Similar to some large DNA viruses that encode their own disulfide bond pathway, baculovirus encodes a viral sulfhydryl oxidase, P33. Enzyme activity of P33 is related to infectious BV production, occlusion-derived virus (ODV) envelopment, occlusion body morphogenesis, and oral infectivity, suggesting that P33 is involved in disulfide bond formation of multiple proteins. A complete disulfide bond formation pathway normally contains a sulfhydryl oxidase, a disulfide-donating enzyme, and one or more substrates. In baculovirus, apart from P33, other components of the putative pathway remain unknown. In this study, we identified PIF5 as the first substrate of P33, which is fundamental for revealing the complete disulfide bond formation pathway in baculovirus. PIF5 is essential for oral infection and is absent from the PIF complex. Our study demonstrated that native disulfide bonds in PIF5 are required for oral infection, which will help us to reveal its mode of action.
KEYWORDS: P33, PIF5, baculovirus, disulfide bond pathway, oral infection, substrate, sulfhydryl oxidase
ABSTRACT
Disulfide bonds are critical for the structure and function of many proteins. Some large DNA viruses encode their own sulfhydryl oxidase for disulfide bond formation. Previous studies have demonstrated that the baculovirus-encoded sulfhydryl oxidase P33 is necessary for progeny virus production, and its enzymatic activity is important for morphogenesis and oral infectivity of baculoviruses. However, the downstream substrates of P33 in the putative redox pathway of baculoviruses are unknown. In this study, we showed that PIF5, one of the per os infectivity factors (PIFs), contained intramolecular disulfide bonds and that the disulfide bond formation was interrupted in the absence of P33. In vivo pulldown and colocalization analyses revealed that PIF5 and P33 interacted with each other during virus infection. Further, in vitro assays validated that the reduced PIF5 proteins could be oxidized by P33. To understand the contribution of disulfide bonds to the function of PIF5, several cysteine-to-serine mutants were constructed, which all interfered with the disulfide bond formation of PIF5 to different extents. All the mutants lost their oral infectivity but had no impact on infectious budding virus (BV) production or virus morphogenesis. Taken together, our results indicated PIF5 as the first identified substrate of P33. Further, the disulfide bonds in PIF5 play an essential role in its function in oral infection.
IMPORTANCE Similar to some large DNA viruses that encode their own disulfide bond pathway, baculovirus encodes a viral sulfhydryl oxidase, P33. Enzyme activity of P33 is related to infectious BV production, occlusion-derived virus (ODV) envelopment, occlusion body morphogenesis, and oral infectivity, suggesting that P33 is involved in disulfide bond formation of multiple proteins. A complete disulfide bond formation pathway normally contains a sulfhydryl oxidase, a disulfide-donating enzyme, and one or more substrates. In baculovirus, apart from P33, other components of the putative pathway remain unknown. In this study, we identified PIF5 as the first substrate of P33, which is fundamental for revealing the complete disulfide bond formation pathway in baculovirus. PIF5 is essential for oral infection and is absent from the PIF complex. Our study demonstrated that native disulfide bonds in PIF5 are required for oral infection, which will help us to reveal its mode of action.
INTRODUCTION
The formation of native disulfide bonds is important for proper folding, stability, and function of many proteins (1). This oxidative process relies on a disulfide bond formation pathway. As revealed in prokaryotes and eukaryotes, the disulfide bond formation pathway is localized mainly in oxidizing compartments such as the endoplasmic reticulum (ER), mitochondrial intermembrane space (IMS), or bacterial cell periplasm (2, 3). Commonly, this pathway is constituted of a disulfide-generating oxidase producing disulfides de novo and a disulfide-donating enzyme that effectively introduces disulfides to substrates (4). In most cases, viruses use the pathway of host cells to form disulfide bonds during folding and assembly of viral proteins (5). However, all nucleocytoplasmic large DNA viruses (NCLDVs) (6), including those from the following five families, Poxviridae, Asfarviridae, Iridoviridae, Mimiviridae, and Phycodnaviridae, encode their own sulfhydryl oxidase to catalyze disulfide bond formation of viral proteins in the reducing cytosol, where the host disulfide bond formation pathway is not available (7–9). The virus oxidative folding pathway was first illustrated in vaccinia virus, in which a disulfide bond is generated by a complex consisting of sulfhydryl oxidase E10R and a redox protein A2.5L, delivered to the intermediary protein G4L, and then introduced to a number of viral proteins, including L1R, F9L, A28L, and A21L (10–12). The sulfhydryl oxidase E10R and the intermediary protein G4L are essential for vaccinia virus assembly and morphogenesis (13, 14). All the identified substrate proteins of the vaccinia virus are intracellular mature virion (IMV) membrane proteins. Among them, L1R is required for virus morphogenesis, F9L for virus entry, A28L for virus reproduction, and A21L for cell entry and fusion. Likewise, in the putative African swine fever virus (ASFV) redox pathway, ASFV pB119L protein is the flavin adenine dinucleotide (FAD)-containing sulfhydryl oxidase, pA151R is the intermediate, and pE248R, a homolog of vaccinia virus L1R, has been identified as a substrate (8).
Apart from NCLDVs, baculoviruses also encode their own sulfhydryl oxidase (15). Baculoviruses are insect-specific, large, double-stranded circular DNA viruses that replicate and assemble in the nuclei of host cells (16). Two types of virions are produced during the life cycle of the virus: budded virions (BVs), which are responsible for systemic infection in larval tissues, and occlusion-derived virions (ODVs), which are responsible for initiating oral infection in the insect midgut. ODVs are embedded in occlusion bodies (OBs), which provide physical protection for the virus in the environment. The sulfhydryl oxidase encoded by baculovirus, P33, is conserved in all sequenced baculoviruses and has been shown to be critical for multiple processes of baculovirus infection. P33 was initially identified in Autographa californica multiple nucleopolyhedrovirus (AcMNPV), as it binds to the AcMNPV-expressed human tumor suppressor P53 and enhances P53-mediated apoptosis (17). P33 also interacts with the P53 homolog in Spodoptera frugiperda (SfP53) and oxidizes SfP53 in vitro; however, no effect of this interaction on AcMNPV replication was detected (18). Purified P33 protein expressed by bacteria was demonstrated to be an active FAD-linked sulfhydryl oxidase (15). Crystal structures of P33 of AcMNPV and Bombyx mori NPV have been resolved and show a unique dimeric structure linked by the C-terminal domain, which contains a FAD binding pocket and an active site CXXC motif (19–21). The AcMNPV P33 localizes in both cytoplasm and nuclei and accumulates in the ring zone region at the later stage of infection; it is a membrane component of BV and is associated with both the nucleocapsid and envelope of ODV, and it has been shown to be necessary for infectious BV production and multinucleocapsid ODV formation (22, 23). Our previous studies indicated that the decrease in enzymatic activity of P33 affects OB morphogenesis and oral infectivity of the virus (21). Although these results suggest that P33 may influence disulfide bond formation of more than one viral protein, no P33 substrates have been identified to date.
