Rapid and efficient synthetic assembly of multiplex luciferase reporter plasmids for the simultaneous monitoring of up to six cellular signaling pathways

Abstract

High-throughput cell-based screening assays are valuable tools in the discovery of chemical probes and therapeutic agents. Such assays are designed to examine the effects of small compounds on targets, pathways, or phenotypes participating in normal and disease processes. While most cell-based assays measure single quantities, multiplexed assays seek to address these limitations by obtaining multiple simultaneous measurements. The signals from such measurements should be independently detectable and measure large dynamic ranges. Luciferases are good candidates for generation of such signals. They are genetically encoded, versatile, and cost-effective, whose output signals can be sensitively detected. We recently developed a multiplex luciferase assay that allows monitoring the activity of five experimental pathways against one control simultaneously. We used synthetic assembly cloning (Vazquez-Vilar, et al., 2020) to assemble all six luciferase reporter units into a single vector, over eight stitching rounds. Because all six reporters are on a single piece of DNA, a single vector ensures stoichiometric ratios of each transcriptional unit in each transfected cell, resulting in lower experimental variation. Our proof-of-concept multiplex hextuple luciferase assay was designed to simultaneously monitor the p53, TGF-β, NF-κβ, c-Myc, and MAPK/JNK signaling pathways. The same synthetic assembly cloning pipeline allows the stitching of numerous other cellular pathway luciferase reporters. Here we present an improved three-step synthetic assembly protocol to quickly and efficiently generate multiplex hextuple luciferase reporter plasmids for other signaling pathways of interest. This improved assembly protocol provides opportunities to analyze any five desired pathways at once much quicker. Protocols are provided on how to prepare DNA components and destination vector plasmids, design synthetic DNA, and perform assembly cloning of new transcriptional reporter elements, implement multipartite synthetic assembly cloning of single pathway luciferase reporters, and carry out one step assembly of final multiplex hextuple luciferase vectors. We present protocols on how to perform multiplex hextuple luciferase in the accompanying Current Protocols in Molecular Biology article (see Sarrion-Perdigones, et al., in press).

Introduction

Recently, we developed a multiplex hextuple luciferase assay that allows for the simultaneous recording of the activity of six luciferases within the same sample (Sarrion-Perdigones et al., 2019). Using this method, we were able to monitor the effects of genetic, ligand and small molecule chemical compound treatments of five cellular pathways of interest. Multiplex monitoring allows us to measure the effects on a pathway of interest, as well as collateral “off-target” modulations on other signaling pathways.

In our prior work, we implemented a previously described synthetic assembly cloning pipeline to build a proof-of-concept multiplex hextuple luciferase reporter vector using an eight-step synthetic assembly protocol. The vector carried five different transcriptional response elements purposed to report on p53 (Osada et al., 2005), TGF-β (Zawel et al., 1998), NF-κβ (Oeckinghaus and Ghosh, 2009), c-Myc (Walhout et al., 1997; Allevato et al., 2017), and MAPK/JNK (Carter et al., 2001) pathway signaling events. It also carried a control constitutive hCMV-IE1 promoter (Yew et al., 1997) serving as a normalization standard. Using the same synthetic assembly cloning pipeline would allow us and others to construct, other multiplex reporters tailored to any five cellular signaling pathways. Here, however, we improved that method by developing a convenient three-step synthetic assembly protocol to quickly and efficiently construct multiplex hextuple luciferase reporter plasmids for other signaling pathways of interest. We present this simplified method in this unit.

