Abstract
The zinc-finger protein A20 has crucial physiological functions as a dual inhibitor of nuclear factor-κB (NF-κB) activation and apoptosis in tumor necrosis factor (TNF) receptor 1 signaling pathway. Although the molecular basis for the anti-NF-κB function of A20 has been well elucidated, the anti-apoptotic function of A20 is largely unknown. Here, we report a novel mechanism underlying the anti-apoptotic function of A20: A20 blocks TNF-induced apoptosis through suppression of c-jun N-terminal kinase (JNK) by targeting apoptosis signal-regulating kinase1 (ASK1). First, the ectopic expression of A20 drastically inhibits TNF-induced JNK activation and apoptosis in multiple cell types including those deficient of NF-κB activation. Unexpectedly, the blunting effect of A20 on TNF-induced JNK activation is not mediated by affecting the TNFR1 signaling complex formation. Instead, A20 interacts with ASK1, an important MAPKK kinase in the JNK signaling cascade. More importantly, overexpression of wild-type A20, but not of mutant A20 (ZnF4; C624A, C627A), promotes degradation of the ASK1 through the ubiquitin-proteasome system. Taken together, the results from this study reveal a novel anti-apoptotic mechanism of A20 in TNF signaling pathway: A20 binds to ASK1 and mediates ASK1 degradation, leading to suppression of JNK activation and eventually blockage of apoptosis.
Keywords: TNF receptor, JNK, NF-κB, apoptosis, cellular signaling
In most cell types, it has been well established that activation of nuclear factor-κB (NF-κB) antagonizes apoptotic cell death triggered by tumor necrosis factor receptor1 (TNFR1) and several other stimuli.1,2 Although the mechanisms by which anti-apoptotic genes that are regulated by NF-κB inhibit TNF-induced apoptosis remain to be fully explored, it has been well established that the anti-apoptotic function of NF-κB downstream of TNFR1 involves suppression of the c-jun N-terminal kinase (JNK) cascade.3–5 Indeed, in mouse embryonic fibroblast cells (MEFs) lacking p65, inhibitory κB kinase (IKKβ), or stably expressing superrepressor IκBα, there is persistent JNK activation in response to TNF because of the lack of expression of NF-κB-mediated JNK inhibitors.6,7 This persistent JNK activation contributes to TNF-induced apoptosis, making those MEFs highly sensitive to TNF-induced apoptosis. Earlier, it has been proposed that a subset of NF-κB target genes including growth arrest and DNA damage-inducible 45β (GADD45β), X-linked inhibitor of apoptosis protein (XIAP), manganese superoxide dismutase (MnSOD), and ferritin heavy chain (FHC) are capable of antagonizing JNK signaling.3,6,8,9 However, the existing literature on the function of these proteins in TNFR1-mediated JNK signaling cascade is still confusing and controversial. For instance, genetic analysis of the GADD45β- or XIAP-deficient mice showed no defect in TNF-induced JNK activation and apoptosis.10,11 Moreover, in several NF-κB-deficient cells, MnSOD expression did not substantially inhibit TNF-induced apoptosis,7,9 suggesting that other proteins might be required cooperatively or independently to suppress the JNK signaling pathway. Thus, it seems that the primary mediators of NF-κB-mediated control of JNK signaling downstream of TNFR1 remain elusive.
As one of the NF-κB target genes, A20 has been well established as a negative feedback loop to block NF-κB activation in response to TNF.12–15 Recently, substantial progress has been made in understanding the biochemical and molecular mechanisms by which A20 constitutes a negative feedback loop to terminate NF-κB activation. A20 possesses dual ubiquitin editing functions to receptor interacting protein1 (RIP1), a critical signaling molecule in TNF-mediated NF-κB activation. A20 is capable of deubiquitinating K63-linked polyubiquitin chains of RIP1 by its N-terminal ovarian tumor (OTU) domain and adding K48-linked ployubiquitin chains by the C-terminal zinc finger (ZnF) containing domain.13–15 In addition to RIP1, other ubiquitinated proteins such as TRAF6 and CIAP1 have been identified as A20 targets in the NF-κB signaling pathway.16–18 Given the well established anti-apoptotic function of NF-κB and the ability of A20 to terminate NF-κB activity, A20 is expected to possess a potent pro-apoptotic function. However, the accumulating evidence suggests the opposite: A20 acts mainly as an anti-apoptotic protein, as it protects most cells from TNF-induced cell death. Overexpression of A20 protects breast cancer MCF-7 cells, fibrosarcoma WEHI164 cells, embryonic fibroblast NIH3T3 cells, and L929 cells from TNF-mediated apoptosis or necrosis.19–21 A20 also protects the cells from a number of apoptotic stimuli other than TNF. For instance, A20 protects endothelial cells from Fas/CD95 receptor ligation, lymphoblastic B cells from serum depletion, and macrophages from oxidized low-density lipoprotein.22–24
However, up to date it is still largely unknown how A20 paradoxically protects cells from TNF-induced apoptosis even it is capable of inhibiting NF-κB. Therefore, we aimed to investigate the molecular mechanisms underlying the anti-apoptotic function of A20 by focusing its regulatory function in JNK signaling downstream of TNFR1. The results from this study reveal a novel anti-apoptotic mechanism of A20 in TNF signaling pathway: A20 binds to apoptosis signal-regulating kinase1 (ASK1) and mediates ASK1 degradation, leading to suppression of JNK activation and eventually blockage of apoptosis.