Based on our previous study (21), efforts to identify P33 substrates involved in oral infection were undertaken. To date, 10 per os infectivity factors (PIFs) have been identified as essential for baculovirus oral infection. These PIFs have been named PIF0 to PIF9; all PIFs except PIF9 are encoded by core genes of baculovirus, and most of them contain conserved cysteine residues (24). Among the 10 PIFs, all except PIF5 form an ∼500-kDa PIF complex to resist the enzyme-rich, alkaline environment in the midgut and mediate ODV entry (25). The deletion of PIF5 results in the complete loss of oral infectivity without affecting the integrity of the PIF complex (25, 26), suggesting that PIF5 plays an independent role outside the PIF complex during oral infection.
PIF5 is highly conserved in Baculoviridae, and in AcMNPV, it is comprised of 376 amino acids with a calculated molecular mass of 40.9 kDa, and it contains six cysteines. In the present study, we aimed to verify if PIF5 is a substrate of the baculoviral disulfide bond formation pathway. Our results revealed PIF5 as the first substrate of P33, demonstrating that the native disulfide bond formation of PIF5 is critical for oral infection but not for BV production or viral morphogenesis.
RESULTS
PIF5 contains intramolecular disulfide bonds.
Alignments with all known PIF5 sequences from baculoviruses were conducted, and the results of the representative sequences are shown in Fig. 1. All six cysteines (C203, C210, C224, C241, C253, and C281 in AcMNPV) of PIF5 were conserved in alpha-, beta-, and gammabaculoviruses. In contrast, in deltabaculovirus, C203 and C224 were replaced by other amino acids (Fig. 1A). Based on the analyses by the DISULFIND and DiANNA web servers, the predicted disulfide bonds in AcMNPV PIF5 were formed between C203 to C241, C210 to C253, and C224 to C281 (Fig. 1A).
FIG 1.
PIF5 contains intramolecular disulfides. (A) Diagram of PIF5 showing conserved cysteines. Disulfide connectivity prediction of PIF5 was performed on the DISULFIND (http://disulfind.dsi.unifi.it/) and DiANNA (http://clavius.bc.edu/~clotelab/DiANNA/) web servers and is shown in the diagram. (B) Reducing and nonreducing Western blot analysis on PIF5. Sf9 cells were infected with vAcBac-egfp-ph for 72 h. ODVs were purified from AcMNPV-WT OBs. The harvested cells and ODVs were divided into two equal groups and treated with SDS-PAGE loading buffer in the presence (R, reducing) or absence (NR, nonreducing) of 20 mM TCEP. (C) Analysis of intramolecular disulfide bonds in ODV. The R- and NR-treated ODV samples were divided into two equal groups and treated with or without 20 mM AMS. Samples were resolved on a 12% SDS-PAGE gel followed by ECL-Western blotting with anti-PIF5 antibody. M, standard molecular markers.
Western blot analysis using a PIF5-specific antibody showed that under reducing conditions (lane R), PIF5 from the samples of infected cells and ODVs exhibited a molecular mass of ∼48 kDa (Fig. 1B), which is in agreement with previous reports (25, 27). While under reducing conditions (lane NR), faster electrophoretic mobility of PIF5 proteins was observed in comparison with those under reducing conditions (Fig. 1B), suggesting the existence of intramolecular disulfide bonds in native PIF5 proteins. To identify free thiols in PIF5, the alkylating agent 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid (AMS) was used for labeling PIF5 proteins from the ODV sample, which should lead to a mass addition of 536 Da on each free thiol. After being reduced with Tris(2 carboxyethyl) phosphine hydrochloride (TCEP), the AMS-labeled proteins showed a higher molecular mass of ∼51 kDa, suggesting that AMS was covalently linked to the reduced PIF5, which contains 6 free thiols (Fig. 1C, lane 2). In contrast, the nonreduced PIF5 proteins with AMS treatment (Fig. 1C, lane 4) showed similar electrophoretic mobility to those without AMS labels (Fig. 1C, lane 3), suggesting there were no free thiols in the nonreduced PIF5 proteins. This result suggests that there were no free thiols in native PIF5 proteins, and all six cysteines participated in disulfide bond formation.
Disulfide bond formation of PIF5 is mediated by P33.
To investigate whether the disulfide bonds of PIF5 were formed via baculoviral sulfhydryl oxidase P33, the thiol-disulfide states of PIF5 proteins in Sf9 cells transfected with bAcBac-Δp33 bacmid, which contained an enhanced green fluorescent protein gene (egfp) at the p33 locus (P33 knockout [KO]), (28) were analyzed. VP39 was used as a control in this experiment for two reasons. First, VP39 is the major viral nucleocapsid protein and was used as a loading control to show cells were properly transfected. Second, VP39 is a good marker to indicate AMS labeling because it contains 8 cysteines. In the wild-type (WT) sample (Fig. 2A, left), without AMS labeling, VP39 (middle panel) showed an expected molecular mass of about 39 kDa under reducing conditions (lane 1). Under nonreducing conditions, the migration rate of VP39 (lane 3) was similar to that of under reducing conditions, suggesting there are likely no intramolecular disulfide bonds within VP39 proteins. This was further confirmed after treating with AMS, as under reducing conditions, the molecular mass of VP39 was increased to ∼45 kDa (lane 2), which was in close agreement with the expectation that 8 free thiols would result in an increase of ∼4.3 kDa by AMS labeling. Similarly, under nonreducing conditions, the migration rate of VP39 treated with AMS (lane 4) was much slower than that without AMS labeling (lane 3), suggesting there are free thiols in native VP39. In the P33 KO sample (Fig. 2A, right), VP39 (middle) showed similar results to those in the WT sample, suggesting P33 had no impact on VP39 structure, which is consistent with the hypothesis that VP39 has no intramolecular disulfide bonds. Western blot analysis using an anti-P33 antibody confirmed the absence of P33 in the P33 KO sample (Fig. 2A, right, bottom). P33 holds 4 cysteines, and the crystal structure shows it contains an intramolecular disulfide bond and two cysteines with free thiol (21). In the WT sample (Fig. 2A, left, bottom), under reducing conditions, AMS-alkylated P33 (lane 2) exhibited an about 2-kDa increase in molecular mass over unalkylated P33 (lane 1), as expected. Under nonreducing conditions, AMS-labeled P33 (lane 4) migrated slower than P33 without AMS treatment (lane 3) because the two free thiols were labeled with AMS. In the WT sample, PIF5 with or without alkylation by AMS exhibited a similar migration rate under nonreducing conditions (Fig. 2A, lanes 3 and 4). However, under reducing conditions, PIF5 appeared at a higher molecular mass of ∼51 kDa when labeled with AMS (Fig. 2A, lane 2). This result was consistent with that of ODV (Fig. 1C), confirming that there was no free thiol in the native PIF5. In the P33 KO sample (Fig. 2A, right), under reducing conditions, the apparent molecular mass of PIF5 (upper panel) was ∼51 kDa (lane 6) and 48 kDa (lane 5) with and without AMS treatment, respectively, which was similar to that of the WT sample. In contrast, under nonreducing conditions, the migration rate of PIF5 with AMS labels (lane 8) was higher than those without AMS treatment (lane 7), suggesting the presence of free thiols in PIF5 when P33 was absent. Moreover, in the P33 KO samples, the migration rate of PIF5 labeled with AMS was similar with or without TCEP treatment (Fig. 2A, lanes 8 and 6), suggesting that all cysteines in PIF5 may remain reduced when P33 is absent. Taken together, these results showed that cysteines of the PIF5 protein were oxidized to form disulfide bonds during infection of the WT virus but remained as free thiols in the absence of P33. Therefore, disulfide bond formation of PIF5 is likely mediated by P33.