In the previous work, we utilized the GoldenBraid2.0 (GB2.0) cloning system (Sarrion-Perdigones et al., 2013, 2014) to carry out the serial assembly of the multiplex hextuple luciferase reporter vector over eight rounds of serial assembly cloning (Sarrion-Perdigones et al., 2019). GB2.0 is a second version of the initial GoldenBraid system (Sarrion-Perdigones et al., 2011), which itself was founded on the multipartite Golden Gate cloning pipeline (Engler et al., 2008). Golden Gate (Marillonnet & Grützner, 2020), GoldenBraid (Vazquez-Vilar, et al., 2020) and their successors use type IIs restriction enzymes for DNA assembly (Sarrion-Perdigones et al., 2011; Engler et al., 2008; Sarrion-Perdigones et al., 2013; Vazquez-Vilar et al., 2017; Weber et al., 2011; Werner et al., 2012). Type IIs restriction enzymes cut a defined number of nucleotides away from their binding site (Szybalski et al., 1991), and when they are sticky, allow for the exposed overhangs to be user-defined annealing substrates (Engler et al., 2008; Sarrion-Perdigones et al., 2011). Those defined sticky overhangs, when designed orthogonally (i.e., mutually exclusively so one sticky overhang only anneals with its counterpart, and not to any of the other sticky overhangs), allow guided assembly of multiple parts in a specified order into destination vectors (Engler et al., 2008; Sarrion-Perdigones et al., 2011). In a first step, DNA parts need to be accommodated towards the GB2.0 assembly cloning pipeline, by removing any of the downstream used Type IIs restriction enzymes. This accommodation, commonly referred to as domestication, is performed by mutagenesis of existing DNA parts or synthesis of novel DNA parts, and moving those domesticated parts in so-called domesticator plasmids. In subsequent steps, GB2.0 cloning uses two kinds of of destination plasmids, called alpha and omega vectors (Sarrion-Perdigones et al., 2011), into which several domesticated parts can be stitched together. Parts and assemblies generated in alpha vectors can be assembled further in omega vectors, and those can be assembled further back into alpha vectors and so on. This serial transfer between alpha and omega vectors can be reiterated indefinitely to build increasingly complex multigene constructs. The only limitations towards indefinite reiterations are the “cargo capacity”, the size of the DNA inserts that the type of plasmid can stably replicate, and the “plasmid copy number” of the plasmid type, the total number of plasmid DNA molecules the host bacterial strain will try to maintain. DNA inserts that are too large are only maintained stably in a high copy number plasmid up to about 20 to 25 kb (Venken et al., 2006). Those limitations could be addressed by swapping vector backbones and/or microorganism in the near future.

In this work, we describe an improved three-step synthetic assembly protocol to generate multiplex luciferase reporter vectors. In the first step, new transcriptional reporter elements are designed and assembled, in the second step, single pathway luciferase reporters are generated, and these reporters are assembled into a final multiplex luciferase reporter vector in the third step. To do so, we generated five alpha level vectors for the second step that accomodate five modular positions present in the omega level destination vector used in the third step (Weber et al., 2011; Sarrion-Perdigones et al., 2011). This approach allows a five-way ligation of five transcriptional reporter units into an omega level vector to yield a multiplex luciferase reporter vector that can report on up to six cellular pathways (see Figure 1).

Figure 1. Schematic overview of the synthetic assembly pipeline to generate complex multiplex luciferase reporter vectors in just three steps.

(A) DNA parts and destination vectors (Table 1) are ordered from the nonprofit plasmid repository Addgene as bacterial stabs, streaked on bacterial plates, grown up in culture, and prepared according to Basic Protocol 1. (B) DNA parts include pathway response elements consisting of a transcription blocker coupled to transcriptional response elements that can bind transcription factors specific for cellular pathways (e.g., NF-κβ, TGF-β, MAPK/JNK, c-Myc, or p53), five orthogonal luciferases (RedF, FLuc, NLuc, Renilla, and GrRenilla), and the transcriptional terminator/polyadenylation signal from the bovine growth hormone gene (bGHpA). Note that improved TGF-β and c-Myc pathway luciferase reporters were generated that have seven canocical transcription factor binding motifs, instead of four and five as proiviously described (Sarrion-Perdigones et al., 2019). Destination vectors include five positional blue/white destination vectors for position A, B, C, D, and E, located in the final destination vector that provides a blue/white colorimetric screening marker (lacZ), and one pink/white final destination vector that provides a pink/white colorimetric screening marker (tinsel purple). (C) In the first step, novel pathway response elements are built, as described in Basic Protocol 2 or Alternate Protocol 1. (D) In the second step, novel custom luciferase reporter vectors are built in an alpha assembly, using the five positional blue/white destination vectors, pathway response element, luciferase, and transcriptional terminator, following Basic Protocol 3. (E) In the final step, a new multiplex hextuple luciferase reporter vector, consisting of four previously described pathway reporters (coupled to the luciferases RedF, FLuc, NLuc, and GrRenilla, respectively), one novel custom luciferase reporter (coupled to the luciferase Renilla in this case) and one control reporter (coupled to the luciferase ELuc), is generated as described in Basic Protocol 4. The same synthetic assembly pipeline can be tailored to incorporate any five previously described pathway reporters, any five novel custom luciferase reporters, or any combinations thereof, illustrating the versatility of the pipeline. (F-G) Comparison between the assembly cloning pipeline previously published stitching together 5xMyc:Renilla, 2xp53:Nluc, 4xTGFβ:FLuc, 6xMAPK:GrRenilla, CMV:ELuc, and 5xNFκβ:RedF luciferase reporters over five consecutive cloning reactions (Sarrion-Perdigones et al., 2019) (F), and the one presented here, stitching together 5xNFκβ:RedF, 7xTGFβ:FLuc, 3xDBE:Renilla, 2xp53:Nluc, 6xMAPK:GrRenilla, and CMV:ELuc luciferase reporters using a single cloning reaction (G), illustrating a substantial decrease in time and money investment.