Results
A20 has an essential function in the NF-κB-mediated suppression of JNK activation and apoptosis on TNFR1 ligation
To test whether A20 is involved in TNF-induced JNK activation, we first examined the time course of JNK activation after TNF treatment in the cells overexpressing A20 by ectopic infection of recombinant adenoviral vector carrying A20 (rAd-A20). TNF treatment resulted in a rapid and progressive induction of A20 expression, and overexpression of A20 efficiently blocked TNF-induced IκBα degradation (Figure 1a and b), which is consistent with an earlier report that A20 functions as a negative regulator of NF-κB.16 Pretreatment with a protein synthesis inhibitor, cycloheximide (CHX), which blocks NF-κB-dependent transcriptional events, not only abolished A20 expression, but also resulted in persistent JNK activation in response to TNF, suggesting that TNF-inducible de novo protein synthesis, including A20, is required to suppress the persistent JNK activation. More importantly, overexpression of A20 led to abolishment of JNK activation, as well as IκBα degradation after treatment with TNF and CHX (TNF/CHX) (Figure 1a and b). Consistently, knockdown of A20 by specific small hairpin RNA (shRNA) elicited the persistent IκBα degradation and JNK activation after TNF treatment (Supplementary Figure S1), indicating that A20 has a dual capacity to have in down-regulation of TNF-induced NF-κB and JNK activation. Moreover, cells with overexpression of A20 were found to be more resistant to apoptotic cell death induced by TNF/CHX, as evidenced by the cell viability assay (Figure 1c and d) and cleavage of both caspase-3 and poly(ADP-ribose)polymerase (PARP) (Figure 1e). Pretreatment of JNK-specific inhibitor SP600125 dramatically suppressed TNF/CHX-induced cell death and the cleavage of caspase-3 (Figure 1f and g), confirming that the JNK activation contributes in TNF-induced apoptosis, as reported earlier.5 On the other hand, pretreatment of an irreversible caspase-8 inhibitor z-IETD-fmk also partially suppressed TNF/CHX-induced apoptosis and caspase-3 cleavage, but with a lesser extent than that of SP600125 (Figure 1f and g). These results suggest that under the condition of NF-κB blockage, persistent JNK activation is a major cell death mechanism in TNF-induced apoptosis.
To investigate directly whether A20 is responsible for the NF-κB-mediated suppression of JNK signaling, rAd-A20 was infected ectopically into MEFs that are null of functional components of NF-κB signaling. Similar to HeLa and HEK293 cells as shown earlier, TNF treatment induced progressive expression of A20 and transient JNK activation in wild-type (WT) MEFs (Figure 2a). In contrast, in p65−/−, IKKβ−/−, and TNFR-associated factor 2/5 (TRAF2/5) double knockout (DKO) MEFs, there was no induction of A20, but with more persistent JNK activation after TNF treatment (Figure 2b–d, left panels). Remarkably, overexpression of A20 almost completely blocked the persistent JNK activation in these cells deficient of NF-κB (Figure 2b–d, right panels). Earlier, it has been reported that NF-κB-defective cells are highly susceptible to TNF-induced apoptosis, because of persistent JNK activation.7,25 Consistently, overexpression of A20 in NF-κB-deficient cells offered significant protection against TNF-induced cell death (Figure 2e–g). Taken together, these findings show that the capacity of A20 to block the persistent JNK activation is responsible for its anti-apoptotic function against TNF-induced killing in multiple cell types studied.
As NF-κB-mediated suppression of JNK activation is mainly executed through induction of its target genes, we next examined whether A20 affects the transcriptional induction of NF-κB-mediated target genes, which are known to inhibit JNK signaling. Here, we found that in cells infected with the control vector (rAd-GFP), both A20 and GADD45β were transiently induced with TNF treatment, whereas the induction of A20 was more evident and persistent than that of GADD45β (Figure 3a, left panel). Notably, the transcription of other NF-κB target genes (Mn-SOD, XIAP, and FHC) were marginally induced or occurred at late time after TNF treatment. Importantly, TNF-induced up-regulations of these genes, including GADD45β, were impaired by A20 overexpression (Figure 3a, right panel), which is likely because of the inhibitory effect of A20 on NF-κB signaling, as evidenced by the absence of p65 nuclear translocation in those cells with overexpression of A20 (Figure 3b). Taken together, data from this part of the study thus suggest that A20 is an essential NF-κB-mediated target gene to control JNK signaling after the TNF receptor ligation.
A20 does not affect the TRAF2 recruitment into TNFR1 signaling complex on TNF stimulation
It is worth noting that A20 is recruited into TNFR1 signaling complex by interacting with TRAF2, a molecule required for activation of TNF-induced JNK signaling.26,27 Therefore, it is hypothesized that the inhibitory effects of A20 on TNF-induced JNK activation might be achieved through disruption of the TNFR1 signaling complex involving TRAF2. To assess whether A20 directly affects the formation of the plasma membrane bound TNFR1 signaling complex (complex I), the recruitment of RIP1 and TRAF2 into this complex was examined. Treatment of cells with TNF led to immediate recruitment of RIP1 and TRAF2, as well as A20 into complex I (Figure 4a, left panel). Whereas the recruitment of RIP1 into complex I in rAd-GFP-infected cells was rather transient after TNF treatment, such RIP1 recruitment remained to be hyperubiquitinated in rAd-A20-infected cells (Figure 4a, first row). However, unexpectedly, the extent and duration of TNF-induced TRAF2 recruitment into complex I was not affected by A20 overexpression (Figure 4a, second row), indicating that suppression of TNF-induced JNK activation by A20 is independent of TRAF2 recruitment into complex I. This conjecture also seems to be consistent with the earlier observation that A20 is capable of protecting TRAF2/5 DKO MEFs against TNF-induced cell death (Figure 2g). To further assess whether A20 affects TNF-induced JNK activation by acting on the site of complex I, the binding of RIP1 and TRAF2 with TNFR1 in those NF-κB activation-deficient cells were monitored. As expected, TNF treatment of p65−/−, IKKβ−/−, and TRAF2/5 DKO MEFs failed to express A20 (Figure 4b, fifth row) and resulted in no detectable recruitment of A20 into TNFR1 (Figure 4b, third row). Interestingly, TNF-induced RIP1 and TRAF2 recruitments were found to be normal in p65−/− and IKKβ−/− MEFs, although TNF-induced RIP1 ubiquitination was more quickly disappeared in these NF-κB activation-deficient MEFs (Figure 4b, top two rows). From the results of above protein-binding experiments, we conclude that the inhibitory effect of A20 on TNF-mediated JNK activation is not achieved through disruption of proximal TNFR1 complex (complex I) formation.