FIG 2.
PIF5 is a substrate of P33. (A) Dependence of PIF5 disulfide bond formation on P33. Sf9 cells were transfected with bAcBac-egfp-ph (WT) and bAcBac-Δp33 (P33 KO) bacmids for 72 h. The cells were harvested with PBS containing 5% TCA to quench the thiol-disulfide state of the samples and prepared with (−) or without (+) reduction using TCEP prior to the treatment with (−) or without (+) alkylation using AMS. Prepared samples were resolved by 12% PAGE, and the proteins were analyzed by Western blotting using the anti-PIF5 antibody. VP39 was used as a loading control, and the anti-P33 antibody was used to confirm the absence of P33 in the P33 KO sample. (B) In vitro assay for oxidation of PIF5 by P33. Reduced PIF5 protein was incubated with purified P33 protein or BSA at 30°C in a 120-μl mixture, and 20-μl aliquots were withdrawn at each time point to measure thiol group content, as mentioned in Materials and Methods. DTT was used as a control substrate.
We further tested whether P33 was able to catalyze disulfide bond formation of PIF5 by monitoring the P33-mediated oxidation of PIF5 thiols in vitro. To this end, prokaryotic-expressed and purified P33 proteins were incubated with reduced PIF5 proteins or dithiothreitol (DTT) as a control, and the content of free thiols was detected at each time point from 0 to 120 min. As shown in Fig. 2B, reduced PIF5 proteins were efficiently oxidized by P33 in vitro. Further, in comparison to DTT, PIF5 appeared to be a more preferred substrate of P33 under our experimental conditions.
PIF5 interacts with P33 in vivo.
To investigate the interaction between PIF5 and P33, subcellular localization of PIF5 and P33 at the indicated time points was determined using an immunofluorescence assay (IFA). Both PIF5 and P33 were detected at the ring zone (RZ) around the nuclei after 24 h postinfection (p.i.). At 48 h p.i., during OB formation, the fluorescence focuses of PIF5 and P33 were observed to be colocalized in the RZ, which had been filled with OBs (Fig. 3A).
FIG 3.
Detecting protein-to-protein interaction between PIF5 and P33. (A) Colocalization analysis of PIF5 and P33. Sf9 cells were infected with vAcMNPV-WT, fixed at 24 h p.i. or 48 h p.i., stained using rabbit anti-PIF5 antibody and mouse anti-P33 antibody as the primary antibody, and then incubated with mixed secondary antibodies (Alexa 488-labeled goat anti-rabbit [1:500; Abcam] and Alexa 647-labeled goat anti-mouse [1:500; Abcam]). Nuclei were stained with Hoechst. Scale bars, 10 μm. (B) In vivo pulldown assay. Sf9 cells were infected with vAcMNPV-Δpif5-pif5 (PIF5-S tag) or vAcBac-Δp33-p33-ph (P33-S tag), and PIF5-S or P33-S proteins were precipitated with S-protein agarose at 48 h p.i. Sf9 cells infected with vAcBac-egfp-ph were used as the negative control (NC). Agarose-bound proteins were analyzed by Western blotting with anti-P33, anti-PIF5, or anti-S-tag antibodies, respectively. IN, input; PD, pulldown. (C) In vitro pulldown assay. In brief, 500-ng prey proteins were pulled down with S-protein agarose that had been bound with 500-ng bait proteins. An equal amount of prey proteins was incubated with agarose that had been treated with 500 ng BSA as a negative control (NC). The pulldown sample was boiled in SDS-PAGE loading buffer and analyzed by Western blotting with anti-PIF5 and anti-P33 antibodies.
In vivo S (RNase S-peptide) tag pulldown assay was conducted using cell samples infected with recombinant AcMNPV containing S-tagged PIF5 or P33, respectively. When the cells infected with AcMNPV containing S-tagged PIF5 were collected and pulled down with S-tagged agarose, P33 proteins were found to be copurified in the pulldown sample (PD) as evidenced by Western blotting using anti-P33 antibody (Fig. 3B, left, top). Similarly, from the cells infected with AcMNPV containing S-tagged P33, PIF5 was found copurified with S-tagged P33 in the pulldown sample (Fig. 3B, right, top). These results demonstrated a bidirectional interaction between PIF5 and P33 in vivo (Fig. 3B). In vitro S-tag pulldown assays were also conducted using prokaryotically expressed and purified S-tagged PIF5 or P33 (Fig. 3C). The result showed that when S-tagged PIF5 was used as the bait, P33 could not be detected in the pulldown sample (Fig. 3C, left, top). Likewise, when S-tagged P33 was used as the bait, PIF5 was not detected in the pulldown sample (Fig. 3C, right, top). These results suggest there is no direct interaction between PIF5 and P33 in vitro. These differences in the in vivo and in vitro assays indicate that there might be other factors in vivo to mediate the interaction between P33 and PIF5.
Cysteine-to-serine mutations have no apparent effects on BV production and OB morphogenesis, but they disrupt disulfide bond formation of PIF5.
