Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Mar 15.
Published in final edited form as: Hear Res. 2020 Jan 20;388:107896. doi: 10.1016/j.heares.2020.107896

Generation of a ChATCre mouse line without the early onset hearing loss typical of the C57BL/6J strain

Nichole L Beebe a, Colleen S Sowick a, Inga Kristaponyte a, Alexander V Galazyuk a, Douglas E Vetter b, Brandon C Cox c, Brett R Schofield a
PMCID: PMC7369543  NIHMSID: NIHMS1608477  PMID: 31982642

Abstract

The development of knockin mice with Cre recombinase expressed under the control of the promoter for choline acetyltransferase (ChAT) has allowed experimental manipulation of cholinergic circuits. However, currently available ChATCre mouse lines are on the C57BL/6J strain background, which shows early onset age-related hearing loss attributed to the Cdh23753A mutation (a.k.a., the ahl mutation). To develop ChATCre mice without accelerated hearing loss, we backcrossed ChATIRES-Cre mice with CBA/CaJ mice that have normal hearing. We used genotyping to obtain mice homozygous for ChATIRES-Cre and the wild-type allele at the Cdh23 locus (ChATCre,Cdh23WT). In the new line, auditory brainstem response thresholds were ~20 dB lower than those in 9 month old ChATIRES-Cre mice at all frequencies tested (4–31.5 kHz). These thresholds were stable throughout the period of testing (3–12 months of age).

We then bred ChATCre,Cdh23WT animals with Ai14 reporter mice to confirm the expression pattern of ChATCre. In these mice, tdTomato-labeled cells were observed in all brainstem regions known to contain cholinergic cells. We then stained the tissue with a neuron-specific marker, NeuN, to determine whether Cre expression was limited to neurons. Across several brainstem nuclei (pontomesencephalic tegmentum, motor trigeminal and facial nuclei), 100% of the tdTomato-labeled cells were double-labeled with anti-NeuN (n = 1896 cells), indicating Cre-recombinase was limited to neurons. Almost all of these cells (1867/1896 = 98.5%) also stained with antibodies against ChAT, indicating that reporter label was expressed almost exclusively in cholinergic neurons. Finally, an average 88.7% of the ChAT+ cells in these nuclei were labeled with tdTomato, indicating that the Cre is expressed in a large proportion of the cholinergic cells in these nuclei.

We conclude that the backcrossed ChATCre,Cdh23WT mouse line has normal hearing and expresses Cre recombinase almost exclusively in cholinergic neurons. This ChATCre,Cdh23WT mouse line may provide an opportunity to manipulate cholinergic circuits without the confound of accelerated hearing loss associated with the C57BL/6J background. Furthermore, comparison with lines that do show early hearing loss may provide insight into possible cholinergic roles in age-related hearing loss.

Keywords: acetylcholine, transgenic mouse, normal hearing, presbycusis, choline acetyltransferase, age-related hearing loss

1. INTRODUCTION1

The creation of genetically modified animals that contain Cre recombinase in an identified set of neurons has provided unprecedented opportunities for neuronal circuit analysis and experimental manipulation. While genetically modified animals have been developed across several species, by far the most widely used is mouse (reviewed by Ohlemiller et al., 2016). We have been interested in studying cholinergic circuits in the auditory brainstem, and thus would have an interest in using mice in which cholinergic neurons express Cre recombinase, such as the commercially available B6;129S6-Chattm2(cre)Lowl/J line (ChATIRES-Cre; The Jackson Laboratory) in which Cre recombinase is expressed under control of the endogenous choline acetyltransferase (ChAT) promoter. Previous studies have shown excellent labeling of brainstem cholinergic cells and their projections using this mouse line and adeno-associated viral (AAV) delivery of Cre-dependent expression of fluorescent reporters (e.g., Stornetta et al., 2013).

One concern with use of the ChATIRES- Cre line listed above is that, like many of the available mouse lines, it was produced on a C57BL/6J strain background and therefore shows early onset age related hearing loss typical of this strain (Zheng et al., 1999; Ohlemiller et al., 2016). C57BL/6J mice exhibit an accelerated hearing loss (compared to the CBA/CaJ strain) attributed to the Cdh23753A mutation (also known as the ahl mutation; Noben-Trauth et al., 2003) and have been used as a model of age-related hearing loss (e.g., Hequembourg and Liberman, 2001; Zhang et al., 2013; Brewton et al., 2016; Zhao et al., 2018). The hearing loss, apparent as elevated thresholds in auditory brainstem responses (ABRs) demonstrable at 6 months of age and substantial by 12 months, occurs in mice that are homozygous for the ahl mutation, but not in mice that are heterozygous (Frisina et al., 2011; Kane et al., 2012; Burghard et al., 2019).