We further examined whether A20 affects the TNFR1-associated cytoplasmic complex (complex II) formation, as reported earlier.28 Immunoprecipitation assay with a anti-FADD antibody showed that A20 was recruited into complex II in a time-dependent manner after TNF, but not TNF/CHX treatment (Figure 5a, second row). On the other hand, TNF-induced interaction between processed caspase-8 p43/41 and FADD seemed mainly in the presence of CHX (Figure 5a, first row), suggesting that the recruited A20 into complex II may affect the FADD-mediated caspase-8 activity. However, the overexpression of A20 partly suppressed the interaction between caspase-8 and FADD, as well as caspase-8 cleavage after TNF/CHX treatment (Figure 5b, first and fourth rows), whereas it markedly suppressed caspase-3 cleavage (Figure 5b, bottom row). Together with the observations that the potency of the specific caspase-8 inhibitor to suppress TNF-induced apoptosis (Figure 1f and g), these data thus suggest that the recruitment of A20 into complex II is less likely to be of importance for its anti-apoptotic function under the condition of TNF/CHX treatment.
A20 physically interacts with ASK1 in the JNK signaling cascade
As it seems that the inhibitory effect of A20 on TNF-induced JNK activation is neither associated with TNFR1 signaling complex formation nor the downstream NF-κB-mediated transcription of target genes, we next examined whether A20 physically interacts with the components of JNK signaling cascades. To address this issue, HEK293 cells were transiently transfected with Xp-tagged A20 and flag-tagged kinases [mitogen-activated protein kinase kinase kinase (MAP3K) (GCK, MEKK3, ASK1), mitogen-activated protein kinase kinase (MAP2K) (MKK4/7) or mitogen-activated protein kinase (MAPK) (JNK1/2)], and the protein–protein interactions were assessed. Notably, A20 bound strongly to ASK1, but not to other MAP3K, MAP2K, or MAPK tested (Figure 6a–c). The endogenous association of A20 with ASK1 was also confirmed in HEK 293 cells (Figure 6d and e). More importantly, TNF treatment led to an enhanced interaction between A20 and ASK1, and such interaction was dependent on A20 expression (Figure 6f). To determine the interaction regions, the deletion mutants of ASK1 and A20 were constructed and analyzed for their ability to interact, respectively (Figure 6g and i). ASK1 mutant containing a non-catalytic amino-terminal region (ASK1-N), but not the ASK1-K (containing the kinase domain) or the ASK1-C (containing the carboxy-terminal region), was able to interact with A20 (Figure 6h). In parallel, A20-N, but not A20-C, bound to ASK1 (Figure 6j). The specific association between A20 and ASK1 through the amino-terminal region was further confirmed in the cells co-transfected with each of amino-terminal fragments (Figure 6k), clearing indicating that ASK1 and A20 use their amino-terminal regions for the protein–protein interaction.
A20 reduces the stability and promotes the degradation of ASK1 through the ubiquitination process
A20 restricts TNF-induced NF-κB signaling through its ubiquitin editing activity on RIP1,14,15 it is thus of interest to test whether A20 would be affecting the stability of ASK1 through a similar mechanism. To address this hypothesis, we first examined whether the protein level of ASK1 was changed by overexpression of A20. TNF/CHX or high concentration of hydrogen peroxide (H2O2) treatment resulted in substantial increase of ASK1 expression (Figure 7a, top row). Such observations are indeed consistent with an earlier report,29 and indicate that such extracellular stimuli may enhance ASK1 stability. Notably, the level of ASK1 was dramatically decreased in cells with overexpression of A20 (Figure 7a, top row), without alteration of RIP1 and TRAF2 protein levels. In the same blot, TNF- or H2O2-induced JNK activation was suppressed by A20 overexpression (Figure 7a, second row). Moreover, H2O2 induced the cleavage of caspase-3 and PARP was significantly blocked by A20 overexpression (Supplementary Figure S2).
To further evaluate the effect of A20 on ASK1 protein level under the physiological condition, endogenous ASK1 and A20 levels were determined at different time points after TNF treatment. Indeed, there was enhanced ASK1 level at earlier time points (10 to 30 min), but started to decrease by 1 h when A20 was coincidently induced (Figure 7b, left panel). However, the enhanced protein level and kinase activity of ASK1 by TNF continued to maintain up to 2 h in cells treated with TNF/CHX (Figure 7b, right panel), suggesting that induced expression of A20 by TNF may affect the protein stability of ASK1. To confirm this possibility, we examined whether the kinetics of ectopically expressed ASK1 levels are altered by A20 overexpression in the presence of CHX. Consistently, progressive reduction of ASK1 level was observed in cells with overexpression of A20, whereas the ASK1 level remained stable up to 6 h after CHX treatment in cells without A20 expression (Supplementary Figure S3). Furthermore, the proteasome inhibitor MG132 significantly reversed the effect of A20 overexpression on the ASK1 protein level (Supplementary Figure S4), indicating that A20 targets ASK1 degradation through the proteasome-dependent pathway. We next examined the susceptibility of WT and ASK1−/− MEFs in response to TNF/CHX, aiming to understand the function of ASK1-mediated JNK activation in TNF-induced killing. As consistent with an earlier report,30 ASK1−/− MEFs was defective in persistent JNK activation, and highly resistant to TNF/CHX-induced cell death as compared with WT MEFs (Supplementary Figure S5). These results thus suggest that A20 may target ASK1 degradation, thereby suppress ASK1-mediated JNK activation, and eventually inhibit TNF-induced apoptosis.