To analyze the role of disulfide bonds in PIF5 function, we constructed several cysteine-to-serine mutated recombinant viruses and examined disulfide bond formation of PIF5. Six single-site mutants (C203S, C201S, C224S, C241S, C253S, and C281S), three double-site mutants (C203S/C241S, C201S/C253S, and C224S/C281S), and one mutant with substitutions of all cysteines (6-cys mutant) were constructed based on the backbone of bAcMNPV-Δpif5, which contained egfp as described in Materials and Methods (Fig. 4A). A transfection assay showed that at 24 h posttransfection (p.t.), EGFP fluorescence was detected in very few cells, but at 96 h p.t., most cells were found to be fluorescent, indicating none of the mutants have an obvious impact on intracellular virus replication and spread (Fig. 4B). The titers of the recombinant viruses ranged from 6.43 × 107 to 1.17 × 108 50% tissue culture infective dose (TCID50)/ml, which were similar to that of the parental virus (1.25 × 108 TCID50/ml), suggesting the mutants had no apparent effects on infectious BV production. This is in agreement with previous reports that PIF5 as a per os infectivity factor had no impact on BV production, even when deleted (27). The OBs produced from the larvae injected with each mutant BV were purified and observed by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The results showed that OB morphogenesis was not influenced by the cysteine substitutions, as all OBs had a regular polyhedral shape with a smooth surface (Fig. 4C) and multiple ODVs embedded (Fig. 4D).
FIG 4.
Construction of pif5 knockout and repair cysteine mutant bacmids and electron microscopy analysis of OBs purified from infected larvae. (A) Schematic diagram of the recombinant viruses. The bacmid bAcMNPV-Δpif5 (KO) was constructed by replacing a 760-bp fragment in pif-5 of the AcMNPV bacmid with a Cmr cassette through homologous recombination in E. coli. The knockout bacmid bAcMNPV-Δpif5 was repaired by S-tagged pif5 and cysteine mutant S-tagged pif5 as described in Materials and Methods. (B) Transfection and infection assay. Sf9 cells were transfected with repaired and mutant bacmids to produce infectious recombinant viruses. Then Sf9 cells were infected with transfection supernatants. The fluorescence microscopy images were taken at 24 h p.t., 96 h p.t., and 24 h p.i. (C) OBs of mutant viruses were purified from infected larvae and visualized under SEM to observe the outer morphology. (D) Ultrathin OB sections were analyzed by TEM. Scale bars, 1 μm.
We next investigated the impact of the mutations on PIF5 disulfide bond formation. The Sf9 cells infected with different viruses were collected at 48 h p.i., and the cellular proteins were subjected to SDS-PAGE under reducing and nonreducing conditions. Normally, proteins with intramolecular disulfide bonds exhibit faster electrophoretic mobility under nonreducing conditions than under reducing conditions. Under reducing conditions, PIF5 proteins from different mutants as well as the repaired virus showed similar but slower mobility compared to the WT virus due to the S-tag fusion (Fig. 5A). In contrast, under nonreducing conditions, all mutated PIF5 proteins displayed various degrees of decreased mobility compared to WT and repaired PIF5, and the 6-cys mutant PIF5 showed the slowest mobility (Fig. 5B). Since the double mutations were constructed on the pair of cysteines predicted to form a disulfide bond (Fig. 1A), they were expected to have similar electrophoretic mobility as the related single mutants. However, the double mutants had different banding patterns in comparison to those of the single mutants (Fig. 5B), suggesting the disulfide bond prediction in Fig. 1A is likely to be incorrect. Taken together, these results indicated that native disulfide bond formation of PIF5 was disrupted by these cysteine-to-serine substitutions.
FIG 5.
Cysteine-to-serine mutation disrupts PIF5 disulfide bond formation. (A) Sf9 cells were infected with cysteine mutant viruses, repaired virus, and the AcMNPV bacmid-derived control virus (WT) at an MOI of 5 TCID50 units/cell and harvested with PBS containing 5% TCA at 48 h p.i. Further, the total protein was dissolved and quantified. Each sample was treated with SDS-PAGE loading buffer in the presence of DTT, resolved by SDS-PAGE, and analyzed by Western blotting with the anti-PIF5 antibody. (B) Each quantified sample was treated with SDS-PAGE loading buffer in the absence of DTT and subjected to nonreducing Western blot analysis.
Native disulfide bond formation of PIF5 is required for oral infection.
To detect the effect of PIF5 disulfide bond on oral infection, OBs of different viruses were fed to third-instar Spodptera exigua larvae at a dose of 3 × 108 OBs/ml using the droplet feeding method. The result showed that all PIF5 mutants lost oral infectivity (Table 1), suggesting that establishment of oral infection depended on the native disulfide bond formation of PIF5.
TABLE 1.
Feeding assay of the cysteine-mutated OBs
| Virus | Mortality (no. dead/total) |
|
|---|---|---|
| Test 1 | Test 2 | |
| C203S | 0/24 | 0/24 |
| C210S | 0/24 | 0/24 |
| C224S | 0/24 | 0/24 |
| C241S | 0/24 | 0/24 |
| C253S | 0/24 | 0/24 |
| C281S | 0/24 | 0/24 |
| C203/241S | 0/24 | 0/22 |
| C210/253S | 0/23 | 0/23 |
| C224/281S | 0/24 | 0/24 |
| 6-cys mutant | 0/24 | 0/24 |
| Repair | 22/24 | 23/24 |
| AcMNPV WT | 22/24 | 24/24 |
Since the egfp gene existed in the parental bacmid (Fig. 4A), all the mutant viruses derived from the bacmid should express EGFP if infection is established. To further investigate the effect of the PIF5 disulfide bond on oral infection, fourth-instar S. exigua larvae orally infected with different viruses were dissected at 48 h p.i. and observed by stereo fluorescence microscopy. The result showed the distribution of fluorescent signals throughout the body of larvae fed with WT and repaired OBs, but no EGFP fluorescent signals were observed inside the larvae fed with mutant OBs (Fig. 6A). When the midgut tissue of the infected larvae was analyzed by fluorescence microscopy, fluorescence foci were observed outside the midgut of larvae fed with WT and repaired OBs, which illustrated that viruses had crossed the midgut barrier and initiated systemic viral infection, as shown by EGFP fluorescence in the adjacent tissues. In contrast, no fluorescence was observed in larvae infected with mutant OBs, confirming that PIF5 mutant OBs could not establish primary infection in the midgut (Fig. 6B). Collectively, these findings illustrate that the native disulfide bonds of PIF5 are required for oral infection.
FIG 6.
Florescence microscopy of virus infection in insects. (A) Fourth-instar S. exigua larvae were fed with 3 × 106 OBs of different viruses which all contain egfp in their genome. At 48 h p.i., the infected larvae were slit open and pinned, and the infection status was observed by detecting the EGFP fluorescence using a stereo fluorescence microscope. (B) The midguts of the infected larvae were dissected and analyzed by fluorescence microscopy under ×100 magnification.