This improved design, which is based on the ability of type IIs restriction enzymes to create unique ends that assemble multiple DNA fragments in a defined linear order, facilitates the ability of researchers to generate custom multiplex luciferase reporter vector from individual single luciferase reporter vectors in a single step. We have deposited all new vectors and DNA parts in the nonprofit plasmid repository Addgene for unrestricted access to the academic research community.

Strategic Planning

Our proof-of-concept multiplex hextuple luciferase reporter vector included luciferase reporters for the c-Myc, NF-κβ, TGF-β, p53, and MAPK/JNK signaling pathways (Sarrion-Perdigones et al., 2019). Other research may require luciferase reporters that are driven by DNA elements responsive to different signaling pathways. While such multiplex luciferase reporters can be generated using the same assembly cloning pipeline described in our previous work, we decided to simplify this pipeline by reducing the number of cloning steps to just three. Before starting, the investigator identifies specific transcriptional response elements activated by pathways of interest. Previously published works that catalog collections of DNA motifs recognized by transcription factors from humans or other organisms (Mathelier et al., 2016; Weirauch et al., 2014; Jolma et al., 2013; Khan et al., 2018) provide an excellent resource for identifying such transcription response elements. In the first cloning step,, a transcriptional DNA response element of interest activated by a particular pathway is combined with, 1) an upstream transcription blocker (Eggermont and Proudfoot, 1993), now called an “insulator”, to protect the response element (and eventually the entire transcriptional reporter unit) within the multiplex reporter from unwanted transcriptional enhancement by nearby enhancers present in the final construct, and 2) a minimal promoter that contains the TATA box required for transcriptional initiation (Wassman et al., 2013). In a second cloning step, this transcriptional response unit is combined with one of the five pathway-responsive luciferases and a transcriptional terminator. In the third, and final construction step, all five pathway-responsive luciferases are combined together with the control luciferase. If the investigator plans to probe fewer than five pathways, they should fill positions otherwise occupied by pathway-responsive luciferases with luciferase units not driven by pathway-responsive elements or neutral stuffer fragments, DNA parts that don’t encode biological information flanked by the necessary overhangs.

Basic Protocol 1

Preparation of DNA parts and destination vectors for synthetic assembly cloning

In this protocol, we describe the workflow to prepare the 23 vectors from the public repository Addgene that are used in this protocol, and to verify their integrity by restriction enzyme DNA fingerprinting. These vectors include the basic vectors to build new transcriptional pathway reporter elements, build transcriptional luciferase reporter units that contain novel response elements, and the final destination vector that will be used to combine five pathway-specific luciferase reporters with the control reporter. If less than five pathways are to be probed, neutral stuffers can be used to fill positions normally occupied by pathway-responsive luciferases.

Materials: Reagents, solutions, and starting samples or test organisms/cells

Vectors from the public repository Addgene (Table 1).

Table 1.

Summary of vectors described in this work.

