, Frey B. Potential sources of microbial colonizers in an initial soil ecosystem after retreat of an alpine glacier. ISME J. 2016;10:1625–1641. doi: 10.1038/ismej.2015.238. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

GlobalFungi, a global database of fungal occurrences from high-throughput-sequencing metabarcoding studies

Tomáš Větrovský

Daniel Morais

Petr Kohout

Clémentine Lepinay

Camelia Algora

Sandra Awokunle Hollá

Barbara Doreen Bahnmann

Květa Bílohnědá

Vendula Brabcová

Federica D’Alò

Zander Rainier Human

Mayuko Jomura

Miroslav Kolařík

Jana Kvasničková

Salvador Lladó

Rubén López-Mondéjar

Tijana Martinović

Tereza Mašínová

Lenka Meszárošová

Lenka Michalčíková

Tereza Michalová

Sunil Mundra

Diana Navrátilová

Iñaki Odriozola

Sarah Piché-Choquette

Martina Štursová

Karel Švec

Vojtěch Tláskal

Michaela Urbanová

Lukáš Vlk

Jana Voříšková

Lucia Žifčáková

Petr Baldrian

Abstract

Background & Summary

Fig. 1.

Methods

Data selection

Processing of sequencing data

Fig. 2.

Sample metadata

Table 1.

Data Records

Table 2.

Technical Validation

Online-only Table 1.

Usage Notes

Fig. 3.

Acknowledgements

Online-only Table

Author contributions

Code availability

Competing interests

Footnotes

References

Associated Data

Data Citations

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases