Abstract
The skeletal muscle T-tubule is a specialized membrane domain essential for coordinated muscle contraction. However, in the absence of genetically tractable systems the mechanisms involved in T-tubule formation are unknown. Here, we use the optically transparent and genetically tractable zebrafish system to probe T-tubule development in vivo. By combining live imaging of transgenic markers with three-dimensional electron microscopy, we derive a four-dimensional quantitative model for T-tubule formation. To elucidate the mechanisms involved in T-tubule formation in vivo, we develop a quantitative screen for proteins that associate with and modulate early T-tubule formation, including an overexpression screen of the entire zebrafish Rab protein family. We propose an endocytic capture model involving firstly, formation of dynamic endocytic tubules at transient nucleation sites on the sarcolemma, secondly, stabilization by myofibrils/sarcoplasmic reticulum and finally, delivery of membrane from the recycling endosome and Golgi complex.
Subject terms: Cell biology, Developmental biology
It is unclear how the T-tubule structure of skeletal muscle, which regulates coordinated muscle contraction, forms. Here, the authors develop a four-dimensional quantitative model for T-tubule formation in zebrafish, based on live imaging, proposing a dynamic endocytic capture model.
Introduction
The transverse tubule (T-tubule) system of skeletal muscle is an extensive membrane domain that allows action potentials from innervating neurons to reach the depths of muscle fibres thereby triggering calcium release in a synchronised fashion. The T-tubule system is a vital component of the skeletal muscle, frequently disrupted in muscle disease. This is exemplified by aberrant T-tubules and mutations in key T-tubule components in many human myopathies1–6. An understanding of the biogenesis of this enigmatic organelle is necessary for further insight into these diseases; however, progress has been compromised by the absence of adequate experimental models.
The T-tubule system develops within a defined, but extended period, in mammalian systems. In the mouse, the T-tubules are first observed as longitudinal elements at E167 which gradually become organised into transverse elements from around birth to post-natal day 108. The mature T-tubule system is an elaborate system of surface-connected tubules permeating the entirety of the muscle fibre, and occupying a volume greater than that of the sarcolemma from which is it is thought to be derived9. The mature T-tubule system has a protein and lipid composition which is distinct from the sarcolemma, and an extremely precise organisation and morphology which includes linear elements and triad junctions at specific points, making contact with the sarcoplasmic reticulum. No cell culture systems faithfully reproduce the development of the highly organised T-tubule system characteristic of vertebrate muscle, and a tractable vertebrate animal model has been lacking until now.
Here, we establish an in vivo model to follow formation of T-tubules in real time. We combine live confocal imaging with state-of-the-art electron microscopic approaches, genome editing and quantitative overexpression screening to define the membrane pathways and molecular processes orchestrating T-tubule development. We derive a model for T-tubule formation involving the co-option of existing endocytic pathways and spatially restricted tubule capture to generate the organised T-tubule system.
Results
In vivo visualisation of T-tubule development
In order to provide robust visualisation of the developing T-tubule system, we first tested several transgenic markers and vital dyes for co-labelling with the T-tubule specific protein Bin110–12 (Fig. 1a–e, Supplementary Fig. 1a, b). We found that fluorescent proteins tagged with the CaaX domains from either H-ras or K-ras were robustly localised to the T-tubules, as well as to the sarcolemma at 48 hpf (Fig. 1a, b). For this reason we obtained an existing transgenic line which strongly and robustly expresses GFP-CaaX in all cells from a ubiquitous promoter to use in our analyses13. This general membrane marker allowed us to visualise development of the T-tubule membrane system at an early stage without bias caused by focussing on specific proteins. To investigate the development of the T-system during the transition from nascent myotube to muscle fibre, we imaged transgenic embryos from immediately post-fusion of the fast muscle (16 hpf), until 48 hpf when the T-tubules were observed to penetrate the cell all the way from the sarcolemma to the midline of the fibre (Fig. 1f, Supplementary Movies 1 and 2). Direct measurements from still images showed that the T-tubules adopted a regular spacing at 1.9 µm intervals.
A quantitative model of T-tubule development
In order to understand the development of the T-system in a quantitative manner, and to probe more deeply our observations from light microscopy, we turned to electron microscopy. We used a potassium ferricyanide stain on thin transmission electron microscopy (TEM) sections to label the T-tubules8 and distinguish them from sarcoplasmic reticulum (SR). Sections taken at 16 hpf showed electron dense, transverse oriented tubular membranes associated with the forming Z-lines (arrow Fig. 2a). By contrast, transverse sections taken towards the centre of the sarcomere some distance away from the Z-lines showed association of longitudinal sarcoplasmic reticulum (identifiable by its beaded appearance and lower electron density) with the early myofibrillar material (arrowhead, Fig. 2c). By 48 hpf, the myofibrillar bundles, analogous to previously described nascent myofibrils14 developed longitudinal furrows as they increased in diameter consistent with the Goldspink model of myofibrillar splitting during growth15 (Fig. 2b, d–f). Thin sections and serial blockface scanning electron microscopy with 3D reconstruction showed that these furrows contained SR and, at the level of the Z-line, T-tubules (Fig. 2b, d–j, Supplementary Movie 3). Tracing of thin sections taken between 16 hpf and 10 dpf showed that furrows develop in a spatially predictable manner, such that each contractile filament maintains close proximity to a furrow, and consequently a T-tubule (Fig. 2k). We reasoned that these reiterated spatial relationships would be amenable to mathematical modelling.
To produce a quantitative mathematical model of membrane sequestration into the forming tubules, we required more accurate empirical data from larger numbers of developing muscle fibres than is possible using serial blockface methods. Instead, we assembled large mosaics of tiled TEM micrographs covering entire transverse sections through the trunk musculature at 48 hpf, 5 dpf and 10 dpf. Using custom written image analysis macros we were able to produce masks defining muscle fibres, myofibrils and furrows within a half-section through an entire animal (Fig. 3a–c), and extract morphometric data (Fig. 3d, e, Supplementary Fig. 3a–c).
Using the functions derived from these empirical measurements, and from measurements of somite width (Fig. 3f; a proxy for fibre length) and T-tubule diameter (Fig. 3g), we derived a single equation to predict the total surface area of T-tubule membrane within muscle fibres of specified length and diameter (Supplementary Fig. 3d–g, full details are given in the Methods). With this model we calculated that the T-tubule system (only identifiable after 16 hpf), has developed into a complex organelle with a surface area comprising 35% of the total surface area of the cell (2579 : 4817 µm2; T-system : sarcolemma) by 48 hpf (total surface area = T-system surface area + sarcolemma). By 5 dpf the relative surface area of the T-tubule domain gradually increases to 40% (4737 : 7092 μm2) and after 10 dpf will overtake the surface area of the sarcolemma (13695 : 14456 μm2; 49%). For the largest fibres in adult fish, we applied our model to fibres from a 12-month-old male from the zebrafish atlas (http://bio-atlas.psu.edu/zf/view.php?s=220&atlas=18; http://bio-atlas.psu.edu/zf/view.php?s=275&atlas=17), where the largest fibres are approximately 580 µm in length and have diameters of up to 40 µm. In these fibres, our model predicts that the T-tubule system has approximately 1.5 times of the total surface area of the cell (Fig. 3h, i). The increase in surface area of the two membrane systems during the two early time periods correspond to an average of ~1.03 μm2 min−1 of new membrane addition for the entire 48 h–5 dpf period and ~2.27 μm2 min−1 for the 5 dpf to 10 dpf period. These results emphasise the magnitude of new membrane synthesis and, necessarily, flow through and delivery from the Golgi complex to allow this membrane expansion. Previous studies have suggested a maximal rate of approximately 2.7 µm2 of membrane min−1 for passage through the Golgi complex in rapidly dividing transformed cell lines16 which would be adequate for the generation of the T-tubule system and for the expansion of the sarcolemma based on our estimates. However, additional membrane synthesis would obviously be required for the generation and expansion of the other crucial membrane systems during this period such as the SR. This implies that specific cellular machinery must be upregulated at the onset of T-tubule formation, including components required for membrane synthesis, for sorting, and for targeted delivery to specific domains including the T-tubule system during this growth period.