Type	Abbreviation	Description	Function	Vector	Resistance	Addgene
Vectors	pUPD3	Universal Part Domesticator plasmid #3	Building new basic parts	ColE1 vector	Chloramphenicol	#118043(Sarrion-Perdigones et al., 2019)
	AlphaA (is Alpha1)	pColE1_Alpha1	Empty vector	ColE1 vector	Kanamycin	#118044(Sarrion-Perdigones et al., 2019)
	AlphaB	pColE1_AlphaB	Empty vector	ColE1 vector	Kanamycin	#124524 (this work)
	AlphaC	pColE1_AlphaC	Empty vector	ColE1 vector	Kanamycin	#124525 (this work)
	AlphaD	pColE1_AlphaD	Empty vector	ColE1 vector	Kanamycin	#124526 (this work)
	AlphaE	pColE1_AlphaE	Empty vector	ColE1 vector	Kanamycin	#124527 (this work)
	Omega Destination-CMV::ELuc:bGHpA	pColE1 with CMV:ELuc and Omega Level Entry Point	Empty vectorwith already integrated control luciferase	ColE1 vector	Spectinomycin	#124528 (this work)
GoldenBraid2.0 Basic Parts	pFLuc	FLuc luciferase	CDS + STOP Codon	pUPD	Ampicillin	#68201 (Sarrion-Perdigones et al., 2013)
	pRedF	RedF luciferase	CDS + STOP Codon	pUPD	Ampicillin	#118057 (Sarrion-Perdigones et al., 2019)
	pNLuc	NLuc luciferase	CDS + STOP Codon	pUPD3	Chloramphenicol	#118058 (Sarrion-Perdigones et al., 2019)
	pRenilla	Renilla luciferase	CDS + STOP Codon	pUPD3	Chloramphenicol	#118059 (Sarrion-Perdigones et al., 2019)
	pGrRenilla	GrRenilla luciferase	CDS + STOP Codon	pUPD3	Chloramphenicol	#118060 (Sarrion-Perdigones et al., 2019)
	pbGHpA	polyA signal	3' UTR + poly(A)	pUPD3	Chloramphenicol	#118061 (Sarrion-Perdigones et al., 2019)
	TB:3xDBE_RE:MiniP	3 copies of the Daf-16 family binding element	Transcriptional reporter element	pUPD	Ampicillin	#124529 (this work)
	TB:5xNF-κβ_RE:MiniP	5 copies of the NF-κβ DNA binding motif	Transcriptional reporter element	pUPD3	Chloramphenicol	#133878 (this work)
	TB:7xSMAD_RE:MiniP	7 copies the SMAD DNA binding motif	Transcriptional reporter element	pUPD3	Chloramphenicol	#133879 (this work)
	TB:7xE-Box:MiniP	7 copies of the E-box motif	Transcriptional reporter element	pUPD3	Chloramphenicol	#133880 (this work)
	TB:2xP53_RE:MiniP	2 copies of the p53 DNA binding motif	Transcriptional reporter element	pUPD3	Chloramphenicol	#133881 (this work)
	TB:6xAP-1_RE:MiniP	6 copies of the AP-1 binding motif	Transcriptional reporter element	pUPD3	Chloramphenicol	#133884 (this work)
Built Reporters	5xNF-κβ_RE::RedF	NF-κβRedF reporter	Luciferase reporter	pColE1_AlphaA/1	Kanamycin	#124530 (this work)
	7xSMAD_RE::FLuc	TGF-βFLuc reporter	Luciferase reporter	pColE1_AlphaB	Kanamycin	#124531 (this work)
	7xE-Box::Renilla	c-MycRenilla reporter	Luciferase reporter	pColE1_AlphaC	Kanamycin	#124532 (this work)
	2xP53_RE::NLuc	P53 NLuc reporter	Luciferase reporter	pColE1_AlphaD	Kanamycin	#124533 (this work)
	6xAP-1_RE::GrRenilla	MAPK/JNK GrRenilla reporter	Luciferase reporter	pColE1_AlphaE	Kanamycin	#124534 (this work)
	3xDBE_RE::Renilla	FOXO Renilla reporter	Luciferase reporter	pColE1_AlphaC	Kanamycin	#124535 (this work)
	MLRV2:NF-κβ-TGF-β-FOXO-P53-AP1	Multiplex luciferase reporter vector	Multiplex luciferasereporter vector	Omega Destination-CMV::ELuc:bGHpA	Spectinomycin	#124536 (this work)

Bacterial plates (VWR, cat. no. 25384–092) containing LB agar and 2% X-Gal supplemented with 30 μg mL⁻¹ kanamycin, 12.5 μg mL⁻¹ chloramphenicol, 100 μg mL⁻¹ spectinomycin, or 100 μg mL⁻¹ ampicillin. Plates with ampicillin also contain IPTG.

Liquid LB medium containing 30 μg mL⁻¹ kanamycin, 12.5 μg mL⁻¹ chloramphenicol, 100 μg mL⁻¹ ampicillin or 100 μg mL⁻¹ spectinomycin.

Restriction enzymes: BglII (New England Biolabs, cat. no. R0144S), BsaI (New England Biolabs, cat. no. R0535S), BsmBI (New England Biolabs, cat. no. R0580S), EcoRI-HF (New England Biolabs, cat. no. R3101S), EcoRV-HF (New England Biolabs, cat. no. R3195S), KpnI-HF (New England Biolabs, cat. no. R3142S), SphI-HF (New England Biolabs, cat. no. R3182S), XhoI (New England Biolabs, cat. no. R0146S)

Restriction enzyme buffers (New England Biolabs): NEB3.1 (New England Biolabs, cat. no. B7203S) and CutSmart Buffers (New England Biolabs, cat. no. B7204S).