While the elevated hearing thresholds in C57BL/6J mice have been reported at 6 months of age, recent studies have revealed other abnormalities appearing much earlier. The efferent system in C57BL/6J mice, and in particular the medial olivocochlear cells, show deficits as early as 6–8 weeks of age, prior to hearing loss (Zhu et al., 2007). Sinclair et al., (2017) describe abnormal responses of olivocochlear cells soon after hearing onset. Thus, C57BL/6J mice exhibit abnormalities at a much younger age than previously recognized, and the related deficits are closely tied to brainstem cholinergic systems. Given these limitations of the C57BL/6J background, our aim was to develop a ChATCre mouse line more useful for auditory experimentation by crossing ChATIRES-Cre mice with CBA/CaJ mice that have normal hearing. We selectively bred mice until we obtained mice that were homozygous for ChATIRES Cre and homozygous for the wild-type allele at the Cdh23 locus. While accelerated hearing loss would not be expected in heterozygous animals, the production of homozygous animals alleviates the need for further genotyping of offspring and facilitates breeding with another line on the C57 background (such as the tdTomato reporter line). We measured ABRs to monitor hearing thresholds and identify animals with substantial hearing loss. We then cross-bred the new line of animals with Ai14 reporter mice to confirm the expression pattern of ChATIRES-Cre.

2. MATERIALS AND METHODS

All procedures are consistent with NIH guidelines and were approved by the Northeast Ohio Medical University Institutional Animal Care and Use Committee. Efforts were made to minimize pain and the number of animals needed for the study.

2.1. Animal husbandry and genotyping

To generate mice homozygous for the wild type cdh23 gene and homozygousfor ChATIRES-Cre (ChATCre,Cdh23WT), CBA/CaJ mice (carrying two copies of the wild-type cdh23 gene, The Jackson Laboratory, stock no. 000654) were crossed with ChATIRES-Cre mice carrying two copies of ChATIRES-Cre and two copies of the mutated cdh23 gene (B6;129S6-Chattm2(cre)Lowl/J, The Jackson Laboratory, stock no. 006410). Offspring in the resulting F0 generation were assumed to be heterozygous for both ChATIRES- Cre and the cdh23 point mutation. These heterozygous F0 offspring were crossed, and mice from the resulting F1 generation were genotyped for presence and zygosity of the G->A point mutation at the 753rd nucleotide position of the cdh23 gene, and presence of ChATIRES-Cre. These F1 mice, or the offspring of F1 mice homozygous for ChATIRES-Cre and the normal-type cdh23 gene, were subsequently bred with B6.Cg-Gt(Rosa)26Sortm14(CAG-tdTomato)Hze/J mice (Ai14 reporter mice, The Jackson Laboratory, stock no. 007914) to investigate the Cre expression pattern.

Tissue for genotyping was collected via a sterile ear punch at or near weaning, and genotyping was carried out by Transnetyx (Cordova, TN). Tissue from CBA/CaJ mice and ChATIRES-Cre mice was included in each plate as a control. Samples from CBA/CaJ mice always tested negative for the ChATIRES-Cre transgene, and homozygous negative for the cdh23 point mutation, while samples from ChATIRES-Cre mice always tested positive for ChATIRES-Cre and homozygous positive for the cdh23 point mutation. Primers for the ChATIRES-Cre transgene were as follows: forward: TTAATCCATATTGGCAGAACGAAAACG, reverse: CAGGCTAAGTGCCTTCTCTACA, reporter: CCTGCGGTGCTAACC. Primers for the point mutation in the cdh23 gene were as follows: forward: TGCCCTACAGTACTAACATCTACGA, reverse: ACGCAGGACAGGCATTTGT, reporter 1: CTCTCCTCCGGTGAGC, reporter 2: CTCTCCTCCAGTGAGC.

2.2. Perfusion and tissue processing

Six ChATCre,Cdh23WT:Ai14 mice (two females and four males, 3–6 months of age) were deeply anesthetized with isoflurane until breathing stopped and corneal and withdrawal reflexes were absent. Each animal was then perfused transcardially with Tyrode’s solution to clear, followed by 50 ml of 4% paraformaldehyde in 0.1M phosphate buffer (pH 7.4) and 50 ml of the same fixative containing 10% sucrose. Brains were removed and stored in fixative containing 25% sucrose overnight. The following day, each brain was frozen and cut into 40 μm sections on a sliding microtome. Sections were collected in three series.