DISCUSSION
P33 is a FAD-linked sulfhydryl oxidase encoded by a core gene of baculoviruses, which plays important roles in multiple processes of baculovirus infection, such as BV production, multiple-enveloped ODV formation, OB morphogenesis, and oral infection (21, 22), suggesting its involvement in disulfide bond formation of multiple viral proteins. In this study, we focused on the role of P33 in disulfide bond formation of PIF5, one of the proteins essential for baculoviral oral infectivity. We found that PIF5 contained native disulfide bonds (Fig. 1), and the disulfide bond formation was blocked in the absence of P33 (Fig. 2A). PIF5 proteins were found to interact with P33 during virus infection by colocalization and pulldown assays in vivo (Fig. 3A and B) but not in vitro (Fig. 3C). By constructing cysteine mutant viruses, we showed that native disulfide formation of PIF5 was disturbed (Fig. 5) and the mutants lost their oral infectivity (Table 1 and Fig. 6). The mutants, however, had no apparent impacts on BV production, multiple-enveloped ODV formation, or OB morphogenesis (Fig. 4). Previously, SfP53 was reported to interact with P33 and was oxidized by the latter in vitro; however, no obvious functional relationship between P33 and SfP53 was found in cultured cells (18). Therefore, PIF5 was the first identified substrate of P33, which affects oral infectivity. Other substrates of the baculovirus-encoded disulfide bond pathway need to be further explored.
AcMNPV PIF5 contains six highly conserved cysteine residues, and our results showed that they all formed disulfide bonds because no free thiols were detected in native PIF5 (Fig. 1C). The cysteine mutants had effects, to different extents, on disulfide bond formation (Fig. 5B). However, they all lost their oral infectivity (Table 1), suggesting that the disulfide bonds are crucial for the function of PIF5. Our prediction of disulfide connections (Fig. 1A) was based on the primary sequence of AcMNPV PIF5. Although some double mutants (C203/214S and C201/253S) appeared to have faster mobility than the single cysteine mutants under nonreducing conditions (Fig. 5B), it is difficult to assess disulfide connections due to the complexity and possible reforming of artificial disulfide bonds caused by the cysteine substitutions. Interestingly, PIF5 of deltabaculovirus Culex nigripalpus NPV (CuniNPV) contained only four conserved cysteines, i.e., C214, C246, C258, and C286, corresponding to C210, C241, C253, and C286 of AcMNPV PIF5, respectively. Using DISULFIND and DiANNA, the disulfide connections of CuniNPV PIF5 were predicted as C214 to C246 and C258 to C286, suggesting another possibility of a disulfide connectivity pattern in AcMNPV PIF5, namely, C203 to C224, C210 to C241, and C253 to C281. At present, studies are underway to resolve the crystal structure of PIF5 to reveal the correct disulfide bond connections and to understand their role in PIF5 function.
A typical disulfide bond formation pathway usually contains two kinds of enzymes, disulfide-generating oxidase and disulfide-donating oxidoreductase, to introduce disulfide bonds into substrate proteins (11, 29). A disulfide bond is generated at the active site (CXXC) of oxidase and then transferred to the active site (CXXC) of the thioredoxin (trx) domain on the oxidoreductase, followed by introduction into the cysteine pair on substrates (4). We consider PIF5 as one of the final substrates but not the disulfide carrier (oxidoreductase) in the baculoviral disulfide bond formation pathway because PIF5 does not contain a CXXC motif. Further, no trx domain was identified based on the secondary structure prediction. In addition, we showed that PIF5 and P33 interacted with each other in the in vivo pulldown assays (Fig. 3B), yet interaction between PIF5 and P33 was not detected in the in vitro pulldown assay (Fig. 3C), suggesting that P33 and PIF5 may be associated with each other via other viral or host protein(s) in vivo. It should be noted that the in vitro pulldown results were based on prokaryotically expressed proteins, which might not reflect the native protein structure. The in vitro oxidation assay showed that reduced PIF5 could be directly reoxidized by P33 (Fig. 2B). This, however, does not imply that the disulfide carrier protein is not needed during virus infection. Naturally, the formation of disulfide bonds in a substrate is based on the thiol-disulfide reaction between an oxidized disulfide carrier protein and a reduced substrate (30). During this reaction, a short-lived complex of the carrier protein and substrate linked with an intramolecular disulfide will be formed and resolved to generate a reduced carrier protein and oxidized substrate (31). Thus, the carrier protein that interacts with a specific substrate can be identified by trapping the disulfide-linked intermediates (32). Since PIF5 has been identified as a substrate of the pathway, future studies will be carried out to detect the disulfide-linked carrier-substrate complex using PIF5 cysteine mutants.
In summary, we identified PIF5 as the first substrate of the baculoviral sulfhydryl oxidase P33 and demonstrated that baculoviruses possess their own disulfide bond formation pathway. To the best of our knowledge, this is the first viral disulfide bond formation pathway confirmed in a non-NCLDV virus. It broadens our understanding in the field and opens many new questions, such as what is the baculoviral disulfide donating oxidoreductase? What are the other substrates of P33 that are involved in BV production, multinucleocapsid ODV formation, and OB morphogenesis? A proposed baculoviral disulfide formation pathway is shown in Fig. 7, demonstrating that a disulfide bond is formed by P33, transferred through an unknown intermediate, and introduced to multiple substrates involved in BV production, multinucleocapsid ODV formation, OB morphogenesis, or oral infection. This study showed that PIF5 is the substrate required for oral infectivity, but since many other PIFs also contain multiple conserved cysteines (25), it is possible that there are more substrates responsible for oral infection. The method used in this study can be explored to identify other candidate substrates involved in different aspects of the baculoviral life cycle. In addition, the recombinants expressing cysteine-mutated PIF5 generated in the study can be used as bait to identify candidates of intermediate factors. Thus, this study is fundamental for revealing the complete pathway in the future.
FIG 7.
Putative baculovirus disulfide bond formation pathway. A disulfide bond is formed by sulfhydryl oxidase P33, transferred through an unknown intermediate, and introduced to multiple substrates involved in different steps of infection. As the first identified substrate protein of the pathway, PIF5 disulfide bonds are required for oral infectivity. Identification of other candidate substrates and intermediates is needed in further studies.
MATERIALS AND METHODS
Analysis of thiol-disulfide state of PIF5.
To test the presence of disulfide bonds in PIF5, WT control virus vAcBac-egfp-ph-infected Sf9 cells and ODVs purified from AcMNPV-WT OBs (33) were boiled with SDS-PAGE loading buffer (50 mM Tris-HCl, 2% [wt/vol] SDS, 0.1% [wt/vol] bromophenol blue dye, and 1% [vol/vol] glycerin) in the presence (reducing conditions) or absence (nonreducing conditions) of 20 mM TCEP (Thermo Scientific). To analyze the disulfide-thiol states of PIF5, boiled ODV samples were treated with or without 20 mM AMS (Invitrogen).