To address whether the conserved ZnF domain of A20 might be responsible for ASK1 degradation, the full-length A20 with point mutations of conserved cystein residue to alanine within OTU (C103A), ZnF3 (C521A, C524A), or ZnF4 (C624A, C627A) domain were generated, as reported earlier.16 Overexpression of WT- or OTU MT-A20 dramatically decreased ASK1 level, whereas ZnF4 MT- or ZnF3/ZnF4 MT-A20 almost completely eliminated the effect of A20 on ASK1 level (Figure 7c, top row). Such results thus indicate that the conserved ZnF4 domain of A20 is critical for ASK1 degradation. To determine whether A20 ligates ubiquitin chains to ASK1, the immunoprecipitants of endogenous ASK1 were assayed by immunoblotting with anti-ubiquitin. Strikingly, overexpression of A20 reduced protein level of ASK1 with a concomitant increase of polyubiquitinated ASK1 (Figure 7d, top two rows). Moreover, in cells treated with TNF, there was increased level of polyubiquitinated ASK1 from 30 min onward (Figure 7e, left panel), whereas overexpression of A20 markedly enhanced ASK1 polyubiquitination (Figure 7e, right panel), confirming the ability of A20 to mediate ASK1 ubiquitination and degradation. To rule out the possibility of non-specific interaction of anti-ASK1 polyclonal antibody used in the immunoprecipitation assay, cells were co-transfected with flag-ASK1 and HA-ubiquitin, and then tested the ability of A20 to ubiquitinate the ASK1. Consistently, TNF treatment triggered ASK1 ubiquitination and this ASK1 ubiquitination was dramatically exaggerated by overexpression of A20 (Figure 7f). Taken together, we present clear evidence that A20 blunts TNF-induced JNK activation and apoptosis through interaction with ASK1 to promote its ubiquitination and subsequent proteasomal-dependent degradation.
Enhanced expression of A20 in breast cancer
The specific pathologic context where A20 participates as a predominant player in the cell death and survival process might allow a selective link between A20 and the ASK1–JNK pathway in certain types of human diseases, such as cancer. Thus, we examined the expression levels of A20 in human breast cancer tissues. As consistent with earlier reports,31,32 the expression levels of A20 were markedly enhanced in breast cancer tissues, as evidenced by immunohistochemistry and immunoblot analysis (Figure 8a and b). Cancer tissues had much higher immunoreactivity than the surrounding normal tissues, and the punctuated granular expression of A20 associated with certain vesicles was observed mainly in the cytoplasm (Figure 8a). On the contrary to the expression pattern of A20, breast cancer tissues expressed lower levels of ASK1 in almost all the samples tested (Figure 8b, top two rows). Taken together, these results suggest that enhanced expression of A20 may contribute to cellular survival through selective inhibition of the ASK1–JNK signaling during the tumorigenic processes.
Discussion
Herein, we have identified a novel mechanism responsible for the anti-apoptotic function of A20 in TNF signaling. A20 acts as a principle mediator in the termination of TNFR1-mediated JNK activation. More importantly, the engagement of A20 in this process is independent of TNFR1 signaling complex formation. Finally, we provide evidence that A20 interacts with ASK1, leading to ASK1 polyubiquitination and proteasomal degradation. Therefore, it is believed that A20 is an important element in the cross-talk between NF-κB and JNK that largely determines the fate of the cell in response to TNF.
It has been well established that suppression of the JNK signaling pathway represents a crucial protective mechanism mediated by NF-κB from TNF-induced apoptosis.3 Earlier reports suggest that NF-κB-inducible proteins such as GADD45β, XIAP, MnSOD, and FHC have important functions in suppression of JNK activation.3,8,9 In this study, MnSOD was induced by TNF at late times after the onset of the persistent JNK activation and apoptosis (Figure 3a). Furthermore, XIAP and FHC were marginally or poorly induced by TNF treatment. Thus, it seems that these factors are unlikely to be important mediators in JNK inhibition by NF-κB. One critical finding from this study is that A20 not only completely blocked the transcription of other NF-κB target genes known to antagonize JNK signaling, but also effectively suppressed TNF-induced JNK activation and apoptotic cell death in NF-κB activation-deficient MEFs (Figure 2). Thus, these findings clearly indicate that A20, rather than other described earlier JNK inhibitors, has a more predominant function in the suppression of TNF-induced JNK signaling under physiological TNFR1 ligation condition.
With regard to TNFR1 signaling, TRAF2 binds to the amino-terminal region of A20, and this interaction is required for the recruitment of A20 into TNFR1 signaling complex.26,27 Therefore, it is possible that A20 may regulate JNK signaling pathway by affecting this signaling complex formation. Indeed, an early study reported that A20 inhibited the recruitment of death domain proteins TRADD and RIP1 into TNFR1 signaling complex and thus protected Jurkat T-cell from TNF-induced apoptosis.33 In this study, A20 is also found to be transiently recruited into TNFR1 complex I as well as complex II after TNF treatment (Figures 4 and 5). Notably, TNF-induced TRAF2 recruitment into TNFR1 signaling complex was not affected by A20, indicating that the inhibitory effect of A20 on TNF-induced JNK activation is unlikely to be achieved through TRAF2. This conclusion was further supported by the fact that TNF-induced TRAF2 recruitment was normal in the condition of CHX pretreatment (data not shown) or in NF-κB activation-deficient MEFs (Figure 4b). These discrepancies with an early report33 might be resulted from cell-type difference and/or differences in experimental systems (transient adenoviral infection versus stable transfection of A20). Although TRAF2 is important to activate ASK1 and JNK in response to TNF or H2O2,4,34 we observed that overexpression of A20 sufficiently blocked the TNF-induced JNK activation and apoptosis in TRAF2/5 DKO MEFs (Figure 2). In this regard, it was of interest to determine whether ASK1 might be activated in TRAF2/5DKOMEFs after TNF treatment. Interestingly, TNF-induced persistent phosphorylation of ASK1 preserved in TRAF2/5 DKO MEFs (Supplementary Figure S6), indicating that TRAF2 is not absolutely required for TNF-induced ASK1 activation. Earlier, it has been proposed that ROS have an important function in TNF-induced persistent JNK activation under NF-κB-deficient cells including TRAF2/5 DKO MEFs.7 As TRAF6 is also required for ROS-mediated activation and ASK1 and JNK signaling pathway,35 one possibility is that, in case of TRAF2/5 deficiency, TRAF6 might be involved in TNF-mediated ROS formation and JNK activation.