Stability is dependent upon sarcomere integrity
The strict association of the T-tubules with the sarcomeric Z-lines led us to question whether the contractile apparatus was involved in the scaffolding of T-tubules during development. To examine further the relationship of sarcomerogenesis to T-tubule development, we made a transgenic line expressing a red fluorescent protein fused to the lifeact tag17, which labels F-actin, including sarcomeric actin. Live imaging of fish carrying both red Lifeact and green CaaX transgenes revealed transverse tubules invariably extended inwards towards the midline of the cell while maintaining a perpendicular association with the developing actin-containing myofibrils (Fig. 4a, b, Supplementary Movie 4), in agreement with our EM data. Examination of the sarcoplasmic reticulum, marked by another stable transgenic line expressing a red fluorescent protein tagged with an N-terminal calreticulin signal sequence and a C-terminal (KDEL) ER retention sequence, showed that the SR also adopts a regular, Z-line associated arrangement upon sarcomerogenesis (Fig. 4c, d). Titin cap (Supplementary Fig. 4a, b), alpha-actinin (c–d) and junctophilin 1a (e–f) were also spatially associated with T-tubule development, whereas SERCA1, a marker of the non-junctional SR was specifically excluded from the CaaX positive T-domain (g–h). Finally, in order to test directly whether tubule formation is directly dependent upon the sarcomere, we employed a loss of function approach using CRISPR-Cas918. We generated embryos possessing null alleles of slow myosin heavy chain (the only myosin expressed in zebrafish slow muscle at early stages19). All slow muscle cells in these embryos showed a reduction in the distance between T-tubules, reflecting a concertina effect on the sarcomeres, where the Z-lines became closer together (Fig. 4e, g). Next, we generated a null allele of titin, the molecular scaffold which links myosin filaments to the Z-line20. In these mutants, the T-tubules completely lost their transverse structure and instead became a disorganised meshwork (Fig. 4f). TEM images showed unstructured myosin and actin filaments and narrow unstructured electron dense tubules (Fig. 4h–j). We noted however, the stochastic coalescence of junctional SR and electron dense tubule (arrows, Fig. 4i, j). Quantitation of the minimum diameters of SR-associated vs non-SR associated T-tubule (oblique cut tubes) in titin mutants showed a 90% increase in average diameter (43.5 vs 22.8 µm) in tubules associated with SR, suggesting that tubule morphology is influenced by interactions with SR or thin filament components (Fig. 4k).
T-tubules are stabilised by endocytic capture
The tight association of the forming T-tubules with the Z-line and junctional SR led us to investigate further the first interactions of the tubules with the forming contractile apparatus. Using live imaging, we observed at the earliest stages, both tubular and vesicular CaaX positive structures beneath the plasma membrane (Fig. 5a–c). These tubular structures appeared to then become stabilised into the familiar transverse-orientated tubules regularly spaced at 1.9 µm intervals. We next asked whether, during formation, the T-tubules are in fact surface-connected, or whether the nascent tubule begins as an internal compartment which opens to the extracellular milieu later in development. To test this, we performed intramuscular injection of Alexa-647 labelled UTP, which has been used as a low molecular weight fluorescent tracer that is unable to cross an intact plasma membrane21. Injection of the tracer into 16, 24 or 48 hpf GFP-CaaX zebrafish resulted in immediate infiltration into the tubules, confirming surface connectivity (Fig. 5d–f). Similarly, uptake of the fluid-phase marker Alexa-647-dextran (10,000 MW), also resulted in immediate infiltration into the tubules, whereas uptake into putative endosomes only occurred after several minutes (Fig. 5g, Supplementary Movie 5). Serial blockface scanning electron microscopy and 3D reconstruction of 48 hpf fibres at high resolution showed narrower tubular connections between the plasma membrane and the stabilised, sarcomere associated tubules (Fig. 5h). In areas where sarcomeres were separated from the plasma membrane by cytoplasm, these connecting tubules frequently looped and formed connections to the sarcolemma some distance from their origin (Supplementary Fig. 5a). Injection of unconjugated horse radish peroxidase into the circulation at 48 hpf also resulted in infiltration into the tubules (Supplementary Fig. 5b, c). Taken together with our analyses of smyhc1 and titin mutants, these data suggest that the earliest detectable tubules are surface-connected and are therefore analogous to endocytic tubules. In this model, tubules derived from the sarcolemma would be stabilised when they interact with the contractile apparatus either directly, or through specification of the junctional sarcoplasmic reticulum, a process which we term endocytic capture.
Molecular composition of the early T-tubules
In order to probe the composition of the early tubules in zebrafish muscle, and to gain insight into their biogenesis, we sought to examine the localisation of the zebrafish orthologues of a suite of trafficking and T-tubule associated markers previously defined in mammalian systems (Fig. 6a–j). We developed a set of computational tools which allowed us to perform quantitative analyses of the association of transiently expressed fluorescently tagged proteins with the T-tubules in an unbiased fashion with reasonable throughput. Using this pipeline, we were able to calculate localisation values for defined domains, in this case T-tubule and sarcolemma (Fig. 6i, j) from large numbers of replicated images using ImageJ (full code is given in Supplementary Software). We were also able to calculate the extent of T-tubule perturbation, by comparing the amplitude of CaaX intensity along the longitudinal axes of the cells (Fig. 6k–m). These analyses showed a striking and selective enrichment of a subset of these proteins; Bin1b, Cavin4a and Cavin4b, EHD1a, Cav3, Dynamin2b and CD44b to the area of the Z-line and junctional SR (Fig. 6a–j, Supplementary Fig. 6a–g). Localisation of these factors to this intracellular domain suggested an endocytic tubule formation mechanism with similarities to those described in non-muscle cells22,23. To test a functional role for these proteins, we generated dominant negative forms of these proteins where possible, and compared the amplitude plots of the CaaX marker as a measure of the extent of perturbation (Fig. 6l, m). We found a marked reduction in amplitude with expression of some of the dominant negative forms, in particular, EHD1a-dEH and EHD1b-dEH (Fig. 6d, m, Supplementary Fig. 6a, b). Notably, in the cases of EHD1a and EHD1b, tubule intensity was also increased when the wildtype proteins were expressed. These analyses demonstrate that endocytic protein function is necessary for the normal development of the T-system and suggests a model where formation occurs by co-option of existing endocytic machinery.
Next, we used a set of well-established probes to examine the phosphoinositide composition of the T-tubules, since different membrane compartments have particularly distinct phosphoinositide signatures. T-tubule phosphoinositide composition has not been directly studied in vivo, although enrichment of PtdIns(4,5)P2 on early tubules in C2C12 cells, and a tenfold increase in total phosphoinositides upon differentiation into myotubes have been demonstrated10. Of all probes tested, LactC2/PS, had the highest T-tubule signal (Fig. 7a, h) consistent with a previous biochemical study24. We also found substantial levels of BTK/PtdIns(3,4,5)P3 (Fig. 7b, h) and PLC-D/PtdIns(4,5)P2 (Fig. 7c, h) in early T-tubule membranes. Of the other probes used, ING/ PtdIns(5)P showed a small but significant localisation to the tubules (Fig. 7d, h), FAPP1/ PtdIns(4)P was largely confined to the Golgi complex as expected (Fig. 7e), ATG18/ PtdIns(3,5)P2 labelled an internal compartment consistent with lysosomes (Fig. 7f) and 2xFYVEhrs/PtdIns(3)P gave a punctate pattern consistent with early endosomes (Fig. 7g, see also GalT, lamp1 and EEA1, Supplementary Fig. 7a–c, respectively). These data suggest that a defining feature of the early tubules is a distinct lipid composition, which may form a platform on which other proteins are recruited to establish the distinct protein composition.