In two animals, a series was mounted directly onto gelatin-coated slides from a 0.2% gelatin solution, air-dried, and coverslipped with DPX mountant (Sigma), in order to examine the native tdTomato fluorescence. In four animals, a series was stained for choline acetyltransferase (ChAT, the synthetic enzyme for acetylcholine) and for neuronal nuclear protein (NeuN, a neuron-specific stain). Sections were washed in PBS (0.9% NaCl in 0.01M phosphate buffer, pH 7.4), then permeabilized in 0.3% Triton X-100 in PBS for 30 minutes at room temperature. Nonspecific staining was blocked by treating sections with a solution of 20% normal donkey serum and 0.1% Triton X-100 in PBS for one hour at room temperature. After blocking, sections were incubated in a solution containing 1% normal donkey serum, 0.1% Triton X-100, and primary antibodies in PBS overnight at 4° C. Primary antibodies were AB144P goat anti-ChAT (Millipore Sigma, 1:100) and ABN78 rabbit anti-NeuN (Millipore Sigma, 1:500). For both primary antibodies, the manufacturer shows reactivity exclusively with bands of molecular weight consistent with the respective proteins in Western blot analyses of mouse brain lysate. Western blot images are available on the manufacturer website. The anti-ChAT antibody was localized with a biotinylated donkey anti-goat secondary antibody (AB6884, Abcam, 1:100) in PBS at room temperature for one hour, followed by binding with an AlexaFluor 647-conjugated streptavidin tag (S21374, Invitrogen, 1:100) and an AlexaFluor 488-conjugated donkey anti-rabbit secondary antibody (A21206, Invitrogen, 1:100) were applied in PBS at room temperature for one hour. Following washes in PBS, sections were mounted on gelatin-coated slides from a 0.2% gelatin solution, air-dried, and coverslipped with DPX mountant.

2.3. Immunochemistry analysis and Photography

Fluorescent cells were quantified in three ChATCre,Cdh23WT:Ai14 mice in sections that were also stained with antibodies for ChAT and NeuN. Three nuclei known to contain cholinergic cells and that displayed consistent staining for NeuN and ChAT were analyzed. For each mouse, the motor trigeminal nucleus and the pontomesencephalic nuclei (comprising the pedunculopontine tegmental nucleus and the laterodorsal tegmental nucleus) were analyzed in each of two coronal sections. The facial nucleus was also analyzed; its larger size in a coronal section allowed collection of a reasonable number of cells from a single section in two mice, while two sections through the facial nucleus were analyzed in a third mouse. Each area was examined at high magnification (40x objective, NA 0.75) with a Neurolucida system (MBF Bioscience, Williston, VT) attached to a Zeiss Axioimager Z2 microscope. In order to minimize false negative findings due to limited penetration of the immunostaining reagents, the depth of immunostaining was carefully assessed and subsequent analysis was limited to depths at which all stains were readily visible. Each cell labeled with tdTomato, anti-ChAT and/or anti-NeuN was plotted with a symbol indicating which labels were present. Every ChAT+ cell and every tdTomato+ cell was also NeuN+, so further analysis focused on the percent of tdTomato+ cells that were ChAT+, and the percentage of ChAT+ cells that were labeled by tdTomato. Altogether, 1896 tdTomato+ cells and 2105 ChAT+ cells were examined.

Photographs of fluorescent cells were taken with a Hamamatsu Orca camera and structured illumination microscopy (Zeiss Apotome 2) on an Axioimager Z1 microscope. Low magnification images were taken with 10x or 20x objectives; high magnification images were taken with 63x oil immersion objective (NA 1.4) and optical sectioning at 0.5 μm depth intervals. Final images are maximum projections exported as tif files. Adobe Photoshop (CS6 or CC) was used to colorize images, provide labels and for global adjustment of brightness and contrast.

2.4. Auditory brainstem response (ABR)

Experiments were conducted on sixteen ChATCre,Cdh23WT mice (from the F1 generation described above) and four ChATIRES-Cre mice (obtained from The Jackson Laboratory). At 12 months of age the sample size for the ChATCre,Cdh23WT group was reduced to 15 mice due to one death. Mice were anesthetized with ketamine/xylazine (100 mg/kg and 10 mg/kg, respectively). ABR thresholds were obtained by presenting tone bursts at 4, 8, 12.5, 16, 20, 25, and 31.5 kHz at decreasing sound intensities ranging from 80 to 5 dB SPL in 5 dB steps. Tones were 5 ms duration, with 0.5 ms rise/fall time delivered at the rate of 50/s. Sterile stainless-steel electrodes were placed subdermally, two behind the right and left mastoid prominences, one along the vertex and the fourth one at the tail (indifferent electrode). RZ6 hardware/software system from Tucker-Davis (TDT) was used for sound generation and ABR recording. Sounds were delivered using LCY K-100 Ribbon Tweeter in a free-field arrangement with the speaker approximately 10 cm from the head. Evoked potentials were averaged over 300 repetitions. Thresholds were defined as the smallest sound intensity that evoked a visible ABR wave I. Frequency-specific thresholds were determined by visually examining the averaged ABR waveforms at different sound intensity levels. Statistical analyses were performed using R (R Core Team, 2013), with the add-on packages car (Fox and Weisberg, 2011), lme4 (Bates et al., 2015), lmerTest (Kuznetsova et al., 2017), and emmeans (Lenth, 2017). ABR thresholds were normalized using the Box-Cox procedure, which provides an optimal transformation for non-normal variables (Box and Cox, 1964). We used the mixed-effects analyses of variance (ANOVA) to assess variation in hearing thresholds. The mixed-effects approach (Pinheiro and Bates, 2000) allowed us to appropriately account for random variation among individual mice and between ears within individual mice. Specifically, the random factor was ear nested within animal, to avoid pseudo-replication errors that could arise due to sampling the two ears from the same mouse. To account for multiple comparisons p-values were adjusted using the Benjamini and Hochberg’s false discovery rate (FDR) procedure (Benjamini and Hochberg, 1995).