It is well known that the duration of JNK activation is a critical factor in determining the susceptibility of cells to TNF-induced apoptosis: persistent JNK activation contributes to TNF-induced cell death.36 Acute JNK induction by TNFR1 likely involves MAP3K of the MAPK/ERK kinase (MEK) and mixed-lineage kinase (MLK) groups.37 Conversely, the persistent JNK activation downstream of TNFR1 occurs through activation of the ASK1.30 In this respect, the fact that A20 binds to ASK1, but not to GCK or MEKK3, and inhibits TNF- or H2O2-induced JNK activation is particularly interesting. Furthermore, the results of domain mapping experiments show that A20 binds to the non-catalytic amino-terminal region of ASK1, which has been shown to be responsible for the interaction with E3 ligase-CIAP1, -TRAF2, or thioredoxin,38,39 suggesting that the association of ASK1 through this amino-terminal region with A20 has an essential function in down-regulation of JNK signaling through regulating ASK1 stability and degradation. Earlier, it has been shown that the protein stability of ASK1 mediated through interaction with E3 ligases is an important mechanism for the regulation of ASK1–JNK signaling cascade in response to ROS or TNF.29,38,39 Therefore, it is conceivable that the complex formation with ASK1 and A20 is a critical step for suppression of the ASK1–JNK signaling cascade and subsequent apoptotic cell death. However, as there are multiple signaling molecules including A20 and other ASK1-binding proteins recruited into the ASK1 signalosome,35 further elucidation of dynamic interactions of these signaling molecules within the ASK1 complex is required to provide a better understanding of physiological functions of such a complex. One important hint from this study is that the expression levels of A20 were increased significantly in breast cancer tissues (Figure 8), suggesting that A20 may have an important function in promoting the carcinogenic processes through its pro-survival function. However, intriguingly, some recent genetic analysis showed that A20 was frequently inactivated by somatic mutation or deletion in certain types of tumors including B-lineage lymphomas.40,41 Therefore, further studies are required to define the functional characteristics of A20 in tissue-specific malignancies such as breast cancer.
Materials and Methods
Antibodies
All commercial antibodies were purchased from the following: anti-JNK, anti-RIP1, and anti-PARP (BD Biosciences, San Jose, CA, USA); anti-phospho-JNK1/2 (Invitrogen, Carlsbad, CA, USA); anti-actin and anti-flag (Sigma-Aldrich, St. Louis, MO, USA); anti-IKKβ (Upstate Biotechnology, Waltham, MA, USA); anti-caspase-3 (Cell Signaling Technology, Beverly, MA, USA); anti-TNFR1 (R&D Systems, Minneapolis, MN, USA); anti-A20, anti-p65, anti-ubiquitin, anti-IKKα, anti-TRAF2, anti-Xpress, anti-HA, anti-ASK1, anti-IκBα, and anti-GFP (Santa Cruz Biothenology, Santa Cruz, CA, USA). Anti-phospho-ASK1 antibody was a kind gift from Dr. H Ichijo (The University of Tokyo, CREST, Japan).
Plasmids and adenovirus production
Xpress-tagged full-length A20 were prepared by amplifying the human normal colon tissue and MEFs of cDNA library in-frame with corresponding primers into pcDNA 3.1C (Invitrogen). Flag-tagged constructs (flag-GCK, flag-MEKK3, flag-ASK1, flag-MKK4, flag-MKK7, flag-JNK1, and flag-JNK2) were generated using pENT/CMV vector (Stratagene, La Jolla, CA, USA). HA-Ub was provided by E Junn (University of New Jersey-Robert Wood Johnson Medical School, NJ, USA). Deletion mutants (A20-N, A20-C, ASK1-N, ASK1-K, and ASK1-C) were generated by standard PCR methods and point mutants at cystein 103 (OTU-MT-A20, C103A), 521/524 (ZnF3-MT-A20, C521A, C524A), and 624/627 (ZnF4-MT-A20, C624A, C627A) were created using a Quickchange kit as directed by the manufacturer (Stratagene). Adeonoviruses encoding the full-length A20 and GFP were created using Virapower adenovirus expression system according to the manufacturer’s instruction (Invitrogen). Site-specific recombination between entry vector (A20-pENT/CMV-flag) and adenoviral destination vector (pAd/PL-DEST) were established with LR clonase II (Invitrogen).
Cell culture, adenovirus infection, and transfection
HeLa cells, HEK293 cells, and MEFs (WT, p65−/−, IKKβ−/−, TRAF2/5 DKO, and ASK1−/−) were maintained in DMEM supplemented with 10% fetal bovine serum, 2mmol/l of glutamine, 100 units/ml of penicillin, and 100 μg/ml of streptomycin (Life Technology, Carlsbad, CA, USA). HEK293 cells were transfected with Lipofectamine PLUS reagent by following the instruction provided by the manufacturer (GIBCO/BRL). Alternatively, HeLa and MEFs were infected with recombinant virus with the titers of 200 PFU per cells obtained A20-pAd/PL-DEST-transfected 293A Phoenix packaging cells.