Overexpression screening implicates endosomal Rab proteins
In order to identify specific cellular machinery upregulated or deployed during formation of the T-tubule/SR junction, we performed an overexpression screen of the entire zebrafish Rab family. Rab proteins are key regulators of membrane trafficking, controlling almost every step of vesicle trafficking including formation, transport and fusion. Approximately 60 Rab proteins are involved in different aspects of membrane regulation in mammalian cells and the functions of many of these proteins are well described in non-muscle cells. Indeed, Rab protein overexpression has been shown to have specific functional consequences upon specific membrane trafficking processes, presumably by sequestering key regulators25, a strategy validated in other in vivo screening systems26. We generated a muscle-specific expression library by cloning each Rab open reading frame behind a muscle-specific promoter and a red fluorescent protein tag. Identified Rab proteins were further tested using specific dominant-acting mutants.
Using this systematic quantitative analysis, we found a subset of Rab proteins with specific localisation to the T-tubule/SR junction (Fig. 8a–e, i). This included Rab33bb, Rab32b and Rab40b which all showed strong and specific localisation to this region (Fig. 8a–c). Closely related paralogues frequently had markedly different profiles confirming the specificity of the screen (e.g. compare Rab33bb to Rab33ba, Fig. 8i). Rab8b specifically localised to the tubules (ranked 10th) but also frequently produced ectopic knots of CaaX-negative tubules extending beyond the leading front of tubule formation (Supplementary Fig. 8b). In this case, overexpression was also associated with a decrease, rather than an increase in T-tubule intensity (Fig. 8i). In contrast, Rab32b, ranked second for localisation, resulted in an approximately 80% increase in CaaX intensity, strongly suggestive of positive regulation of T-tubule formation (Fig. 8i). We found that the most perturbing construct was Rab6a (Fig. 8f, i). Rab6b was not localised to the T-tubules consistent with its role in vesicle fission from the Trans–Golgi Network (TGN)27. Strikingly, the next most perturbing group of Rab proteins all belong to a subset of endosomal Rabs, including Rab4a, Rab22a, Rab11ba, Rab5c which are all present on early (Rab22a, 5c) or recycling (Rab11ba, 4a, 22a) endosomes28–31 (Fig. 8h, i, Supplementary Fig. 8a, Rab11ba and Rab5c images not shown). These effects were confirmed using the lipid marker BODIPY-FLC5-Ceramide (Supplementary Fig. 8c–h) to avoid confounding effects specific to the Hras CaaX domain (note that this analysis showed that Rab23 caused redistribution of the CaaX signal, rather than a specific effect on the T-tubules themselves [compare Fig. 8g with Supplementary Fig. 8d] and was therefore omitted from further analysis). The specific role of the most perturbing Rab proteins (Rab6a, 11ba, 4a, 22a and 5c) on T-tubule development were confirmed by overexpression of the dominant negative and constitutively active variants (Supplementary Fig. 8i).
An in vitro model of T-tubule formation
Our in vivo approach allowed identification of rab proteins which localise to the triadic compartment of the sarcomere, where the T-tubules form at the interface of the junctional SR and Z-line. In order to probe further the role of these molecules in a systematic manner, and to validate their triad association, we developed a non-muscle in vitro system based on the readily transfectable baby hamster kidney (BHK) cell line. Upon transfection with zebrafish Bin1b, we found that BHK cells form an extensive plasma membrane-connected tubule system which was able to recruit both the CaaX surface marker, and caveolin3, but not the early endosomal marker snx832 (Supplementary Fig. 9e–g).
We took the top ten hits for localisation from our in vivo screen, and expressed them in this system. Remarkably, six out of the ten candidates (rab13, 8a, 8b, 33bb, 40b, 26; Fig. 9a–g) co-localised to the induced tubules suggesting that, even in the absence of both sarcomere and junctional SR they are able to be recruited to Bin1b-induced membrane tubules. Two factors (rab32b and 37; Supplementary Fig. 9a, b) marked puncta independent from the Bin1b positive tubules, and a further two did not localise to any discernible structure (rab38a and 19; Supplementary Fig. 9c, d). Combined with the in vivo screen, we can conclude that a subset of Rabs associate with the developing T-tubule/SR junction, and that the majority of these are recruited to the minimal Bin1 tubule in a model system.
Discussion
In this study, we have defined the molecular mechanisms underpinning vertebrate T-tubule development. Our unique system, utilising live imaging of transgenic zebrafish embryos, three-dimensional electron microscopy, mathematical modelling and semi-automated overexpression screening has allowed dissection of T-tubule formation in vivo, a process which has been refractory to study for decades. We propose that initial tubule formation, immediately following muscle fibre fusion, utilises the machinery of endocytosis. The T-tubule system further develops to become an extensive domain permeating the entire cell and eventually surpasses the sarcolemma in terms of surface area. Mathematical modelling of this process shows that its continuous growth requires rates of membrane synthesis comparable with those of rapidly dividing transformed cell lines. By combining overexpression screening of the entire zebrafish rab protein family with quantitative microscopic analysis we show a role for a Golgi complex small GTPase and a subset of rab proteins specific to the early and recycling endosomes in the expansion of the T-tubule system.
Based on our quantitative 4D analyses, utilising advanced light and electron microscopy, we put forward a testable model for skeletal muscle T-tubule formation comprising of three stages. Firstly, tubules derived from the sarcolemma nucleate on the inner leaflet of the plasma membrane. These early tubules possess markers of clathrin independent endocytosis, in particular CD44, EHD133 and dynamin234,35. Furthermore, we were able to reciprocally regulate T-tubule integrity when we over-expressed EHD1a or b in wildtype or dominant negative forms confirming that these proteins play a key role in this process. Secondly, these tubules are stabilised by interactions with the sarcomere, either directly or indirectly via the sarcoplasmic reticulum, a process which we have termed ‘endocytic capture’. Our three-dimensional electron microscopy revealed that the spatial positioning of the tubules was dependent upon the splitting of myofibrils to form ‘furrows’ during growth, a phenomenon described over 30 years ago but which has received little attention since15. We present evidence that the sarcomere forms the scaffold for the early T-system, since genetic disruption of the sarcomere has a downstream effect on T-tubule morphology. Scaffolding appears to occur independently of the thick filament, since genetic perturbation by deletion of myosin results only in a change in tubule spacing. Genetic perturbation of titin however, results in dysregulation of T-tubule development such that tubules lose completely any ordered orientation. They are narrower, and form only stochastic junctions with SR, where they are also significantly wider in diameter. This raises the intriguing possibility that T-tubule recruitment might actually be mediated through maturation of SR, and only indirectly by scaffolding from the sarcomere. In differentiating mouse fibres, the junctional SR appears to form absolutely concomitantly with the transversely oriented tubules8, and non-transverse tubules, such as longitudinal elements, are not associated with SR. Our data also show that the tubules extending from the sarcomere to the sarcolemma, remain narrow and tortuous, even after the mature architecture is fully developed, raising the possibility that they may be temporally and spatially dynamic, perhaps even remodelling between contraction cycles. Thirdly, because of the prodigious surface area described by our mathematical model, T-tubule development is sensitive to perturbation of trafficking pathways. It appears that vesicles containing fluid-phase dextran might interact with the forming tubules, and our data show that perturbation by overexpression of the endosomal rabs rab11ba, 4a, 22a or 5c, results in significant tubule loss, while the integrity of the sarcomere is preserved. Exactly how this directional membrane traffic into growing tubules is achieved is currently unclear, but a recent study using cultured fibroblasts from centronuclear myopathy patients carrying mutations in myotubularin, demonstrated that the myotubularin-dependent conversion of endosomal PI3P into PI4P is necessary for tethering and fusion of exocytic carriers at the plasma membrane36. A similar mechanism regulating vesicle fusion at the T-tubule would provide a common axis for the pathobiology of Bin1-, Dynamin2- or myotubularin-related centronuclear myopathies.