Reagents for agarose gel electrophoresis as described in Current Protocols in Molecular Biology (Voytas, 2001).

Materials: Hardware and instruments (e.g., glassware, disposables, microscopes, centrifuge)

14 mL sterile bacterial culture tubes (VWR, cat. no. 60818–689)

Table-top centrifuge that can accommodate 14 mL tubes (Fisher Scientific, cat. no. 75230115)

1.7 mL microcentrifuge tubes (VWR, cat. no. 87003–294)

Table-top microcentrifuge that can accomdate 1.7 mL tubes (Fisher Scientific, cat. no. 75002435)

37°C incubator-shaker (Amerex, cat. no. 747/747R)

QIAprep Spin Miniprep Kit (QIAGEN, cat. no. 27106)

DeNovix DS-11+ spectrophotometer (DeNovix, cat. no. DS-11)

55°C incubator (VWR, cat. no. 89409–216)

Equipment for agarose gel electrophoresis are described in Current Protocols in Molecular Biology (Voytas, 2001).

Prepare the vectors obtained as bacterial agar stabs from Addgene

• 1Order plasmids from the public repository Addgene (Table 1). Some of the plasmids were published previously in the original paper describing multixplex hextuple luciferase assaying (Sarrion-Perdigones et al., 2019) or the GoldenBraid 2.0 paper (Sarrion-Perdigones et al., 2013), while the remaining plasmids were submitted along this publication, to streamline synthetic assembly.

  Note: All plasmids used in these protocols have been deposited in Addgene for unrestricted accessibility by academic researchers. They are maintained in appropriate E. coli cells and functional luciferase transcriptional units have been tested in a variety of human cell lines. Upon arrival, streak the strains out on bacterial plate within a few days.

• 2Use a sterile pipet tip or inoculating loop to scrape bacteria from the bacterial stab received from Addgene, and streak onto an LB agar plate with the appropriate antibiotic and 2% X-Gal, as indicated in Table 1. Incubate plate at 37°C overnight.

  Note: The pUPD3, AlphaA, AlphaB, AlphaC, AlphaD, and AlphaE vectors carry a constitutively expressed LacZ fragment, and will result in blue colonies on plates containing X-Gal. The Omega Destination-CMV::ELuc:bGHpA vector incorporates a constitutively expressed purple chromogenic protein, and will result in pink colonies.

• 3Pick a single colony from each plate to inoculate 5 mL of LB liquid medium containing the appropriate antibiotic in a 14 mL bacterial culture tube. Grow overnight at 37°C for a maximum of 16h.
• 4Isolate plasmids using the QIAprep Spin Miniprep Kit, following the standard protocol.
• 5Quantify the DNA concentration of each miniprep using the DeNovix DS-11+ spectrophotometer.

Plasmid digestion for verification

• 6Prepare the following restriction enzyme digestions mixes, adding water to a final volume of 25 μL as shown in Table 2 below.
• 7Incubate all digestions at 37°C for 1h, except the BsmBI digestions, that need to be incubated at 55°C.
• 8Run a 1% agarose gel electrophoresis experiment with all digested vectors, according to (Voytas, 2001). Run 600 ng of uncut vector.
• 9Image the gel using a gel documentation system and compare it with the image in Figure 2.
• 10Store plasmids at −20°C.

Table 2:

Restriction Enzyme mixes and expected fragment sizes

#	600 ng vector	Buffer	Restriction Enzyme(s)	Expected band sizes
1	pUPD3	2.5 μL NEB 3.1	0.5 μLBsmBI	2335, 469
2	AlphaA	2.5 μL NEB 3.1	0.5 μL BsmBI	2326, 485
3	AlphaC	2.5 μL NEB 3.1	0.5 μL BsmBI	2326, 489
4	AlphaB	2.5 μL NEB 3.1	0.5 μL BsmBI	2517, 489
5	AlphaD	2.5 μL NEB 3.1	0.5 μL BsmBI	2328, 489
6	AlphaE	2.5 μL NEB 3.1	0.5 μLBsmBI	2326, 485
7	Omega-CMV:ELuc	2.5 μL NEB 3.1	0.5 μLBsmBI	5000, 1015
8	pFLuc	2.5 μL CutSmart	0.5 μLBsaI	1657, 1622, 1433
9	pRedF	2.5 μL CutSmart	0.5 μLBsaI	3057, 1648
10	pNLuc	2.5 μL CutSmart	0.5 μLBsaI	2343, 517
11	pRenilla	2.5 μL CutSmart	0.5 μLBsaI	2343, 937
12	pGrRenilla	2.5 μL CutSmart	0.5 μLBsaI	2343, 937
13	pbGH	2.5 μL CutSmart	0.5 μLBsaI	2343, 229
14	TB:5xNF- κβ_RE:MiniP	2.5 μL CutSmart	0.5 μLBsaI	3057, 334
15	TB:7xSMAD_RE:MiniP	2.5 μL CutSmart	0.5 μLBsaI	3057, 382
16	TB:7xE-Box:MiniP	2.5 μL CutSmart	0.5 μLBsaI	3057, 337
17	TB:2xP53_RE:MiniP	2.5 μL CutSmart	0.5 μLBsaI	3057, 334
18	TB:6xAP-1_RE:MiniP	2.5 μL CutSmart	0.5 μLBsaI	3057, 344
19	5xNF-κβ_RE::RedF	2.5 μL NEB 3.1	0.5 μLBsmBI	2326, 2215
20	7xSMAD_RE::FLuc	2.5 μLNEB 3.1	0.5 μLBsmBI	2517, 2276
21	7xE-Box::Renilla	2.5 μL NEB 3.1	0.5 μLBsmBI	2326, 1511
22	2xP53_RE::NLuc	2.5 μL NEB 3.1	0.5 μLBsmBI	2328, 1088
23	6xAP-1_RE::GrRenilla	2.5 μLNEB 3.1	0.5 μLBsmBI	2326, 1514

Figure 2. Quality control of all plasmids encoding DNA parts and destination vectors grown from the stocks received from the nonprofit plasmid repository Addgene (Basic protocol 1).

Purified plasmid DNA is analyzed by agarose gel electrophoresis two-ways: plasmid fingerprinting after restriction enzyme cutting (to confirm appropriate DNA banding patterns) and uncut (to confirm the absence of unwanted multimerizations). (A) Quality control of domesticator plasmid pUPD3 (#1), destination plasmids AlphaA (#2), AlphaC (#3), AlphaB (#4), AlphaD (#5), and AlphaE (#6), and final destination plasmid Omega-CMV:Eluc (#7). (B) Quality control of luciferase plasmids pFLuc (#8), pRedF (#9), pNLuc (#10) pRenilla (#11), and pGrRenilla (#12), and the transcriptional terminator plasmid pbGH (#13). (C) Quality control of pathway response element plasmids TB:5xNF-κβ_RE:MiniP (#14), TB:7xSMAD_RE:MiniP (#15), TB:7xE-Box:MiniP (#16), TB:2xP53_RE:MiniP (#17), and TB:6xAP-1_RE:MiniP (#18). (D) Quality control of transcriptional response luciferase reporter plasmids 5xNF-κβ_RE::RedF (#19), 7xSMAD_RE::FLuc (#20), 7xE-Box::Renilla (#21), 2xP53_RE::NLuc (#22), and 6xAP-1_RE::GrRenilla (#23).

Basic Protocol 2

DNA synthesis and assembly cloning of a typical transcriptional reporter element

In this section, we detail the protocol to build a new transcriptional reporter element from a synthetized DNA fragment. In this example, we adapt our previous p53 response element (Sarrion-Perdigones et al., 2019), which consists of two repeats of the p53 consensus motif (RRRCWWGYYY) (Osada et al., 2005) to the cloning pipeline presented here. We included the transcription blocker/insulator and the minimal promoter in the same DNA part for easier assembly of the full luciferase reporter unit and also incorporated a restriction enzyme watermark to facilitate distinguishing assembled from patental plasmids by DNA fingerprinting. This example construct has been deposited in Addgene (#133881) (Table 1).

Materials: Reagents, solutions, and starting samples or test organisms/cells

pUPD3 vector (prepared as described in Basic Protocol 1), diluted to 75 ng mL⁻¹.

Bacterial plates containing LB agar supplemented with 12.5 μg mL⁻¹ chloramphenicol + 2% X-Gal.

LB liquid medium containing 12.5 μg mL⁻¹ chloramphenicol.

Restriction enzymes: BsaI (New England Biolabs, cat. no. R0535S), BsmBI (New England Biolabs, cat. no. R0580S).

Restriction enzyme cutting buffer: CutSmart Buffer (New England Biolabs, cat. no. B7204S).