Tissue samples and preparation of homogenates
Tissue samples were obtained from sequential patients during surgical operations for malignant breast cancers at Chungnam National University Hospital, Daejeon, Korea. The study was approved by the hospital institutional review board (approval number 07–21) according to the Declaration of Helsinki, and written informed consent was obtained from each patient by research team before surgery. After washing with cold saline, normal and cancerous tissues were homogenized in 100mM Tris–HCl (pH 8.0) and 1% Triton X-100. Tissue homogenates were centrifuged at 1500 × g for 15 min to remove debris. After clarification, the homogenates were centrifuged at 100 000 × g for 1 h at 4°C. Protein concentration of homogenates was determined for each sample using the Bradford method (Bio-Rad, Hercules, CA, USA).
Immnunoblot analysis and immunoprecipitation
After treating with different conditions as described in the figure legends, the cells and human breast tissues were lysed in M2 buffer (20mM Tris, pH 7.6, 0.5% NP-40, 250mM NaCl, 3mM EDTA, 3mM EGTA, 2mM dithiothreitol, 0.5mM PMSF, 20mM β-glycerol phosphate, 1mM sodium vanadate, and 1 μg/ml leupeptin). For immunoblots, 50 μg of the lysates was fractionated by SDS–polyacrylamide gel and visualized by enhanced chemiluminescence (Amersham). For immunoprecipitation assays, the cells were collected in M2 buffer after treatments as described in the figure legends. The resulting lysates were precipitated with the relevant antibody and protein G-sepharose beads by incubation at 4 °C overnight or for 4 h. Immunoprecipitates were washed three times with M2 buffer, and the bound proteins were resolved in 10% SDS–polyacrylamide gels for immunoblot analysis. Immune complex kinase assay for ASK1 was performed as described in detail earlier.29
RT–PCR analysis
After total RNA was extracted from HeLa cells using a TRIZOL reagent (Life Technologies), the oligo(dT)-primed cDNA was synthesized using a RT–PCR kit (Stratagene). PCR amplication was carried out using the primer pairs specific to each human genes (A20, 5′-GCACACTGTGTTTCATCG-3′ and 5′-GGCATACATTGCTTGAAC-3′; Gadd45, 5′-ATGACGCTGGAAGAGCT-3′ and 5′-GGGCCTCAGCGTTCCT-3′; XIAP, 5′-AGAGCTGGATTTTATGCT-3′ and 5′-TTCAGCACATTGTTTACA-3′; IκBα, 5′-AAGACGAGGAGTACGAGC-3′ and 5′-TGACATCAGCACCCAAGG-3′; FHC1, 5′-CTGCTTCAACAGTGCTTG-3′ and 5′-GTTTGTGCAGTTCCAGTA-3′; Mn-SOD, 5′-AACGCGCAGATCATGCA-3′ and 5′-CTCCCAGTTGATTACATTC-3′; GAPDH, 5′-GACCCCTTCATTGACCTC-3′ and 5′-GCCATCCACAGTCTTCTG-3′).
Determination of cell death
After treatment, as described in the figure legends, cells were trypsinized and collected. Each sample was stained with trypan blue (Bio-Whittaker, Walkersville, MO, USA ) and counted with a hemacytometer. The stained cells (blue) were counted as dead cells and were expressed as a percentage of total cells. Data are expressed as the mean ± S.E. from at least three independent experiments.
Lentiviral packaging and transduction of A20 shRNA
The lentiviral vector pLKO.1 and an shRNA lentiviral plasmid stock for targeting human A20 to pLKO.1 were purchased from Sigma-Aldrich (catalog no. for shRNA: SHCLNG-NM 006290). The sequence of the clone targeting human A20 was GTACCGGGATGAAGGAGAAGCTCTTAAACTCGAGTTTAAGAGCTTCTCCTTCATCTTTTTTG. Lentivirus was produced by cotransfection of HEK 293 T cells with the lentiviral vector, together with three packaging plasmids (pMDL-RRE, pRSV-REV, pVSV-g) using the lipofectamin, as described earlier.42 The lentiviral particles infections into Hela cell lines, followed by selection with puromycin (3 μg/ml), were performed according to the manufacturer’s instructions (Sigma-Aldrich).
Confocal imaging analysis
HeLa cells were grown on glass coverslips and then transfected with pEGFP-C1-A20. After 24 h, the cells were treated as indicated in the figure legend and fixed in 4% paraformaldehyde at room temperature for 10 min. Cells were washed in cold PBS and permeablized with 0.2% Triton X-100, and incubated with mouse anti-p65 antibody (Santa Cruz Biothenology). The PE-conjugated secondary antibody (BD Pharmingen, San Diego, CA, USA) was used and mounted with Fluromount-G (Vector Laboratories, Burlingame, CA, USA) and visualized using an OLYMPUS confocal microscope.
Immunohistochemistry
Expression of A20 was analyzed by immunohistochemistry (IHC) on paraffin-embedded or frozen tissue sections from 33 malignant breast cancer tissues; 3 μm thick sections from the paraffin blocks were used for IHC with mouse EnVision-HRP detection system (Dako, Carpinteria, CA, USA). After deparaffinization and antigen retrieval by a pressure cooker in 10mM sodium citrate buffer (pH 6.0) at full power for 4 min, tissue sections were treated with 3% H2O2 for 10 min. The anti-A20 antibody was diluted (1:50) with background reducing diluent (Dako) and incubated overnight at 4°C in humid chamber. The slides were then incubated with the EnVision reagent for 30 min, and then sequentially incubated with DAB chromogen for 5 min, counterstained with Meyer’s hematoxylin and mounted. Careful rinses with several changes of TBS-0.3% tween buffer were performed at each step. Negative control used was mouse IgG1 isotype control to exclude the primary antibody. Cytoplasmic granular staining was considered as positive cells.
Supplementary Material
Acknowledgements
We thank Dr. H Ichijo for ASK1−/− MEFs. This work was supported by Grant FG06-2-17 of the 21C Frontier Functional Human Genome Project from the Ministry of Science & Technology in Korea, by the grant 20090079064 from NRF of Korea grant funded by the MEST, by the Infection Signaling Network Research Center (R13-2007-020-01002-0) at Chungnam National University, and a grant from the National R&D Program for Cancer Control Ministry of Health & Welfare, Repubic of Korea (No. 0720560).