To identify the impact of p33 deletion on PIF5 disulfide bond formation, Sf9 cells were transfected with p33 knockout bacmid bAcBac-Δp33, in which the original p33 was replaced by a hsp70-egfp-SV40-Cmr cassette (28) or bacmid bAcBac-egfp-ph. Cell samples were harvested with 5% (wt/vol) trichloroacetic acid (TCA) at 72 h p.i. Subsequently, the denatured precipitant was treated with or without 20 mM TCEP and 20 mM AMS followed by boiling in the SDS-PAGE loading buffer. Prepared samples were separated on SDS-polyacrylamide gels, transferred to polyvinylidene difluoride (PVDF) membranes (Millipore), and incubated with antibodies anti-PIF5, anti-VP39, or anti-P33, which were produced previously in our lab (25, 28). Next, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody against rabbit or mouse IgG (Sigma-Aldrich) and developed with SuperSignal West Pico chemiluminescent substrate (Pierce).
In vitro oxidation of PIF5 by P33.
PIF5 (residues 5 to 307 amino acids [aa]) and P33 proteins were produced from pET32a-pif5 in Escherichia coli strain TransB and pET28a-p33 (21) in E. coli strain BL21, respectively. Expression and purification protocols are as described previously (21). Reduced, denatured PIF5 was prepared as described previously (34). Reduced PIF5 was incubated with purified P33 or bovine serum albumin (BSA) (Beyotime). Aliquots were taken to mix with Ellman’s reagent [5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB); Sigma] at half-hour intervals. The absorbance values at 412 nm were measured by UV spectroscopy (Synergy H4; BioTek), and the thiol groups’ content was calculated at an extinction coefficient of 13,600 M−1 cm−1.
Construction of recombinant viruses.
pif5 was deleted in an AcMNPV bacmid constructed by our laboratory, which contains a mini-Tn7 transposon and enhanced green fluorescent protein gene (egfp) at the hr4a region (Fig. 4A). Briefly, a Cmr cassette was amplified from pKS-egfp-Cmr (35) using Cmr-F/R as primers (Table 2) and cloned into plasmid pFastBacDual (Invitrogen). The up- and downstream sequences of pif5 were inserted into each side of the Cmr cassette to generate the homologous fragment pif5US-Cmr-pif5DS. Linear homologous fragments were transformed into E. coli BW25113 containing the AcMNPV bacmid and plasmid pKD46. The recombinant pif5 knockout bacmids were selected by chloramphenicol, and the correct one (confirmed by PCR) was assigned as bAcMNPV-Δpif5.
TABLE 2.
Primers used in the study
| Functions and primers | Sequence (5′ to 3′)a |
|---|---|
| Delete pif5 gene | |
| Cmr-F (XhoI) | CCGCTCGAGGGGCCGTCGACCAATTCTCATGTTTG |
| Cmr-R (BamHI) | CGCGGATCCCCAACTTTTGGCGAAAATGAGACGTTG |
| pif5-US-F (KpnI) | GGGGTACCTATAACGTTTGCGGAACAAAAACTAAAT |
| pif5-US-R (NheI) | CTAGCTAGCTGTGCATCGAACCTTACTCGTTTGGTG |
| pif5-DS-F (EcoRI) | CGGAATTCACGCGTATTATCAGTAATAAAACTGGCCTG |
| pif5-DS-R (HindIII) | CCCAAGCTTATATAAATTTAGCGATCATACAATGGAGAG |
| Repair pif5 gene | |
| Ppif5-F (BamHI) | gcgGGATCCCAAATGCGCCTTCTCGCCCAG |
| pif5:S-R (EcoRI) | gcgGAATTCTTAGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTCTTTTCGAGGGGCCGTTGTTGG |
| Construction of mutants | |
| C203-F′ | CCGAGGCCTCGTTGTTATTGCAG |
| C203-R′ | CTGCAATAACAACGAGGCCTCGG |
| C210-F′ | CAGCGCACTTCTCGTCAAGACC |
| C210-R′ | GGTCTTGACGAGAAGTGCGCTG |
| C224-F′ | GTTACCATTTCGCCATTCGACCCC |
| C224-R′ | GGGGTCGAATGGCGAAATGGTAAC |
| C241-F′ | GAACTAACCAACATGTCGCAAGGATTCAACTATG |
| C241-R′ | CATAGTTGAATCCTTGCGACATGTTGGTTAGTTC |
| C253-F′ | GTAGAAAAAACAGTTTCTCGCGGCAGC |
| C253-R′ | GCTGCCGCGAGAAACTGTTTTTTCTAC |
| C281-F′ | CCAAACACTCATGTCGATCGAACCTTACTC |
| C281-R′ | GAGTAAGGTTCGATCGACATGAGTGTTTGG |
| Repair p33 gene | |
| Pp33-F (XhoI) | GCGCTCGAGAATACGTGGTGTTTGTTAAAAGCACCC |
| p33:S-R1 | CGAATTTAGCAGCAGCGGTTTCTTTTTGCAAATTTAACAATTTTTTGTATTCTCCCC |
| p33:S-R2 (SphI) | GCGGCATGCTTAGCTGTCCATGTGCTGGCGTTCGAATTTAGCAGCAGCGGTTTC |
| Prokaryotic expression of PIF5 | |
| pif5-F (EcoRI) | CCGGAATTCTCAAATCTTCGCGCAGTCAATAAATTG |
| pif5-R (XhoI) | CCGCTCGAGGCCGACTAAACCTTCATCGCCCAGTAAC |
| Eukaryotic expression of PIF5 | |
| pif5-F (KpnI) | CGCGGTACCCATGAGTTTTTTTTCAAATCTTCGCGCAGTCAATAAATTG |
| pif5-R (ApaI) | CGCGGGCCCCATTAACTTGCCGCTGACGCTGTC |
The underlined nucleotides indicate restriction enzyme sites.
To construct the pif5-repaired virus, the entire open reading frame of pif5, along with its native promoter, was PCR amplified with primer pair Ppif5-F and pif5:S-R (which contains an S tag) (Table 2). The fragment was cloned into plasmid pFastBacDual and further transposed into bAcMNPV-Δpif5 to generate the pif5-repaired bacmid. Codons for conserved cysteine residues of PIF5 were mutated to serine codons by overlap extension PCR (36) using the primers in Table 2, and the mutated recombinant bacmids were generated as mentioned above. Infectious recombinant viruses were produced by transfection of recombinant bacmid DNA into Sf9 cells.
Colocalization assay.
To investigate the subcellular localization of PIF5 and P33, Sf9 cells were infected with vAcMNPV-WT (33) at a multiplicity of infection (MOI) of 5 TCID50/cell. At 24 and 48 h p.i., infected cells were fixed, permeabilized, and subjected to IFA using a mixture of anti-PIF5 and anti-P33 as the primary antibodies and Alexa 488-labeled goat anti-rabbit (1:500; Abcam) and Alexa 647-labeled goat anti-mouse (1:500; Abcam) as the secondary antibodies. The nuclei were stained with Hoechst 33258 dye (Beyotime). The images were taken using the DeltaVision Elite microscopy imaging system (GE Healthcare).