This study provides a paradigm for the formation and stabilisation of the T-tubule system during muscle development and establishes a framework in which to probe specific molecular events, such as causative mutations in human disease aetiology.
Methods
Zebrafish husbandry
Fish were maintainedby University of Queensland Biological Resources37. All animals were maintained on the Tuebingen/AB (TAB) background.
Animal ethics
All experimental procedures were reviewed and approved by the Molecular Biosciences Animal Ethics Committee at the University of Queensland prior to commencement.
Stable transgenic fish lines
The new transgenic lines Bact2-Lifeact-mKate2 and Bact2-mKate2-KDEL were made using the Tol2 system38,39. Freshly laid embryos were microinjected with 50ng/ul plasmid vector with 25ng/ul transposase RNA. In order to make our transposase RNA, we generated a new Gateway compatible backbone for in vitro transcription of RNA (pT3TS-Dest_R1-R3) and a new entry clone containing a codon optimised transposase sequence fused to an SV40 nuclear localisation sequence on each end (pME-nls-transposase). These were recombined in an LR reaction with p3E-pA40 to make pT3TS-nls-transposase. This plasmid was linearised with KpnI and XbaI before in vitro transcription with T3 polymerase40,41. All transgenics were crossed until Mendelian frequencies were reached, indicative of single genomic integrations. Stable lines were maintained as heterozygotes. Existing lines used in this study were acta1-EGFP-CaaX (Hras)13, acta1-Lifeact-EGFP42, acta1-mCherry-CaaX42 (Supplementary Table 1).
BODIPY staining
BODIPY vital dye staining was carried by overnight incubation in 5 µg/ml BODIPY-FLC5 (Molecular Probes, catalogue number D3521) followed by a 1 h incubation in 50 µM BODIPY-TR CellTrace (Molecular Probes, catalogue number C34556)12,21. Embryos were washed for 5 min in standard embryo media before being mounted for microscopy.
Intra-cardiac/intramuscular injection
For fluid-phase marker tracing by electron microscopy, zebrafish embryos were placed in 3.5 cm culture dishes and anaesthetised in tricaine. Approximately 1 nl of 10 mg/ml unconjugated horse radish peroxidase (Sigma-Aldrich P8375) and 5 mg/ml 2000kDa FITC-conjugated Dextran (Thermo-Fisher D7137) dissolved in water was injected into the pre-cardiac sinus at 48 hpf43. After 45 min injected embryos were checked for fluorescence in the blood vasculature before being fixed and processed for TEM. For fluid-phase marker tracing by confocal microscopy, approximately 4 nl of 1 mM Alexa-647 conjugated UTP (Thermo-Fisher A32763) was injected into the trunk musculature of 16, 24 and 48 hpf zebrafish44 and imaged immediately. For small molecular weight marker tracing by confocal microscopy, approximately 4 nl of 1 mM Alexa-647 conjugated 10,000 MW dextran (Thermo-Fisher D22914) was injected into the trunk muscle of 24 hpf zebrafish and imaged immediately.
Confocal imaging
Confocal imaging of zebrafish was performed on a Ziess 710 meta confocal microscope43. Zebrafish were mounted in 1% low melting point agarose in embryo media37, in either a MatTek dish (for inverted microscopes) or a standard 8 cm petri dish for upright microscopes. Objectives used were Zeiss water immersion ×40 N/A 1.0 (catalogue number 420762) on upright microscopes or oil immersion ×40 N/A 1.3 (catalogue number 421462) on inverted microscopes. Embryos were anaesthetized in 2.5 mM tricaine prior to imaging. Confocal imaging of BHK cells was carried out at 37 °C on a Zeiss Inverted LSM 880 with Airyscan using a ×40 Plan Apochromat objective (catalogue number 420762-9800-799). At 18 h post transfection, cell culture medium was replaced with phenol red free DMEM/F12 medium (Invitrogen Australia, 11039-021) containing 10% FBS 1 h prior to microscope imaging.
Tissue culture
BHK cells from a baby hamster kidney fibroblast cell line (ATCC CCL-10), were cultured in DMEM (Life Technologies Australia Pty Ltd Invitrogen, 11995073) supplemented with 10% (vol/vol) FBS (GE Healthcare Australia, SH30084.03) and 1% (vol/vol) L-glutamine (Life Technologies Australia, 25030-081)45. Cells were seeded onto glass bottom dishes and at 70% confluence were transfected with DNA constructs using Lipofectamine 3000 reagents (Life Technologies Australia Pty Ltd Invitrogen, L3000015). All cells used were between passage 9 and 13 and all cell lines in use in our laboratory are subject to a quarterly mycoplasma testing regime using the Lonza MycoAlert Mycoplasma detection kit (LT07-418).
Mosaic transgenesis
Plasmids were delivered to recently laid embryos by microinjection of approximately 4 nl into the yolk at 15 ug/ml without transposase RNA. Embryos were sorted for transgenesis prior to imaging.
Constructs and cloning
New ORFs were generated from cDNA and first cloned into pGemTeasy (Promega). Primers were designed using primer346 to the boundary between the ORF and the UTR. Expression plasmids were constructed using the Tol2 kit40. New entry clones were made by PCR subcloning from existing plasmids using primers containing gateway compatible sites. The multisite gateway system is designed so as to be able to stitch together three cassettes in the correct order and orientation within a backbone. In order to streamline the production of large numbers of constructs using many of the same cassettes, we used a strategy in which we were able to perform the gateway reaction in reverse. That is, to take one of our final expression clones and replace either the middle cassette, 3′ cassette, or both cassettes with the ccdb gene. This has the advantage that reactions are able to be performed with a smaller number of component vectors increasing the frequency of correct recombination, and that the largest and most difficult cassettes to recombine (such as promoters) do not need to be recombined in every reaction. In order to do this, we set up gateway reactions with standard volumes and vector concentrations, but only two components; the final expression clone, and the appropriate entry clone containing the ccdb/chloramphenicol cassette. In order to perform the LR reaction in reverse, we used BP clonase, transformed into ccdb resistant cells, and spread onto plates containing both ampicillin and chloramphicol. In order to substitute both middle and 3′ cassettes at the same time, used our new entry vector pDONR_p1-p3 (synthesised by Genscript, U.S.A.). All new constructs have been made available from Addgene and are listed in Supplementary Table 1.
Image processing
In order to avoid bias and ensure reproducibility, we developed a suite of custom macros for ImageJ which we were able to use for the majority of our image processing tasks (Supplementary Table 2). Full code for all macros is given in Supplementary Software. For all in vivo quantitative analyses of localisation or perturbation, six fibres from different individual fish were imaged per condition. For all confocal data sets, we first used Macro 1 “GEN_Split_to_tif_CZI_AND_LSM.ijm” to produce merged .tif files from the native Zeiss .lsm or .czi formats that could be quickly browsed. Where single images are shown, a representative image was selected and then the original confocal file was opened in Fiji (ImageJ), and the raw 16-bit data from each channel was copied and pasted directly into the RGB channels of Adobe Photoshop. Colour-blind compatible images were made by copying and duplicating the red channel into the blue to produce magenta. Brightness and contrast were adjusted as necessary. Intensity traces shown beside individual panels represent average pixel intensities across the entire panel in the x and y planes, with each channel scaled between the maximum and minimum for the channel. The traces are not intended to reflect ratios between channels, rather, these traces give an at a glance representation of the extent to which the two channels correlate, taking into account the limitation that they are averaged across the entire image. Methodology for quantitative comparisons is detailed below.