Abbreviations
- TNF
tumor necrosis factor
- TNFR
tumor necrosis factor receptor
- TRAF2
TNFR-associated factor 2
- RIP1
receptor interacting protein 1
- TRADD
TNFR1-associated death domain protein
- MEF
mouse embryonic fibroblast cells
- ASK1
apoptosis signal-regulating kinase1
- ZnF
zinc finger
- GADD45β
growth arrest and DNA damage-inducible 45β
- XIAP
X-linked inhibitor of apoptosis protein
- MnSOD
manganese superoxide dismutase
- FHC
ferritin heavy chain
- MAP3K
mitogen-activated protein kinase kinase kinase
- MAP2K
mitogen-activated protein kinase kinase
- MAPK
mitogen-activated protein kinase
- MLK
mixed-lineage kinase
- NF-κB
nuclear factor-κB
- JNK
c-jun N-terminal kinase
- IKKβ
inhibitory κB kinase
- PARP
poly(ADP-ribose)polymerase
- CHX
cycloheximide
- WT
wild type
Footnotes
Conflict of interest
The authors declare no conflict of interest.
References
- 1.Hayden MS, Ghosh S. Shared principles in NF-kappaB signaling. Cell 2008; 132: 344–362. [DOI] [PubMed] [Google Scholar]
- 2.Vallabhapurapu S, Karin M. Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol 2009; 27: 693–733. [DOI] [PubMed] [Google Scholar]
- 3.Tang G, Minemoto Y, Dibling B, Purcell NH, Li Z, Karin M et al. Inhibition of JNK activation through NF-kappaB target genes. Nature 2001; 414: 313–317. [DOI] [PubMed] [Google Scholar]
- 4.Karin M, Gallagher E. TNFR signaling: ubiquitin-conjugated TRAFfic signals control stop-and-go for MAPK signaling complexes. Immunol Rev 2009; 228: 225–240. [DOI] [PubMed] [Google Scholar]
- 5.Deng Y, Ren X, Yang L, Lin Y, Wu X. A JNK-dependent pathway is required for TNFalpha-induced apoptosis. Cell 2003; 115: 61–70. [DOI] [PubMed] [Google Scholar]
- 6.De Smaele E, Zazzeroni F, Papa S, Nguyen DU, Jin R, Jones J et al. Induction of gadd45beta by NF-kappaB downregulates pro-apoptotic JNK signalling. Nature 2001; 414: 308–313. [DOI] [PubMed] [Google Scholar]
- 7.Sakon S, Xue X, Takekawa M, Sasazuki T, Okazaki T, Kojima Y et al. NF-kappaB inhibits TNF-induced accumulation of ROS that mediate prolonged MAPK activation and necrotic cell death. EMBO J 2003; 22: 3898–3909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Papa S, Zazzeroni F, Bubici C, Jayawardena S, Alvarez K, Matsuda S et al. Gadd45 beta mediates the NF-kappa B suppression of JNK signalling by targeting MKK7/JNKK2. Nat Cell Biol 2004; 6: 146–153. [DOI] [PubMed] [Google Scholar]
- 9.Pham CG, Bubici C, Zazzeroni F, Papa S, Jones J, Alvarez K et al. Ferritin heavy chain upregulation by NF-kappaB inhibits TNFalpha-induced apoptosis by suppressing reactive oxygen species. Cell 2004; 119: 529–542. [DOI] [PubMed] [Google Scholar]
- 10.Harlin H, Reffey SB, Duckett CS, Lindsten T, Thompson CB. Characterization of XIAP-deficient mice. Mol Cell Biol 2001; 21: 3604–3608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Amanullah A, Azam N, Balliet A, Hollander C, Hoffman B, Fornace A et al. Cell signalling: cell survival and a Gadd45-factor deficiency. Nature 2003; 424: 741–742. [DOI] [PubMed] [Google Scholar]
- 12.Lee EG, Boone DL, Chai S, Libby SL, Chien M, Lodolce JP et al. Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-deficient mice. Science 2000; 289: 2350–2354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Coornaert B, Carpentier I, Beyaert R. A20: central gatekeeper in inflammation and immunity. J Biol Chem 2009; 284: 8217–8221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Vereecke L, Beyaert R, van Loo G. The ubiquitin-editing enzyme A20 (TNFAIP3) is a central regulator of immunopathology. Trends Immunol 2009; 30: 383–391. [DOI] [PubMed] [Google Scholar]
- 15.Renner F, Schmitz ML. Autoregulatory feedback loops terminating the NF-kappaB response. Trends Biochem Sci 2009; 34: 128–135. [DOI] [PubMed] [Google Scholar]
- 16.Wertz IE, O0Rourke KM, Zhou H, Eby M, Aravind L, Seshagiri S et al. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature 2004; 430: 694–699. [DOI] [PubMed] [Google Scholar]
- 17.Boone DL, Turer EE, Lee EG, Ahmad RC, Wheeler MT, Tsui C et al. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat Immunol 2004; 5: 1052–1060. [DOI] [PubMed] [Google Scholar]
- 18.Shembade N, Ma A, Harhaj EW. Inhibition of NF-κB signaling by A20 through disruption of ubiquitin enzyme complexes. Science 2010; 327: 1135–1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Opipari AW Jr, Hu HM, Yabkowitz R, Dixit VM. The A20 zinc finger protein protects cells from tumor necrosis factor cytotoxicity. J Biol Chem 1992; 267: 12424–12427. [PubMed] [Google Scholar]
- 20.Heyninck K, Denecker G, De Valck D, Fiers W, Beyaert R. Inhibition of tumor necrosis factor-induced necrotic cell death by the zinc finger protein A20. Anticancer Res 1999; 19: 2863–2868. [PubMed] [Google Scholar]
- 21.Hess S, Gottfried E, Smola H, Grunwald U, Schuchmann M, Engelmann H. CD40 induces resistance to TNF-mediated apoptosis in a fibroblast cell line. Eur J Immunol 1998; 28: 3594–3604. [DOI] [PubMed] [Google Scholar]