In vivo and in vitro analysis of PIF5-P33 interaction.
For the in vivo pulldown assay, an S-tagged p33 was introduced into the bAcBac-Δp33 to generate recombinant virus vAcBac-Δp33-p33-ph. Sf9 cells infected with vAcMNPV-Δpif5-pif5 (in which pif5 was also fused with an S tag), vAcBac-Δp33-p33-ph, or negative-control virus vAcBac-egfp-ph were harvested at 48 h p.i. and lysed in cell lysis buffer (Beyotime). PIF5-S or P33-S recombinant proteins were precipitated using S-protein agarose (Novagen) and detected by Western blotting with anti-P33, anti-PIF5, or anti-S-tag (Abcam) antibodies, respectively.
For the in vitro pulldown assay, the S-tagged P33 protein was expressed in E. coli strain BL21 by pET-32a expression vector, and aa 1 to 321 of PIF5 protein without an S tag were expressed in the Drosophila S2 cell line (Invitrogen). P33 and S-tagged PIF5 proteins had been expressed as mentioned above. These proteins were purified as described previously (21). In brief, 500 ng bait protein (S-tagged P33 or PIF5 protein) was incubated with 10 μl of S-protein agarose for 2 h at 10°C. The agarose was washed to remove unbound bait protein, and 500 ng prey protein (PIF5 or P33 protein without an S tag) was incubated with bait protein-bound agarose for 2 h at 10°C followed by washing three times with phosphate-buffered saline (PBS) and boiling for 10 min after the addition of SDS-PAGE loading buffer with 20 mM DTT. BSA (500 ng) was used as a negative control. Finally, the input and pulldown samples were analyzed by enhanced chemiluminescence (ECL)-Western blotting with anti-PIF5, anti-P33, or anti-S-tag antibodies.
Electron microscopy.
OBs were purified from infected S. exigua larvae and subjected to SEM and TEM analysis as described previously (21). The SEM sample was observed by Hitachi SU8010, and TEM sections were observed by Tecnai G2 20 Twin at an accelerating voltage of 200 kV.
Detection of disulfide formation state of PIF5 mutant.
To detect the effects of cysteine mutants on PIF5 disulfide bond formation, Sf9 cells were infected with pif5 mutant viruses, repaired virus, or the AcMNPV bacmid-derived control virus (WT) at an MOI of 5 TCID50 units/cell. At 48 h p.i., cells were treated with TCA, and the denatured precipitants were collected and dissolved as mentioned above. For each mutant, two aliquots of 3 μg total cellular proteins were treated with SDS-PAGE loading buffer with or without 20 mM DTT and subjected to Western blot analysis.
Larval feeding assays and fluorescence microscopy.
Early third-instar S. exigua larvae were used for droplet feeding assay (37) with different viruses at a dose of 3 × 108 OBs/ml. The mortality was checked daily until all larvae died or pupated. Two biological replicates were performed.
Early fourth-instar S. exigua larvae were orally infected with 3 × 106 OBs of each mutation and dissected at 48 h p.i. The infection status in the midgut and larval body was observed with an inverted fluorescence microscope and Olympus SZX16 stereomicroscope, respectively.
ACKNOWLEDGMENTS
This research was supported by grants from the National Natural Science Foundation of China (no. 31570153), the Key Research Program of Frontier Sciences of the Chinese Academy of Sciences (grant no. QYZDJ-SSW-SMC021), and the National Key R&D Program of China (2017YFD0200400).
We acknowledge Ding Gao, Anna Du, Pei Zhang, Bichao Xu, and Guibo Rao from the core facility and technical support facility of the Wuhan Institute of Virology for technical assistance.
REFERENCES
- 1.Landeta C, Boyd D, Beckwith J. 2018. Disulfide bond formation in prokaryotes. Nat Microbiol 3:270–280. doi: 10.1038/s41564-017-0106-2. [DOI] [PubMed] [Google Scholar]
- 2.Ellgaard L, Sevier CS, Bulleid NJ. 2018. How are proteins reduced in the endoplasmic reticulum? Trends Biochem Sci 43:32–43. doi: 10.1016/j.tibs.2017.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Manta B, Boyd D, Berkmen M. 2019. Disulfide bond formation in the periplasm of Escherichia coli. EcoSal Plus 8. doi: 10.1128/ecosalplus.ESP-0012-2018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Sato Y, Inaba K. 2012. Disulfide bond formation network in the three biological kingdoms, bacteria, fungi and mammals. FEBS J 279:2262–2271. doi: 10.1111/j.1742-4658.2012.08593.x. [DOI] [PubMed] [Google Scholar]
- 5.Saaranen MJ, Ruddock LW. 2013. Disulfide bond formation in the cytoplasm. Antioxid Redox Signal 19:46–53. doi: 10.1089/ars.2012.4868. [DOI] [PubMed] [Google Scholar]
- 6.Iyer LM, Balaji S, Koonin EV, Aravind L. 2006. Evolutionary genomics of nucleo-cytoplasmic large DNA viruses. Virus Res 117:156–184. doi: 10.1016/j.virusres.2006.01.009. [DOI] [PubMed] [Google Scholar]
- 7.Hakim M, Fass D. 2010. Cytosolic disulfide bond formation in cells infected with large nucleocytoplasmic DNA viruses. Antioxid Redox Signal 13:1261–1271. doi: 10.1089/ars.2010.3128. [DOI] [PubMed] [Google Scholar]
- 8.Rodriguez I, Redrejo-Rodriguez M, Rodriguez JM, Alejo A, Salas J, Salas ML. 2006. African swine fever virus pB119L protein is a flavin adenine dinucleotide-linked sulfhydryl oxidase. J Virol 80:3157–3166. doi: 10.1128/JVI.80.7.3157-3166.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Senkevich TG, White CL, Koonin EV, Moss B. 2000. A viral member of the ERV1/ALR protein family participates in a cytoplasmic pathway of disulfide bond formation. Proc Natl Acad Sci U S A 97:12068–12073. doi: 10.1073/pnas.210397997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Senkevich TG, Ward BM, Moss B. 2004. Vaccinia virus A28L gene encodes an essential protein component of the virion membrane with intramolecular disulfide bonds formed by the viral cytoplasmic redox pathway. J Virol 78:2348–2356. doi: 10.1128/jvi.78.5.2348-2356.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Senkevich TG, White CL, Koonin EV, Moss B. 2002. Complete pathway for protein disulfide bond formation encoded by poxviruses. Proc Natl Acad Sci U S A 99:6667–6672. doi: 10.1073/pnas.062163799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Townsley AC, Senkevich TG, Moss B. 2005. Vaccinia virus A21 virion membrane protein is required for cell entry and fusion. J Virol 79:9458–9469. doi: 10.1128/JVI.79.15.9458-9469.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Senkevich TG, Weisberg AS, Moss B. 2000. Vaccinia virus E10R protein is associated with the membranes of intracellular mature virions and has a role in morphogenesis. Virology 278:244–252. doi: 10.1006/viro.2000.0656. [DOI] [PubMed] [Google Scholar]