Fibre morphometrics from tiled transmission electron microscope images were captured by manual tracing into regions of interest (ROIs) using Macro 2 “GEN_Morphometrics.ijm”. This macro prevents ROIs from overlapping in the case of fibres by trimming the edges of new ROIs to abut existing ROIs. Myofibrils are trimmed to be within existing fibres, and are automatically named after the parent fibre. Similarly myofibrillar furrow ROIs are trimmed to fall within myofibril ROIs and are named after the parent ROI. Data can then be quickly extracted from the ROI set using the standard measuring tools.
Analysis of perturbation in T-tubule intensity by amplitude was performed in a semi-automated manner. In vivo samples and images can be heterogeneous in intensity and quality. However, our mosaic analysis of single overexpressing fibres in an otherwise wildtype provided a robust an internal control, and allowed us to compare domains within individual images, before comparing between images. First, Macro 3 “GEN_Split_to_green_and_blue_highlight_saturated.ijm” was used to generate .tif images from the original data with enhanced brightness and contrast, and any saturated pixels highlighted. Next, Macro 4 was used to generate sets of box ROIs covering arrays of eight T-tubules from adjacent expressing and non-expressing cells. This part of the analysis could not be automated, since the selection of equivalent areas through the midline of each cell was required. Next, Macro 5 “TT_perturbation_process.ijm” was used to extract the amplitude data from the original, raw confocal files using the ROI sets. Similarly, localisation of markers to the T-tubule domain was achieved using Macros 6 “TT_GET_circle_ROIs_for_localisation_comparison.ijm” and 7 “GEN_Put_circle.ijm” to define each localisation domain, and Macro 8 “TT_localisation_comparison_process.ijm” to extract the intensity data using the ROI sets. Macros 5 “TT_perturbation_process.ijm” and 8 “TT_localisation_comparison_process.ijm”, apply a median filter with a pixel radius of 1 to the raw images before data extraction, to prevent potential noise generated by pixel spikes.
ROI sets were able to be exported to vector based .svg files using the python script “Export ROIs in RoiManager to a SVG file” from the “Python + ImageJ, Fiji Cookbook” at the BioImage Analysis Wiki http://wiki.cmci.info/start.
Transmission electron microscopy
Zebrafish were anaesthetised with tricaine (Sigma) in E3 and fixed with 2.5% glutaraldehyde in a Pelco BioWave microwave at 80 W for 6 min under vacuum in a 2 min on, 2 min off, 2 min on, sequence. The head and tail-tips of the zebrafish embryos were removed and the remaining trunk was re-fixed in 2.5% glutaraldehyde in the microwave using the same sequence. Zebrafish were then processed as follows47. Samples were washed in PBS and postfixed in 2% OsO4 with 1.5% potassium ferricyanide. Samples were washed in water and incubated in a 1% (w/v) thiocarbohydrazide solution for 20 min. Tissue was postfixed again in 2% OsO4, washed in water and stained with 1% uranyl acetate. Tissue was further stained with a lead aspirate solution (20 mM lead nitrate, 30 mM asparatic acid, pH 5.5), serially dehydrated in acetone, infiltrated with resin and polymerised. Ultrathin sections were cut on a Leica UC6 ultramicrotome and imaged at 80 kV on a JEOL-1011 transmission electron microscope fitted with an Morada 2k × 2k CCD camera under the control of Olympus iTEM software. Embryos injected with HRP (Supplementary Fig. 5b, c) were not stained with potassium ferricyanide. Instead, they were washed with DAB in cacodylate buffer for 1 min and subsequently treated with DAB in cacodylate buffer containing H2O2 for 30 min at room temperature. Embryos were postfixed in 1% OsO4 for 15 min to provide contrast before dehydration and embedding as described above.
Large-area tiled TEM
Large-area imaging was performed on a Tecnai T12 G2 (FEI) transmission electron microscope at 120 kV fitted with a Direct Electron LC-1100 4k × 4k CCD camera using the Navigator program in SerialEM48. Images were captured with a pixel size of 8 nm and montages were aligned using the blendmont program in IMOD49. Images for all time points were captured using the same settings.
3View Serial blockface scanning electron microscopy
Samples for serial blockface sectioning scanning electron microscopy were processed as for TEM. Imaging was performed on a Zeiss Gemini FE-SEM fitted with a Gatan 3view, at 2.25 kV, with magnification 7.5k and a pixel size of 5.7 nm. Images were captured at a resolution of 5000 × 5000 (dwell 2), under low vacuum (8 Pa) with 50 nm sections. Image stacks were aligned using the xfalign program in IMOD and automated segmentation was performed by density-based thresholding in the Isosurface render program in IMOD.
Focussed ion beam electron microscopy
Following glutaraldehyde fixation and washing samples were placed in 2% osmium tetroxide in 0.1M cacodylate buffer and incubated in a Pelco Biowave at 80 W for 6 min under vacuum in a 2 min on, 2 min off, 2 min on, sequence. The osmium solution was removed without rinsing and a solution of 2.5% potassium ferricyanide was added and placed into the Pelco BioWave for a further 6 min, at 80 W, under vacuum on a 2 min on, 2 min off 2 min on, sequence. Samples were then removed and washed in distilled water 6 times for 2 min. Samples were further incubated in an aqueous filtered solution of 1% thiocarbohydrazide, (6 min under vacuum) in a 2 min off 2 min on sequence. After rinsing in distilled water in a 6 × 2 min sequence, samples were placed in an aqueous 2% osmium tetroxide for 6 min under vacuum in a 2 min on, 2 min off, 2 min on, sequence. After rinsing in distilled water in a 6 × 2 min sequence, samples were placed in 1% uranyl acetate solution and again irradiated at 80 W for 3 min. Samples were removed and washed in distilled water in a 6 × 2 min sequence, and dehydrated through an ethanol series (30, 50, 70, 90 and 100% ethanol for 40 s at 250 W) in the Pelco BioWave, prior to embedding in Durcupan resin. Samples were imaged on an FEI Scios FIB Dual Beam SEM at 1.5 kV with a 0.8 nA electron beam at a resolution of 3072 × 2048, with a chamber vacuum of (1–2) × 10−4 Pa. Slicing was carried out at 30 kV with a 1 nA Ga+ ion beam. Voxel size and slice thickness was 8 nm.
Statistics and reproducibility
Linear, second and third degree polynomial regression equations for mathematical modelling (Fig. 3d–f) were generated using the LINEST function in Excel (Microsoft). A one-tailed T-test was used to compare inter T-tubule distance between fast and slow fibres from smyhc1−/− mutants (Fig. 4g; Microsoft Excel, T.TEST function for heteroscedastic data). One-tailed T-tests were also used to compare average pixel intensity at the T-tubule domain compared to the inter T-tubule domain (localisation data, Figs. 6j, m, 7h and 8i and Supplementary Fig. 8i; Microsoft Excel, T.TEST function for heteroscedastic data). Significance was tested on all markers showing ≥10% increase in intensity at the T-tubule compared to the inter-tubule domain. Two-tailed T-tests were used to compare average pixel intensity in overexpressing cells compared to non-expressing cells (perturbation data, Fig. 8i and Supplementary Fig. 8i) and the extent of perturbation of wildtype vs dominant negative markers (Fig.6m; Microsoft Excel, T.TEST function for heteroscedastic data). One-way ANOVA followed by a Tukey multiple comparison test was used to compare tubule diameters between ttn−/− and wildtype fish in the presence or absence of SR association (Fig. 4k; GraphPad Prism 8).
For the non-quantitative data in Figs. 1a–f, 4a–f, 5a–c and 7e–g and Supplementary Figs. 4a–h and 7a–c, and for the quantitative data in Figures Figs. 6–8 and Supplementary Figs. 6 and 8, pilot studies were carried out to assess which compartment markers localised to and the extent of variation between samples from the same condition. All subsequent quantitative and non-quantitative observations were consistent with these initial pilot studies. As such, these experiments were performed independently twice (although direct quantitation was only performed once). The dextran/Alexa-647 injection experiments in Fig. 5d–g were replicated independently three times. Electron microscopy was was performed on a minimum of two animals per experimental condition but independent replication was not carried out due to the technically demanding and labour intensive nature of the experiments.