3. RESULTS

3.1. Generation of ChATCre,Cdh23WT mice

To generate ChATCre,Cdh23WT mice homozygous for the wild type cdh23 gene and homozygous for ChATIRES-Cre, CBA/CaJ mice (carrying two copies of the wild-type cdh23 gene) were crossed with ChATIRES-Cre mice (carrying two copies of ChATIRES- Cre and two copies of the mutated cdh23 gene). Heterozygous offspring were then bred to produce F1 animals that tested homozygous negative for the cdh23 mutation and tested positive for ChATIRES-Cre. The commercial probe for ChATIRES-Cre was not sufficient to determine zygosity, so offspring of F1 breeders (F2 generation) were also genotyped. Only breeders for whom 100% of offspring tested positive for ChATIRES-Cre were used as founders. Generation of ideal F1 breeders occurred at a rate of about 7%, very similar to the 6.25% expected from Mendelian genetics.

3.2. Confirmation of normal hearing through 12 months of age

ABR thresholds were recorded longitudinally from the same group of ChATCre,Cdh23WT mice (n=16) at ages 3, 6, 9, and 12 months of age (Fig. 1). Thresholds in these mice were stable throughout the 3–12-month period of testing. Although there are published accounts of ABR thresholds for C57BL/6J mice, we assessed four additional ChATIRES-Cre mice at the age of 9 months to ensure that comparisons with our new mouse strain were not affected by differences in ABR equipment or analyses. C57BL/6J mice typically show some threshold shift by 6 months and a more substantial, maintained shift by 9 months of age that is maintained or worsens (Noben-Trauth et al., 2003). Our testing confirmed a deficit in the 9 month old ChATIRES-Cre mice, in which thresholds were on average more than 20 dB higher than observed in the ChATCre,Cdh23WT mice. A mixed-effects ANOVA revealed a significant interaction between the mouse strain and stimulus frequency (F6, 248.9 = 12.7, p < .0001), as well as significant independent main effects for mouse strain (F1, 17 = 86.5, p < .0001) and frequency (F6, 248.9 = 116.6, p < .0001). Post-hoc pairwise comparisons of estimated marginal means (emmeans; also known as least squares means) showed significant differences in hearing thresholds between nine months old ChATCre,Cdh23WT and ChATIRES-Cre mice at all frequencies tested (all FDR adjusted p-values < 0.0001, except at 4 kHz p < 0.05).

Figure 1.

Figure 1.

Open in a new tab

Auditory brainstem responses (ABRs) indicate that the new line of ChATCre,Cdh23WT mice do not exhibit the accelerated hearing loss typical for mice carrying the mutated cdh23 gene. The graph shows ABR thresholds as a function of frequency in ChATCre,Cdh23WT mice at 4 different ages. For comparison, substantially higher thresholds reflecting significant hearing loss were obtained from a group of 9-month old ChATIRES-Cre mice. Error bars represent 95% confidence intervals.

3.3. ChATCre,Cdh23WT labels cells in known cholinergic nuclei

The breeding of the ChATCre,Cdh23WT mice with Ai14 reporter mice leads to the expression of tdTomato in Cre+ cells. Examination of transverse sections through the brains of these animals revealed tdTomato+ cells in all the brainstem regions known to contain cholinergic neurons (VanderHorst and Ulfake, 2006). Figure 2 shows representative reporter labeling of cells in the numerous brainstem regions known to contain cholinergic cells. Within the auditory brainstem, labeled cells were largely confined to the superior olivary complex. Here, the cells were most numerous in the lateral superior olivary nucleus (LSO) and the ventral nucleus of the trapezoid body (VNTB), reflecting the well-known distribution of olivocochlear cells (Fig. 2A). Additional cells were visible near the margins of the LSO that may correspond to shell olivocochlear neurons, and sparsely in other periolivary nuclei. Robust labeling, typically brighter than that in the superior olivary complex, was present in a variety of non-auditory brainstem nuclei, including cranial nerve motor nuclei (e.g., facial nucleus and motor trigeminal nucleus; Fig. 2D, E) and the pontomesencephalic nuclei (pedunculopontine and laterodorsal tegmental nuclei, PPT and LDT, Fig. 2F, G). We saw no evidence of reporter-labeled cells in areas (e.g., inferior colliculus, pontine nuclei) that are not known to contain cholinergic neurons.