- 22.Sarma V, Lin Z, Clark L, Rust BM, Tewari M, Noelle RJ et al. Activation of the B-cell surface receptor CD40 induces A20, a novel zinc finger protein that inhibits apoptosis. J Biol Chem 1995; 270: 12343–12346. [DOI] [PubMed] [Google Scholar]
- 23.Daniel S, Arvelo MB, Patel VI, Longo CR, Shrikhande G, Shukri T et al. A20 protects endothelial cells from TNF-, Fas-, and NK-mediated cell death by inhibiting caspase 8 activation. Blood 2004; 104: 2376–2384. [DOI] [PubMed] [Google Scholar]
- 24.Li HL, Wang AB, Zhang R, Wei YS, Chen HZ, She ZG et al. A20 inhibits oxidized low-density lipoprotein-induced apoptosis through negative Fas/Fas ligand-dependent activation of caspase-8 and mitochondrial pathways in murine RAW264.7 macrophages. J Cell Physiol 2006; 208: 307–318. [DOI] [PubMed] [Google Scholar]
- 25.Kamata H, Honda S, Maeda S, Chang L, Hirata H, Karin M. Reactive oxygen species promote TNFalpha-induced death and sustained JNK activation by inhibiting MAP kinase phosphatases. Cell 2005; 120: 649–661. [DOI] [PubMed] [Google Scholar]
- 26.Song HY, Rothe M, Goeddel DV. The tumor necrosis factor-inducible zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits NF-kappaB activation. Proc Natl Acad Sci USA 1996; 93: 6721–6725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Eliopoulos AG. Cell signaling. ‘Make and brake’ in signaling. Science 2008; 321: 648–649. [DOI] [PubMed] [Google Scholar]
- 28.Schneider-Brachert W, Tchikov V, Neumeyer J, Jakob M, Winoto-Morbach S, Held-Feindt J et al. Compartmentalization of TNF receptor 1 signaling: internalized TNF receptosomes as death signaling vesicles. Immunity 2004; 21: 415–428. [DOI] [PubMed] [Google Scholar]
- 29.Ichijo H, Nishida E, Irie K, ten Dijke P, Saitoh M, Moriguchi T et al. Induction of apoptosis by ASK1, a mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways. Science 1997; 275: 90–94. [DOI] [PubMed] [Google Scholar]
- 30.Tobiume K, Matsuzawa A, Takahashi T, Nishitoh H, Morita K, Takeda K et al. ASK1 is required for sustained activations of JNK/p38 MAP kinases and apoptosis. EMBO Rep 2001; 2: 222–228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Vendrell JA, Ghayad S, Ben-Larbi S, Dumontet C, Mechti N, Cohen PA. A20/TNFAIP3, a new estrogen-regulated gene that confers tamoxifen resistance in breast cancer cells. Oncogene 2007; 26: 4656–4667. [DOI] [PubMed] [Google Scholar]
- 32.Lerebours F, Vacher S, Andrieu C, Espie M, Marty M, Lidereau R et al. NF-kappa B genes have a major role in inflammatory breast cancer. BMC Cancer 2008; 8: 41–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.He KL, Ting AT. A20 inhibits tumor necrosis factor (TNF) alpha-induced apoptosis by disrupting recruitment of TRADD and RIP to the TNF receptor 1 complex in Jurkat T cells. Mol Cell Biol 2002; 22: 6034–6045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Fujino G, Noguchi T, Matsuzawa A, Yamauchi S, Saitoh M, Takeda K et al. Thioredoxin and TRAF family proteins regulate reactive oxygen species-dependent activation of ASK1 through reciprocal modulation of the N-terminal homophilic interaction of ASK1. Mol Cell Biol 2007; 27: 8152–8163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Noguchi T, Takeda K, Matsuzawa A, Saegusa K, Nakano H, Gohda J et al. Recruitment of tumor necrosis factor receptor-associated factor family proteins to apoptosis signal-regulating kinase 1 signalosome is essential for oxidative stress-induced cell death. J Biol Chem 2005; 280: 37033–37040. [DOI] [PubMed] [Google Scholar]
- 36.Ventura JJ, Hübner A, Zhang C, Flavell RA, Shokat KM, Davis RJ. Chemical genetic analysis of the time course of signal transduction by JNK. Mol Cell 2006; 21: 701–710. [DOI] [PubMed] [Google Scholar]
- 37.Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 2000; 103: 239–252. [DOI] [PubMed] [Google Scholar]
- 38.Liu Y, Min W. Thioredoxin promotes ASK1 ubiquitination and degradation to inhibit ASK1-mediated apoptosis in a redox activity-independent manner. Circ Res 2002; 90: 1259–1266. [DOI] [PubMed] [Google Scholar]
- 39.Zhao Y, Conze DB, Hanover JA, Ashwell JD. Tumor necrosis factor receptor 2 signaling induces selective c-IAP1-dependent ASK1 ubiquitination and terminates mitogen-activated protein kinase signaling. J Biol Chem 2007; 282: 7777–7782. [DOI] [PubMed] [Google Scholar]
- 40.Schmitz R, Hansmann ML, Bohle V, Martin-Subero JI, Hartmann S, Mechtersheimer G et al. TNFAIP3 (A20) is a tumor suppressor gene in Hodgkin lymphoma and primary mediastinal B cell lymphoma. J Exp Med 2009; 206: 981–989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Kato M, Sanada M, Kato I, Sato Y, Takita J, Takeuchi K et al. Frequent inactivation of A20 in B-cell lymphomas. Nature 2009; 459: 712–716. [DOI] [PubMed] [Google Scholar]
- 42.Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D et al. A thirdgeneration lentivirus vector with a conditional packaging system. J Virol 1998; 72: 8463–8471. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.