Mathematical model
The mathematical model was built according to the following assumptions.
-
i.Each muscle fibre is assumed to be a perfect cylinder, where fibre cross-sectional area is given by the equation for the area of a circle πr2, where r = radius. Note that fibre diameter and cross-sectional area are both used in the existing literature as valid measurements of fibre dimensions in muscle cellularity studies. Our rationale in choosing fibre diameter as an input parameter rather than cross-sectional area was to provide the simplest and most applicable model. In our model, fibre cross-sectional area is calculated from fibre diameter (D) where
1 -
ii.Myofibril cross-sectional area is a function of fibre cross-sectional area and can be calculated from the linear regression equation shown in Fig. 3d (y = 0.95x − 13.55), where x is muscle fibre cross-sectional area. Combining equations for fibre cross-sectional area and myofibril cross-sectional area allows calculation of myofibril cross-sectional area from fibre diameter (D):
2 -
iii.The T-tubules track through the splits or furrows in the myofibrils, such that at the level of each and every Z-line within a fibre, the total combined length of the myofibrillar furrows in transverse section (illustrated by the red lines in Fig. 2k) will be equal to the total combined length of the associated T-tubules. Moreover, total linear furrow distance can be predicted from the cross-sectional area of the myofibrils within a fibre by the equation y = 1.26x + 6.06 (Fig. 3e). Combining equations for myofibril cross-sectional area and total linear furrow distance allows calculation of the length of T-tubule associated with each single Z-line within a muscle fibre, using the diameter area of the fibre (D):
3 -
iv.The number of units given by this equation is equal to the number of Z-lines within a muscle fibre. This value can be calculated from fibre length (L) and sarcomere length (s) using L/s. Therefore the total length of Z-line associated T-tubules within a single muscle fibre of length (L) and diameter (D) is given by
4 -
v.T-tubules are an elliptical tube with a circumference given by Ramanujan’s approximation for the perimeter of an ellipse (p) where a and b define the major and minor axes, measured from the centre to the perimeter (e.g. in the case of a circle, both a and b would be equal to the radius):
5 In our model Ramanujan’s approximation becomes the following, where d1 and d2 are the major and minor axes of T- diameters:
Dividing by 1000, to convert the output units from nm to µm gives6 7 -
vi.
The total surface area of the T-tubules within a single muscle fibre of length (L) and diameter (D) is given by combining the equations in (iv) and (v), using the major and minor axes of the cross section of an elliptical T-tubule (d1 and d2) and sarcomere length (s):
8 |
Simplifying:
9 |
10 |
11 |
12 |
13 |
14 |
15 |
16 |
17 |
18 |
19 |
20 |
21 |
22 |
23 |
24 |
25 |
26 |
27 |
28 |
29 |
30 |
31 |
32 |
33 |
34 |
35 |
36 |
37 |
38 |
39 |
40 |
41 |
42 |
43 |
44 |
Using the values calculated from our experimental data of d1 = 59.24 nm, d2 = 96.47 nm, s = 1.9 µm, this simplifies to
45 |
If cross-sectional area (C) is preferred as an input parameter, which may be of use to some investigators:
46 |
Using the values calculated from our experimental data of d1 = 59.24 nm, d2 = 96.47 nm, s = 1.9 µm, this simplifies to
47 |
The surface area of plasma membrane (sarcolemma) is calculated using equations for the area of a circle πr2, where D is the fibre diameter (and D/2 is the radius, r):
48 |
and has a circumference given by 2πr:
49 |
Multiplying the cross-sectional area by 2 gives the surface area of each of the fibre ends, and multiplying the circumference by the fibre length (L), gives the remainder of the surface area. The total surface area, excluding the T-tubules, is therefore given by
50 |
Application of the mathematical model to 48 hpf, 5 dpf 10 dpf and adult zebrafish
In order to calculate the surface areas of the T-tubule and sarcolemma at 48 hpf, 5 dpf and 10 dpf, values for fibre length (L) were 90.23 µm, 107.77 µm and 158.83 µm respectively, and were calculated using the regression equation for somite width (y = 0.2x3 − 2.6x2 + 17x + 65; Fig. 3f) for values of x = 2, x = 5 and x = 10. Values for maximum fibre diameter (D) were 15.64 µm, 19.23 µm and 26.72 µm respectively (directly measured cross-sectional areas of 192.04 µm2, 290.42 µm2 and 560.86 µm2) taken from the empirically derived data shown in Fig. 3a–c. Note that these calculations were based on maximum fibre size (rather than the mean size or animal age) since new fibres are continuously added to the myotome and existing fibres grow at different rates (see cellularity profile histograms in Supplementary Fig. 3a–c). To apply this model to the largest fibres found in adult zebrafish we took approximate measurements from the zebrafish atlas images at (http://bio-atlas.psu.edu/zf/view.php?s=220&atlas=18; http://bio-atlas.psu.edu/zf/view.php?s=275&atlas=17). The largest fibres we found in this data set were approximately 580 µm in length and 40 µm in diameter. Applying values of L = 580 µm and D = 40 µm, gave values of 113083 : 75398 µm2; (T-system : sarcolemma) which corresponds to approximately 1.5x. The graphs in Fig. 3h, i show the consequences of scaling fibre length and diameter up to the maximal values measured from 1 year old fish of L = 580 µm and D = 40 µm (cross-sectional area = 1256.64 µm2).
In order to find the point at which the surface area of the sarcolemma and the surface area of the T-tubules are equal (the intercept, shown as a dotted line in Fig. 3h, i), we equated the formulae as follows:
51 |
Solving for L:
52 |
53 |
54 |
55 |
56 |
57 |
58 |
59 |
60 |
61 |
62 |
63 |
Solving for D (beginning from Eq. (58)):
64 |
65 |
66 |
Applying the quadratic formula gives
67 |
CRISPR/Cas9
Guide RNAs were designed using CRISPRscan software50. To generate vectors for sgRNA production we modified the pT7-gRNA vector51 to include a ccdb cassette vector (pT7-gRNA-ccdb) for negative selection to improve cloning efficiency, which in hands, was low with the original. sgRNA sequences were incorporated by one-step oligo annealing and ligation using BsmBI51. DNA templates were generated from these plasmids using a 100 µl PCR (98° for 5 s followed by 35 cycles of 98° for 5 s, 55° for 5 s, 72° for 20 s) and the generic primers sgRNA_F1 (5′-GCAGCTGGCACGACAGGTTTCC-3′) sgRNA_R1 (5′-AAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTT-3′). sgRNAs were generated from the purified amplicons using the Ambion MegaShortScript kit (quarter size reactions). sgRNAs were complexed with EnGen Spy Cas9 NLS protein (New England Biolabs M0646T) for 5 min at 37 °C before injection of approximately 4 nl into the yolk at the one cell stage. Gene-specific sgRNAs were co-injected with an sgRNA targeting tyrosinase51, to allow selection of founders possessing the highest cutting frequencies. The molar ratio of Cas9 to total sgRNA was 1:1.5. Founders were outcrossed and F1 animals were genotyped by sequencing to identify null mutations and mutant lines were maintained as heterozygotes. sgRNA sequences used were tyr_8051 (5′-GGACTGGAGGACTTCTGGGG-3′), smyhc1_977 (5′-CAGTGGCAATCAACTCTTCGG-3′) and ttn.1_C352 (5′-TACTGGGGAATTCAGTGAAGG-3′).