Figure 2.

Figure 2.

Open in a new tab

Breeding ChATCre,Cdh23WT mice with Ai14 reporter mice produced tdTomato-labeled cells (magenta) in known cholinergic nuclei. A. A low magnification image shows the distribution of labeled cholinergic cells in the SOC (magenta). Labeled cells were most numerous in the LSO and VNTB, but were also visible around the margins of the LSO (arrows). In addition to the labeled cells, small bundles of labeled cholinergic axons from the abducens nucleus are visible (arrowheads). Scale bar (A) = 250 μm. B-G. High magnification images of tdTomato-labeled cells from the B. ventral nucleus of the trapezoid body, C. lateral superior olive, D. facial nucleus, E. motor trigeminal nucleus, F. laterodorsal tegmental nucleus, and G. pedunculopontine tegmental nucleus. Dorsal is up; lateral is to the left. Scale bar (B-G) = 20 μm.

3.4. Reporter label is restricted to NeuN+/ChAT+ cells

We used two antibodies to assess the specificity of the tdTomato reporter. First, we stained with the neuron-specific antibody for NeuN (Fig. 3), a marker present in nearly all neurons but absent in glial cells (Mullen et al., 1992). We counted tdTomato-labeled cells in three nuclear regions (pontomesencephalic tegmentum, which includes the pedunculopontine tegmental nucleus and the laterodorsal tegmental nucleus, and two cranial nerve motor nuclei, the facial nucleus and the motor trigeminal nucleus). Although we saw examples of tdTomato+ cells in the superior olivary complex that expressed NeuN (Fig. 3A, B), the staining quality in these nuclei was inconsistent, so we did not include them in the quantitative analysis. Across a total of 1896 tdTomato-labeled cells, 100% were double-labeled with anti-NeuN. These results suggest that all cells with the tdTomato label, and thus the expression of Cre-recombinase, were limited to neurons.

Figure 3.

Figure 3.

Open in a new tab

Labeling with tdTomato in ChATCre,Cdh23WT:Ai14 mice is restricted to neurons. The images show tdTomato-labeled cells (magenta) and immunostaining for NeuN, a neuron-specific marker (green; merged image in third column). Virtually all tdTomato cells were double labeled with NeuN. A. ventral nucleus of the trapezoid body. B. lateral superior olive. C. facial nucleus. D. motor trigeminal nucleus. E. laterodorsal tegmental nucleus. F. pedunculopontine tegmental nucleus. Scale bar (A-F) = 20 μm.

We then compared the staining of the same areas (PMT, motor trigeminal and facial nuclei) for double staining with tdTomato and anti-ChAT, a selective marker of cholinergic neurons. Again, we saw examples of tdTomato+ cells in the superior olivary complex that expressed ChAT (Fig. 4A, B), but the staining quality in these nuclei was inconsistent, so we did not include them in the quantitative analysis. Our first analysis with this approach was to calculate the percentage of reporter-labeled cells that were immunostained with ChAT; i.e., is tdTomato being expressed only by cholinergic cells? Of 1896 tdTomato-labeled cells, 1867 (98.5%) were ChAT immunopositive, suggesting that reporter label present in non-cholinergic neurons was an exceedingly rare event and that the expression of Cre-recombinase occurs almost exclusively in cholinergic neurons.

Figure 4.

Figure 4.

Open in a new tab

A majority of cholinergic cells are labeled by the reporter, tdTomato, in ChATCre,Cdh23WT:Ai14 mice. Images show cholinergic cells labeled with anti-ChAT immunochemistry (ChAT+, cyan) and tdTomato-labeled cells (magenta). The proportion of ChAT+ cells that were double labeled with tdTomato varied from nucleus to nucleus. Arrows show examples of ChAT+ neurons that were not labeled by the tdTomato. A. ventral nucleus of the trapezoid body. B. lateral superior olive. C. facial nucleus. D. motor trigeminal nucleus. E. laterodorsal tegmental nucleus. F. pedunculopontine tegmental nucleus. Scale bar (A-F) = 20 μm.