T4 DNA ligase and 10x T4 DNA ligase buffer (Promega, cat. no. M1801).

Home-made chemocompetent E.coli cells, using the DH10B-T1R strain (ThermoFisher Scientific, cat. no., 12331013). See Support Protocol

2xLB media, no antibiotic (see recipe).

Note: 2xLB has double the amount of all ingredients except for NaCl.

Reagents for agarose gel electrophoresis as described in Current Protocols of Molecular Biology (Voytas, 2001).

45% glycerol in MiliQ water sterilized using autoclaving.

Materials: Hardware and instruments (e.g., glassware, disposables, microscopes, centrifuge)

14 mL sterile bacterial culture tubes (VWR, cat. no. 60818–689)

Table top centrifuge that can accommodate 14 mL tubes (Fisher Scientific, cat. no. 75230115)

1.7 mL microcentrifuge tubes (VWR, cat. no. 87003–294)

Table top microcentrifuge that can accomdate 1.7 mL tubes (Fisher Scientific, cat. no. 75002435).

0.2 μL PCR tubes (VWR, cat. no. 20170–012)

Thermocycler (Applied Biosystems, cat. no. 4375786)

37°C incubator-shakers (Amerex, cat. no. 747/747R)

QIAprep Spin Miniprep Kit (QIAGEN, cat. no. 27106)

DeNovix DS-11+ spectrophotometer (DeNovix, cat. no. DS-11)

55°C incubator (VWR, cat. no. 89409–216).

Equipment for agarose gel electrophoresis as described in Current Protocols in Molecular Biology (Voytas, 2001).

Design of the synthetic DNA fragment

1. Use your preferred in silico DNA software to design the synthetic DNA fragment (Figure 3A and 3B).

   Note: In our lab we use the SnapGene software (GSL Biotech; available at snapgene.com), that has useful features tailored to Type IIs restriction enzyme cloning. Moreover, vector maps at Addgene are all annotated with Snapgene software. A free version with limited capabilities, SnapGene Viewer, is available as well (https://www.snapgene.com/snapgene-viewer/).

2. The designed fragment must include:

   • a
     A SphI restriction site between the two RRRCWWGYYY motifs (Figure 3C). This cut site will act as a restriction enzyme watermark and help diagnostic DNA fingerprinting after the full multiplex hextuple luciferase vector is assembled (Figure 6A).
     Note 1: A DNA watermark is a unique DNA sequence that unambigusously identifies new DNA sequences from a predeccor.
     Note 2: Diagnostic DNA fingerprinting is the analysis of DNA molecules by restriction enzyme digestion followed by separation of the resulting bands through agarose gel electrophoresis, resulting in unique fingerprints for specific DNA molecules
   • b
     Appropriate single stranded overhangs of sequence determined by the particular pUPD/pUPD3 vector to be used, that will guide fragment ligation in the vector after cleavage with BsmBI. BsmBI cuts will expose CTCG and CGAG overhangs that are complementary to the overhangs in the pUPD/pUPD3 BsmBI cut vector. BsmBI cut sites are indicated in blue (Figure 3D).
   • c
     Appropriate overhangs for a future BsaI cut, determined by defined synthetic assembly cloning (Sarrion-Perdigones et al., 2013). These overhangs are GGAG and AATG, which will act as the seams between the vector and the promoter-like element, and between the promoter-like element and the coding sequence, respectively. Final BsaI cut sites are indicated in red (Figure 3D).

3. Order the synthetic DNA fragment from a DNA synthesis vendor.

   Note: We order linear double-stranded DNA fragments from Integrated DNA Technologies, known as “gBlock” gene fragments (IDT, https://www.idtdna.com) or Eurofins Genomics, known as as “GeneStrand” gene fragments (https://www.eurofinsgenomics.com). In our hands, compared with DNA from other companies, synthetic double-stranded DNA fragments from both companies were of good quality and price and with the least amount of errors observed after subcloning verified by Sanger dye terminator sequencing. Other DNA synthesis services can be used at your discretion. Synthesis and shipping usually takes 2 to 4 business days for both of these companies.

Figure 3. Example domestication pipeline for the p53 pathway response element (Basic protocol 2).