- 14.White CL, Senkevich TG, Moss B. 2002. Vaccinia virus G4L glutaredoxin is an essential intermediate of a cytoplasmic disulfide bond pathway required for virion assembly. J Virol 76:467–472. doi: 10.1128/jvi.76.2.467-472.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Long CM, Rohrmann GF, Merrill GF. 2009. The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase. Virology 388:231–235. doi: 10.1016/j.virol.2009.04.006. [DOI] [PubMed] [Google Scholar]
- 16.Rohrmann GF. 2019. Baculovirus molecular biology, 4th ed National Center for Biotechnology Information, Bethesda, MD. [PubMed] [Google Scholar]
- 17.Prikhod'ko GG, Wang Y, Freulich E, Prives C, Miller LK. 1999. Baculovirus p33 binds human p53 and enhances p53-mediated apoptosis. J Virol 73:1227–1234. doi: 10.1128/JVI.73.2.1227-1234.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Wu W, Clem RJ, Rohrmann GF, Passarelli AL. 2013. The baculovirus sulfhydryl oxidase Ac92 (P33) interacts with the Spodoptera frugiperda P53 protein and oxidizes it in vitro. Virology 447:197–207. doi: 10.1016/j.virol.2013.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Hakim M, Mandelbaum A, Fass D. 2011. Structure of a baculovirus sulfhydryl oxidase, a highly divergent member of the erv flavoenzyme family. J Virol 85:9406–9413. doi: 10.1128/JVI.05149-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hou Y, Xia Q, Yuan YA. 2012. Crystal structure of Bombyx mori nucleopolyhedrovirus ORF75 reveals a pseudo-dimer of thiol oxidase domains with a putative substrate-binding pocket. J Gen Virol 93:2142–2151. doi: 10.1099/vir.0.042747-0. [DOI] [PubMed] [Google Scholar]
- 21.Kuang W, Zhang H, Wang M, Zhou NY, Deng F, Wang H, Gong P, Hu Z. 2017. Three conserved regions in baculovirus sulfhydryl oxidase P33 are critical for enzymatic activity and function. J Virol 91:e01158-17. doi: 10.1128/JVI.01158-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Wu W, Passarelli AL. 2010. Autographa californica multiple nucleopolyhedrovirus Ac92 (ORF92, P33) is required for budded virus production and multiply enveloped occlusion-derived virus formation. J Virol 84:12351–12361. doi: 10.1128/JVI.01598-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Nie Y, Fang M, Theilmann DA. 2011. Autographa californica multiple nucleopolyhedrovirus core gene ac92 (p33) is required for efficient budded virus production. Virology 409:38–45. doi: 10.1016/j.virol.2010.09.023. [DOI] [PubMed] [Google Scholar]
- 24.Boogaard B, Van Oers MM, Van Lent J. 2018. An advanced view on baculovirus per os infectivity factors. Insects 9:84. doi: 10.3390/insects9030084. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Wang X, Shang Y, Chen C, Liu S, Chang M, Zhang N, Hu H, Zhang F, Zhang T, Wang Z, Liu X, Lin Z, Deng F, Wang H, Zou Z, Vlak JM, Wang M, Hu Z. 2019. Baculovirus per os infectivity factor complex: components and assembly. J Virol 93:e02053-18. doi: 10.1128/JVI.02053-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sparks WO, Harrison RL, Bonning BC. 2011. Autographa californica multiple nucleopolyhedrovirus ODV-E56 is a per os infectivity factor, but is not essential for binding and fusion of occlusion-derived virus to the host midgut. Virology 409:69–76. doi: 10.1016/j.virol.2010.09.027. [DOI] [PubMed] [Google Scholar]
- 27.Harrison RL, Sparks WO, Bonning BC. 2010. Autographa californica multiple nucleopolyhedrovirus ODV-E56 envelope protein is required for oral infectivity and can be substituted functionally by Rachiplusia ou multiple nucleopolyhedrovirus ODV-E56. J Gen Virol 91:1173–1182. doi: 10.1099/vir.0.017160-0. [DOI] [PubMed] [Google Scholar]
- 28.Kuang W, Zhang H, Hou D, Wang M, Deng F, Wang H, Hu Z. 2016. P33 of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus is a functional homolog of AcP33. Virol Sin 31:346–349. doi: 10.1007/s12250-016-3771-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Depuydt M, Messens J, Collet JF. 2011. How proteins form disulfide bonds. Antioxid Redox Signal 15:49–66. doi: 10.1089/ars.2010.3575. [DOI] [PubMed] [Google Scholar]
- 30.Nagy P. 2013. Kinetics and mechanisms of thiol-disulfide exchange covering direct substitution and thiol oxidation-mediated pathways. Antioxid Redox Signal 18:1623–1641. doi: 10.1089/ars.2012.4973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Kadokura H, Beckwith J. 2009. Detecting folding intermediates of a protein as it passes through the bacterial translocation channel. Cell 138:1164–1173. doi: 10.1016/j.cell.2009.07.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Fujimoto T, Inaba K, Kadokura H. 2019. Methods to identify the substrates of thiol-disulfide oxidoreductases. Protein Sci 28:30–40. doi: 10.1002/pro.3530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Shang Y, Wang M, Xiao G, Wang X, Hou D, Pan K, Liu S, Li J, Wang J, Arif BM, Vlak JM, Chen X, Wang H, Deng F, Hu Z. 2017. Construction and rescue of a functional synthetic baculovirus. ACS Synth Biol 6:1393–1402. doi: 10.1021/acssynbio.7b00028. [DOI] [PubMed] [Google Scholar]
- 34.Pigiet VP, Schuster BJ. 1986. Thioredoxin-catalyzed refolding of disulfide-containing proteins. Proc Natl Acad Sci U S A 83:7643–7647. doi: 10.1073/pnas.83.20.7643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Shao W, He L, Chen Q, Li J, Deng F, Wang H, Hu Z, Wang M. 2019. Functional characterization of the group I alphabaculovirus specific gene ac73. Virol Sin 34:701–711. doi: 10.1007/s12250-019-00146-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. doi: 10.1016/0378-1119(89)90358-2. [DOI] [PubMed] [Google Scholar]
- 37.Hughes PR, Van Beek NAM, Wood HA. 1986. A modified droplet feeding method for rapid assay of Bacillus thuringiensis and baculoviruses in noctuid larvae. J Invertebr Pathol 48:187–192. doi: 10.1016/0022-2011(86)90122-9. [DOI] [Google Scholar]