The next analysis was to calculate the percentage of cholinergic cells that expressed functional Cre-recombinase; i.e., are all cholinergic cells expressing the transgene? Figure 4 shows examples of ChAT+ (i.e., cholinergic) cells that were or were not labeled with tdTomato. In the same nuclei described above, we counted 2105 ChAT+ cells. Of these presumptive cholinergic cells, 1867 were tdTomato+, indicating that, on average, 88.7% of the cholinergic cells expressed the transgene. Unlike the percentages described above, which showed little variation across nuclei, there were substantial differences between nuclei in percentage of ChAT+ cells that were tdTomato+ (Table 1). The highest percentages were observed in the motor nuclei. In the facial nucleus, percentages of ChAT+ cells that were also tdTomato+ ranged from 88% to 100%. Results in the motor trigeminal nucleus showed slightly greater variation, ranging from 84% to 100% of ChAT+ cells that were also tdTomato+. Importantly, the ChAT+/tdTomato− cells in M081918A.MC were not randomly distributed in the nucleus, but were located on the lateral margin and appeared to have smaller somas on average than the tdTomato+ cells in the nucleus. We believe this represents a systematic failure to label a minor population of small cells in the nucleus, which would be essential to understand before one attempts to use these mice to label or manipulate the cholinergic cells in the motor trigeminal nucleus. The higher percentage obtained in the motor trigeminal nucleus of the other two mice may indicate that the sample for our analysis did not include this small subgroup of cholinergic cells (indeed, examination of additional sections through the motor trigeminal nucleus revealed a small number of ChAT+/tdTomato− cells that may reflect the same population included in M081918A.MC). What about other cholinergic nuclei? The pontomesencephalic tegmental nuclei (PMT, comprising pedunculopontine and laterodorsal tegmental nuclei) represent another large cholinergic population, and in this analysis tdTomato was expressed in 75%−94% of the ChAT+ cells (Table 1). This value is lower on average than that seen in the two motor nuclei. Unlike our findings in the motor trigeminal nucleus, the distribution and morphology of the ChAT+/tdTomato− cells did not appear to have a consistent distribution or morphology that distinguished them from the ChAT+/tdTomato+ cells. In other words, there was no clear indication that the lack of reporter in these PMT cholinergic cells reflect a functionally-relevant subpopulation.

Table 1.

Most cholinergic cells express Cre, as indicated by tdTomato fluorescence. The percentage of cholinergic cells (ChAT+) that were successfully labeled by the ChAT-driven Cre expression of tdTomato (tdT+) in three mice is shown for samples from two sections through each of three brainstem regions: facial nucleus, motor trigeminal nucleus (Motor V) and the pontomesencephalic cholinergic nuclei. Columns 3 and 4 show the number of ChAT+ cells that co-contained the tdTomato fluorescent protein (# ChAT+/tdT+) or that did not contain the tdTomato signal (# ChAT+/tdT−).

Nucleus Animal ID# # ChAT+/thT+ # ChAT+/thT- total # ChAT+ cells %of ChAT+ that are thT+
Facial M081918A.MC 203 1 204 100%
M072518B.FA 195 7 202 97%
M112518.MA 97 13 110 88%
Totals 495 21 516 96%
Motor V M081918A.MC 237 45 282 84%
M072518B.FA 172 6 178 97%
M112518.MA 155 0 155 100%
Totals 564 51 615 92%
PMT M081918A.MC 272 89 361 75%
M072518B.FA 378 67 445 85%
M112518.MA 158 10 168 94%
Totals 808 166 974 83%
Grand totals 1867 238 2105 88.7%
Open in a new tab

4. DISCUSSION

The expression of Cre-recombinase under the control of the ChAT promoter offers an important tool for experimental manipulation of cholinergic neurons. In the present study, genotyping confirms that the backcrossed mouse line carries ChATIRES-Cre and the wild-type sequence of the Cdh23 allele. Furthermore, breeding the new line with a standard Cre reporter line indicates that Cre-containing cells have several characteristics consistent with their identity as cholinergic neurons. First, they are NeuN+; there is no evidence for expression of Cre-recombinase in non-neuronal brain cells. Second, the Cre-recombinase containing cells are almost all (99%) immunopositive for ChAT, a specific marker of cholinergic neurons. Finally, the distribution of fluorescently labeled cells in the brains of ChATCre,Cdh23WT:Ai14 mice matches the known distribution of cholinergic cells (VanderHorst and Ulfake, 2006). We conclude that nearly all Cre-containing neurons are cholinergic.

In the ChATCre,Cdh23WT:Ai14 mice, nearly all reporter-expressing cells appeared to be cholinergic (i.e., ChAT+) but not all ChAT+ cells expressed the reporter at detectable levels. In our analyses, 83–100% of the ChAT+ cells were also labeled with tdTomato. The incomplete expression was likely caused by the use of an IRES (internal ribosome entry site) to drive translation of Cre since other studies have shown that IRES-mediation expression is less efficient than cap-mediated expression (Mizuguchi et al., 2000). It also may reflect differences in levels of ChAT expression, with lower levels insufficient to drive translation of Cre. In any case, it must be concluded that experimental manipulations in the new ChATCre,Cdh23WT mouse line are likely to label <100% of the cholinergic cells, with success rates related at least in part to the specific nucleus/nuclei being labeled. In most cases, labeling a substantial portion of a population should prove experimentally valuable. Care must be exercised given the possibility that a specific (perhaps functionally distinct) subset of cells is unintentionally excluded. The present analyses raise such a possibility regarding the small population of cholinergic cells located in the lateral part of the motor trigeminal nucleus. Virtually all the cholinergic cells in the facial nucleus were labeled, so incomplete labeling is unlikely here. In the PMT, ~80% of the cholinergic cells were labeled by tdTomato; the ChAT+/tdTomato− cells appeared to be distributed randomly throughout the two component nuclei (pedunculopontine tegmental nucleus and laterodorsal tegmental nucleus), and did not appear to share any particular trait that differentiated them from the tdTomato+ cells in the same nuclei.