Knockout fish lines
The slow myosin heavy chain mutant generated in this study contains a 2 bp deletion in the slow myosin heavy chain open reading frame (AACGTCAGTGGCAATCAACT[CTdel]TCGGCATCATCAATCGATGC). The titin mutant ttn.1 generated in this study contains a 2bp deletion/7bp insertion in the titin open reading frame (TGGGTACTGGGGAATTCAGT[GAdel]/[AGTATGGin] AGGCAGTATGGAAACTGCAC).
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Acknowledgements
The authors are grateful to Nick Hamilton for advice on image analysis, ImageJ macro programming and equation simplification and Markus Kerr and Alpha Yap for contributing ideas and comments on the manuscript. This work was supported by fellowships and grants from the National Health and Medical Research Council of Australia (to R.G.P., grant numbers 569542 and 1045092; to R.G.P., grant number APP1044041; and to T.E.H. and R.G.P., grant number APP1099251), the Australian Research Council (to T.E.H. and R.G.P., grant number DP200102559) as well as by the Australian Research Council Centre of Excellence in Convergent Bio-Nano Science and Technology (to R.G.P., grant number CE140100036). Confocal microscopy was performed at the Australian Cancer Research Foundation (ACRF)/Institute for Molecular Bioscience (IMB) Dynamic Imaging Facility for Cancer Biology, established with funding from the ACRF. The authors acknowledge the facilities, and the scientific and technical assistance, of the Australian Microscopy & Microanalysis Research Facility at the Centre for Microscopy and Microanalysis, The University of Queensland, in particular, Robyn Webb, Rick Webb, and Hui Diao for serial blockface and focussed ion beam electron microscopy.
Source data
Author contributions
Conceptualisation, T.E.H. and R.G.P.; Methodology, T.E.H., R.G.P, Z.X., N.A., C.F.; Y.L. Validation, T.E.H.; Formal Analysis, T.E.H.; Investigation, T.E.H., N.M., A.X., N.A., J.R. and C.F.; Resources, T.E.H., N.M., H.P.L., Z.X.; Writing, T.E.H.; Visualisation, T.E.H.; Supervision T.E.H. and R.G.P.; Project Administration T.E.H. and R.G.P.; Funding Acquisition T.E.H. and R.G.P.
Data availability
The authors declare that all data supporting the findings of this study are available within the article and its supplementary information files or from the corresponding author upon reasonable request. Data from the zebrafish Bio-Atlas was used in this study (http://bio-atlas.psu.edu/). All plasmids created and used in this study have been made available from a not for profit repository (Addgene; https://www.addgene.org/Rob_Parton/). A full list along with unique identifiers are given in Supplementary Data 1. Source data are provided with this paper.
Code availability
Custom Fiji (ImageJ) macros are listed in Supplementary Table 2, and full code is given in Supplementary Software.
Competing interests
The authors declare no competing interests.
Footnotes
Peer review information Nature Communications thanks Vincenzo Sorrentino, Tobias Starborg and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Thomas E. Hall, Email: thomas.hall@imb.uq.edu.au
Robert G. Parton, Email: r.parton@imb.uq.edu.au
Supplementary information
Supplementary information is available for this paper at 10.1038/s41467-020-17486-w.
References
- 1.Betz RC, et al. Mutations in CAV3 cause mechanical hyperirritability of skeletal muscle in rippling muscle disease. Nat. Genet. 2001;28:218–219. doi: 10.1038/90050. [DOI] [PubMed] [Google Scholar]
- 2.Bitoun M, et al. Mutations in dynamin 2 cause dominant centronuclear myopathy. Nat. Genet. 2005;37:1207–1209. doi: 10.1038/ng1657. [DOI] [PubMed] [Google Scholar]
- 3.Laporte J, et al. A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat. Genet. 1996;13:175–182. doi: 10.1038/ng0696-175. [DOI] [PubMed] [Google Scholar]
- 4.Liu J, et al. Dysferlin, a novel skeletal muscle gene, is mutated in Miyoshi myopathy and limb girdle muscular dystrophy. Nat. Genet. 1998;20:31–36. doi: 10.1038/1682. [DOI] [PubMed] [Google Scholar]
- 5.Minetti C, et al. Impairment of caveolae formation and T-system disorganization in human muscular dystrophy with caveolin-3 deficiency. Am. J. Pathol. 2002;160:265–270. doi: 10.1016/S0002-9440(10)64370-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Nicot A-S, et al. Mutations in amphiphysin 2 (BIN1) disrupt interaction with dynamin 2 and cause autosomal recessive centronuclear myopathy. Nat. Genet. 2007;39:1134–1139. doi: 10.1038/ng2086. [DOI] [PubMed] [Google Scholar]
- 7.Flucher BE, Phillips JL, Powell JA, Andrews SB, Daniels MP. Coordinated development of myofibrils, sarcoplasmic reticulum and transverse tubules in normal and dysgenic mouse skeletal muscle, in vivo and in vitro. Dev. Biol. 1992;150:266–280. doi: 10.1016/0012-1606(92)90241-8. [DOI] [PubMed] [Google Scholar]
- 8.Franzini Armstrong C. Simultaneous maturation of transverse tubules and sarcoplasmic reticulum during muscle differentiation in the mouse. Dev. Biol. 1991;146:353–363. doi: 10.1016/0012-1606(91)90237-w. [DOI] [PubMed] [Google Scholar]
- 9.Jayasinghe ID, Launikonis BS. Three-dimensional reconstruction and analysis of the tubular system of vertebrate skeletal muscle. J. Cell Sci. 2013;126:4048–4058. doi: 10.1242/jcs.131565. [DOI] [PubMed] [Google Scholar]
- 10.Lee E, et al. Amphiphysin 2 (Bin1) and T-tubule biogenesis in muscle. Science. 2002;297:1193–1196. doi: 10.1126/science.1071362. [DOI] [PubMed] [Google Scholar]
- 11.Millar CA, Powell KA, Hickson GR, Bader MF, Gould GW. Evidence for a role for ADP-ribosylation factor 6 in insulin-stimulated glucose transporter-4 (GLUT4) trafficking in 3T3-L1 adipocytes. J. Biochem. 1999;274:17619–17625. doi: 10.1074/jbc.274.25.17619. [DOI] [PubMed] [Google Scholar]
- 12.Cooper MS, et al. Visualizing morphogenesis in transgenic zebrafish embryos using BODIPY TR methyl ester dye as a vital counterstain for GFP. Dev. Dyn. 2005;232:359–368. doi: 10.1002/dvdy.20252. [DOI] [PubMed] [Google Scholar]
- 13.Williams RJ, et al. The in vivo performance of an enzyme-assisted self-assembled peptide/protein hydrogel. Biomaterials. 2011;32:5304–5310. doi: 10.1016/j.biomaterials.2011.03.078. [DOI] [PubMed] [Google Scholar]
- 14.Sanger JW, Wang J, Fan Y, White J, Sanger JM. Assembly and dynamics of myofibrils. J. Biomed. Biotechnol. 2010;2010:858606. doi: 10.1155/2010/858606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Patterson S, Goldspink G. Mechanism of myofibril growth and proliferation in fish muscle. J. Cell Sci. 1976;22:607–616. doi: 10.1242/jcs.22.3.607. [DOI] [PubMed] [Google Scholar]
- 16.Griffiths G, Back R, Marsh M. A quantitative analysis of the endocytic pathway in baby hamster kidney cells. J. Cell Biol. 1989;109:2703–2720. doi: 10.1083/jcb.109.6.2703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Riedl J, et al. Lifeact: a versatile marker to visualize F-actin. Nat. Methods. 2008;5:605–607. doi: 10.1038/nmeth.1220. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Jinek M, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337:816–821. doi: 10.1126/science.1225829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Elworthy S, Hargrave M, Knight R, Mebus K, Ingham PW. Expression of multiple slow myosin heavy chain genes reveals a diversity of zebrafish slow twitch muscle fibres with differing requirements for Hedgehog and Prdm1 activity. Development. 2008;135:2115–2126. doi: 10.1242/dev.015719. [DOI] [PubMed] [Google Scholar]