The genotyping suggests that the new mouse line is homozygous for the normal Cdh23 allele. Previous studies indicate that the early onset hearing loss associated with at least one mutation of ahl appears only in homozygous mutant animals (Noben-Trauth et al., 2003; Frisina et al., 2011; Burghard et al., 2019; Lyngholm and Sakata, 2019). Thus, we would predict that our homozygous ChATCre,Cdh23WT mouse would have normal hearing. In fact, the ABR thresholds suggest better hearing, i.e., lower thresholds across all frequencies, than in the CBA/CaJ parental strain, a finding that has been reported previously (Frisina et al., 2011). A similar argument applies to the cross-breeding of the ChATIRES-Cre mouse with the Ai14 reporter mouse that is on a C57BL/6J background. These mice would presumably be heterozygous for the ahl mutation, inheriting a copy from the Ai14 reporter parent. We conclude that both the ChATCre,Cdh23WT line and the ChATCre,Cdh23WT:Ai14 reporter mice avoid the hearing loss that characterizes the currently available ChATIRES-Cre mouse line and could serve as useful models of normal hearing in auditory experiments. Whether the presence of a single copy of the ahl mutation is associated with more subtle effects will have to be addressed in future studies on animals cross-bred with the reporter mice.

As described above, hearing loss reflected in increased ABR thresholds is prominent by 6 months of age in C57BL/6J mice. With this timeline in mind, it would appear reasonable to conduct studies in mice with this background if the data can be collected well before the period of hearing loss. Of course, it is possible that the ahl mutation could lead to abnormalities in the auditory system that precede the overt threshold shift revealed by ABR recordings. In fact, several recent reports raise the concern that abnormalities appear in the C57BL/6J auditory system at surprisingly early ages. Sinclair et al., (2017) identified differences in the physiological activity of cholinergic olivocochlear cells in C57BL/6J mice compared to CBA/CaJ mice. These differences were noted as early as postnatal day 16, soon after the onset of hearing. The authors speculated that abnormalities in the olivocochlear cells could be related to the development of hearing loss in the C57BL/6J strain. The mouse strain described in the present study has both genotype and ABR data indicating a lack of the early hearing loss typical of the C57BL/6 line and should enhance several opportunities related to cholinergic aspects of auditory processing. First, experimental manipulation of cholinergic circuits, e.g., via optogenetics, can now be done in animals without concern for covert changes that may occur prior to overt hearing loss in ChATIRES-Cre mice on a C57BL/6J background. Second, manipulations of cholinergic circuits could be carried out in both the ChATCre,Cdh23WT line and in C57BL/6 ChATIRES-Cre mice, allowing comparison of the results of experimental manipulation of the cholinergic system in mice that have normal hearing vs. those with accelerated age-related hearing loss.

Highlights.

  • ChATCre mice were backcrossed to eliminate hearing loss typical of C57BL/6J strain

  • Cre recombinase is expressed only in cholinergic neurons

  • A majority of brainstem cholinergic neurons express Cre

Acknowledgments

Thanks to Dr. Jesse Young for advice on statistical analyses of the ABR data.

Funding: This work was supported by the National Institutes of Health grant number NIH R01 DC004391 (to BRS). Equipment for auditory brainstem response recording and analysis was supported by R01 DC016918 (to AG).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Declaration of interest: BCC is a consultant for Otonomy, Inc. and Turner Scientific, LLC.

1

Abbreviations: ABR, auditory brainstem response; ChAT, choline acetyltransferase; Cre, Cre recombinase; LDT, laterodorsal tegmental nucleus; LSO, lateral superior olivary nucleus; Motor V, motor trigeminal nucleus; PPT, pedunculopontine tegmental nucleus; VNTB, ventral nucleus of the trapezoid body.