- 20.Horowits R, Podolsky RJ. The positional stability of thick filaments in activated skeletal muscle depends on sarcomere length: evidence for the role of titin filaments. J. Cell Biol. 1987;105:2217–2223. doi: 10.1083/jcb.105.5.2217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Lim Y-W, et al. Caveolae protect notochord cells against catastrophic mechanical failure during development. Curr. Biol. 2017;27:1968–1981.e1967. doi: 10.1016/j.cub.2017.05.067. [DOI] [PubMed] [Google Scholar]
- 22.Caplan S. A tubular EHD1-containing compartment involved in the recycling of major histocompatibility complex class I molecules to the plasma membrane. EMBO J. 2002;21:2557–2567. doi: 10.1093/emboj/21.11.2557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Pant S, et al. AMPH-1/Amphiphysin/Bin1 functions with RME-1/EHD1 in endocytic recycling. Nat. Cell Biol. 2009;11:1399–1410. doi: 10.1038/ncb1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Rosemblatt M, Hidalgo C, Vergara C, Ikemoto N. Immunological and biochemical properties of transverse tubule membranes isolated from rabbit skeletal muscle. J. Biochem. 1981;256:8140–8148. [PubMed] [Google Scholar]
- 25.Kremer K, et al. An overexpression screen of Toxoplasma gondii Rab-GTPases reveals distinct transport routes to the micronemes. PLoS Pathog. 2013;9:e1003213. doi: 10.1371/journal.ppat.1003213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Chan C-C, et al. Systematic discovery of rab GTPases with synaptic functions in Drosophila. Curr. Biol. 2011;21:1704–1715. doi: 10.1016/j.cub.2011.08.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Young J, et al. Regulation of microtubule-dependent recycling at the trans-Golgi network by Rab6A and Rab6A’. Mol. Biol. Cell. 2005;16:162–177. doi: 10.1091/mbc.E04-03-0260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chavrier P, Parton RG, Hauri HP, Simons K, Zerial M. Localization of low molecular weight GTP binding proteins to exocytic and endocytic compartments. Cell. 1990;62:317–329. doi: 10.1016/0092-8674(90)90369-p. [DOI] [PubMed] [Google Scholar]
- 29.Kauppi M, et al. The small GTPase Rab22 interacts with EEA1 and controls endosomal membrane trafficking. J. Cell Sci. 2002;115:899–911. doi: 10.1242/jcs.115.5.899. [DOI] [PubMed] [Google Scholar]
- 30.Ullrich O, Reinsch S, Urbé S, Zerial M, Parton RG. Rab11 regulates recycling through the pericentriolar recycling endosome. J. Cell Biol. 1996;135:913–924. doi: 10.1083/jcb.135.4.913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Van Der Sluijs P, et al. The small GTP-binding protein rab4 is associated with early endosomes. Proc. Natl Acad. Sci. USA. 1991;88:6313–6317. doi: 10.1073/pnas.88.14.6313. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Wang JTH, et al. The SNX-PX-BAR family in macropinocytosis: the regulation of macropinosome formation by SNX-PX-BAR proteins. PLoS ONE. 2010;5:e13763. doi: 10.1371/journal.pone.0013763. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Posey AD, et al. EHD1 mediates vesicle trafficking required for normal muscle growth and transverse tubule development. Dev. Biol. 2014;387:179–190. doi: 10.1016/j.ydbio.2014.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Johannes L, Parton RG, Bassereau P, Mayor S. Building endocytic pits without clathrin. Nat. Rev. Mol. Cell Biol. 2015;16:311–321. doi: 10.1038/nrm3968. [DOI] [PubMed] [Google Scholar]
- 35.Lakshminarayan R, et al. Galectin-3 drives glycosphingolipid-dependent biogenesis of clathrin-independent carriers. Nat. Cell Biol. 2014;16:595–606. doi: 10.1038/ncb2970. [DOI] [PubMed] [Google Scholar]
- 36.Ketel K, et al. A phosphoinositide conversion mechanism for exit from endosomes. Nature. 2016;529:408–412. doi: 10.1038/nature16516. [DOI] [PubMed] [Google Scholar]
- 37.Westerfield M. The Zebrafish Book: a Guide for the Laboratory Use of Zebrafish (Danio rerio) Eugene: University of Oregan; 2007. [Google Scholar]
- 38.Kawakami K, et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Dev. Cell. 2004;7:133–144. doi: 10.1016/j.devcel.2004.06.005. [DOI] [PubMed] [Google Scholar]
- 39.Villefranc JA, Amigo J, Lawson ND. Gateway compatible vectors for analysis of gene function in the zebrafish. Dev. Dyn. 2007;236:3077–3087. doi: 10.1002/dvdy.21354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Kwan KM, et al. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Dev. Dyn. 2007;236:3088–3099. doi: 10.1002/dvdy.21343. [DOI] [PubMed] [Google Scholar]
- 41.Don EK, et al. A Tol2 Gateway-compatible toolbox for the study of the nervous system and neurodegenerative disease. Zebrafish. 2017;14:69–72. doi: 10.1089/zeb.2016.1321. [DOI] [PubMed] [Google Scholar]
- 42.Berger J, et al. Loss of Tropomodulin4 in the zebrafish mutant trage causes cytoplasmic rod formation and muscle weakness reminiscent of nemaline myopathy. Dis. Model Mech. 2014;7:1407–1415. doi: 10.1242/dmm.017376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hall TE, et al. The zebrafish candyfloss mutant implicates extracellular matrix adhesion failure in laminin 2-deficient congenital muscular dystrophy. Proc. Natl Acad. Sci. USA. 2007;104:7092–7097. doi: 10.1073/pnas.0700942104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Hall TE, et al. Cellular rescue in a zebrafish model of congenital muscular dystrophy type 1A. NPJ Regen. Med. 2019;4:1–13. doi: 10.1038/s41536-019-0084-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Ariotti N, et al. Modular detection of GFP-labeled proteins for rapid screening by electron microscopy in cells and organisms. Dev. Cell. 2015;35:513–525. doi: 10.1016/j.devcel.2015.10.016. [DOI] [PubMed] [Google Scholar]
- 46.Untergasser A, et al. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40:e115–e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Herms A, et al. Cell-to-cell heterogeneity in lipid droplets suggests a mechanism to reduce lipotoxicity. Curr. Biol. 2013;23:1489–1496. doi: 10.1016/j.cub.2013.06.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Mastronarde DN. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 2005;152:36–51. doi: 10.1016/j.jsb.2005.07.007. [DOI] [PubMed] [Google Scholar]
- 49.Kremer JR, Mastronarde DN, McIntosh JR. Computer visualization of three-dimensional image data using IMOD. J. Struct. Biol. 1996;116:71–76. doi: 10.1006/jsbi.1996.0013. [DOI] [PubMed] [Google Scholar]
- 50.Moreno-Mateos MA, et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nat. Methods. 2015;12:982–988. doi: 10.1038/nmeth.3543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Jao L-E, Wente SR, Chen W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl Acad. Sci. USA. 2013;110:13904–13909. doi: 10.1073/pnas.1308335110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Zou J, et al. An internal promoter underlies the difference in disease severity between N- and C-terminal truncation mutations of Titin in zebrafish. eLife. 2015;4:e09406. doi: 10.7554/eLife.09406. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The authors declare that all data supporting the findings of this study are available within the article and its supplementary information files or from the corresponding author upon reasonable request. Data from the zebrafish Bio-Atlas was used in this study (http://bio-atlas.psu.edu/). All plasmids created and used in this study have been made available from a not for profit repository (Addgene; https://www.addgene.org/Rob_Parton/). A full list along with unique identifiers are given in Supplementary Data 1. Source data are provided with this paper.
Custom Fiji (ImageJ) macros are listed in Supplementary Table 2, and full code is given in Supplementary Software.