References

  1. Bates D, Maechler M, Bolker B, Walker S 2015. Fitting linear mixed-effects models using lme4. Journal of Statistical Software, 67, 1–48. [Google Scholar]
  2. Benjamini Y, Hochberg Y 1995. Controlling the false discovery rate: A practical and powerful approach to multiple testing. JRSS B, 57, 289–300. [Google Scholar]
  3. Box GEP, Cox DR 1964. An analysis of transformations. JRSS B 26, 211–246. [Google Scholar]
  4. Brewton DH, Kokash J, Jimenez O, Pena ER, Razak KA 2016. Age-related deterioration of perineuronal nets in the primary auditory cortex of mice. Front Aging Neurosci 8, 270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Burghard AL, Morel NP, Oliver DL 2019. Mice heterozygous for the Cdh23/Ahl1 mutation show age-related deficits in auditory temporal processing. Neurobiol Aging 81, 47–57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fox J, Weisberg S 2011. An R companion to applied regression. Thousand Oaks, CA: Sage; Retrieved from https://CRAN.R-project.org/package=car [Google Scholar]
  7. Frisina RD, Singh A, Bak M, Bozorg S, Seth R, Zhu X 2011. F1 (CBAxC57) mice show superior hearing in old age relative to their parental strains: hybrid vigor or a new animal model for “golden ears”? Neurobiol Aging 32, 1716–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hequembourg S, Liberman MC 2001. Spiral ligament pathology: a major aspect of age-related cochlear degeneration in C57BL/6 mice. J Assoc Res Otolaryngol 2, 118–29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Kane KL, Longo-Guess CM, Gagnon LH, Ding D, Salvi RJ, Johnson KR 2012. Genetic background effects on age-related hearing loss associated with Cdh23 variants in mice. Hear Res 283, 80–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kuznetsova A, Brockhoff PB, Christensen RHB 2017. lmerTest package: Tests in linear mixed effects models. Journal of Statistical Software, 82, 1–26. [Google Scholar]
  11. Lenth R. emmeans: Estimated marginal means, aka least-squares means. R package version 1.3.3. 2017 Retrieved from https://CRAN.R-project.org/package=emmeans.
  12. Lyngholm D, Sakata S 2019. Cre-dependent optogenetic transgenic mice without early age-related hearing loss. Front Aging Neurosci 11, 29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Mizuguchi H, Xu Z, Ishii-Watabe A, Uchida E, and Hayakawa T 2000. IRES-dependent second gene expression is significantly lower than cap-dependent first gene expression in a bicistronic vector. Mol Ther, 1, 376–382. [DOI] [PubMed] [Google Scholar]
  14. Mullen RJ, Buck CR, Smith AM 1992. NeuN, a neuronal specific nuclear protein in vertebrates. Development 116, 201–11. [DOI] [PubMed] [Google Scholar]
  15. Noben-Trauth K, Zheng QY, Johnson KR 2003. Association of cadherin 23 with polygenic inheritance and genetic modification of sensorineural hearing loss. Nat Genet 35, 21–3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Ohlemiller KK, Jones SM, Johnson KR 2016. Application of mouse models to research in hearing and balance. J Assoc Res Otolaryngol 17, 493–523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Pinheiro JC, Bates DM 2000. Mixed-effects models in S and SPLUS. New York, NY: Springer. [Google Scholar]
  18. R Core Team. 2013. R: A Language and Environment for Statistical Computing. Vienna: R Foundation for Statistical Computing; 2013. [Google Scholar]
  19. Sinclair JL, Barnes-Davies M, Kopp-Scheinpflug C, Forsythe ID 2017. Strain-specific differences in the development of neuronal excitability in the mouse ventral nucleus of the trapezoid body. Hear Res 354, 28–37. [DOI] [PubMed] [Google Scholar]
  20. Stornetta RL, Macon CJ, Nguyen TM, Coates MB, Guyenet PG 2013. Cholinergic neurons in the mouse rostral ventrolateral medulla target sensory afferent areas. Brain Struct Funct 218, 455–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. VanderHorst VG, Ulfhake B 2006. The organization of the brainstem and spinal cord of the mouse: relationships between monoaminergic, cholinergic, and spinal projection systems. J Chem Neuroanat 31, 2–36. [DOI] [PubMed] [Google Scholar]
  22. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ 2013. Identifying microRNAs involved in degeneration of the organ of Corti during age-related hearing loss. PLoS One 8, e62786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Zhao N, Alkharabsheh A, Xu F, Sun W 2018. Functional change in the caudal pontine reticular nucleus induced by age-related hearing loss. Neural Plast 2018, 8169847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Zheng QY, Johnson KR, Erway LC 1999. Assessment of hearing in 80 inbred strains of mice by ABR threshold analyses. Hear Res 130, 94–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Zhu X, Vasilyeva ON, Kim S, Jacobson M, Romney J, Waterman MS, Tuttle D, Frisina RD 2007. Auditory efferent feedback system deficits precede age-related hearing loss: contralateral suppression of otoacoustic emissions in mice. J Comp Neurol 503, 593–604. [DOI] [PubMed] [Google Scholar]

RESOURCES