(A) The to-be-synthesized sequence of the p53 pathway response element (TB:2xP53_RE:MiniP): both parts of the transcription blocker are indicated in grey, the p53 DNA binding part is indicated in purple, while the minimal promoter is indicated in black. (B) Overview schematic of the p53 pathway response element (TB:2xP53_RE:MiniP) highlighting the three parts: a transcription blocker (TB) part containing a synthetic polyA terminator and the RNA polymerase II transcriptional pause signal from the human α2 globin gene (pause site), a p53 DNA binding part consisting of two tandem p53 response elements (2xP53_RE), and a minimal promoter (MiniP) part. (C) Close-up of the p53 DNA binding part, highlighting two copies of the p53 response element that are both canonical RRRCWWGYYY p53-binding motifs (GAACATGTCT and GGACTTGCCT), and the recognition site for the type II restriction enzyme SphI to perform diagnostic DNA fingerprinting. (D) Detailed schematic of the to-be-synthetized TB:2xP53_RE:MiniP fragment highlighting the appropriate binding sites for the type IIs restriction enzyme BsmBI followed by an overview of the in silico scarless assembly of the fragment in the domesticator plasmid pUPD3 (Universal Part Domesticator plasmid 3) using BsmBI and T4 DNA ligase, resulting in the final plasmid, pTB:2xp53_RE:MiniP. A second type IIs restriction enzyme, BsaI, is used for diagnostic DNA fingerprinting (see G), and will also be used to release the TB:2xp53_RE:MiniP fragment during the next round of assembly when luciferase reporter transcriptional units will be stitched together (see Basic protocol 3 and Figure 5). Assembled plasmids are identified as white colored colonies that are characterized further (see G), while religated pUPD3 plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (E) Overview of the cloning reaction. Prepare a reaction mix containing 2 μL obtained synthetized fragment, 75 ng of pUPD3 domesticator plasmid, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (F) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (G) Restriction enzyme digestion of 3 white colored colonies using BsaI (3057 and 334 bp), and uncut DNA. All colonies show the correct digestion pattern.

Figure 6. Synthetic assembly of the final multiplex hextuple luciferase vector (Basic protocol 3).

(A) Overview of the in silico scarless assembly of a multiplex luciferase reporter in the destination vector Omega Destination-CMV:ELuc:bGH. Five “transcriptional reporter” plasmids, AlphaA 5xNF-KB:RedF:bGHpA (Addgene #124530) reporting on NF-κβ pathway signaling using red firefly luciferase (RF), AlphaB 7xSMAD:FLuc:bGHpA (Addgene #124531) reporting on TGF-β signaling using firefly luciferase (FL), AlphaC 3xDBE:Renilla:bGHpA (Addgene #124535) reporting on FoxO pathway signaling using renilla luciferase (Re), AlphaD 2xp53:NLuc:bGHpA (Addgene #124533) reporting on p53 pathway signaling using nano luciferase (NL), and AlphaE 6xAP1_RE:GrRenilla:bGHpA (Addgene #124534) reporting on MAPK/JNK pathway signaling using green renilla luciferase (GR), as well as the destination vector Omega Destination-CMV:ELuc:bGH containing the control enhanced beetle luciferase (EL) for normalization purposes are incubated together with BsmBI and T4 DNA ligase. Correct multipartitie stitching of all five BsmBI-released transcriptional luciferase reporter units into BsmBI-opended Omega Destination-CMV:ELuc:bGH, results in the final multiplex luciferase vector MLRV2:NF-kb-SMAD-DBE-P53-AP1 (Addgene #124536), consisting of five transcriptional luciferase reporter units stitched together in a specified order, and one control luciferase reporter unit (constitutively expressed ELuc luciferase). Assembled plasmids are identified as white colored colonies that are characterized further (see C), while religated Omega Destination-CMV:ELuc:bGH plasmids are pink to purple colored due to the presence of the colorimetric marker, tinsel purple. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of the final pink/white destination vector (Omega Destination-CMV:ELuc:bGH), 75 ng of each of the luciferase entry vectors, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C and 16°C. (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 3 white colored colonies using ScaI (6510, 2219, 1790, 1543, 1088 and 486 bps) and XhoI (6500, 2263, 1508, 1098, 979, 794 and 494 bps), and uncut DNA. All colonies show the correct digestion pattern.

Prepare the assembly reaction

• 4After you receive it, resuspend the synthetized fragment in autoclaved MiIiQ water to a final concentration of 25 ng μL⁻¹. From IDT, you will receive 500 ng of gBlock fragment, so resuspend in 20 μL. From Eurofins, you will receive a variable amount that is usually around 300 ng, so resuspend appropriately to a final concentration of 25 ng μL⁻¹.
• 5Prepare a ligation mix in a 0.2 mL PCR tube by pipetting:

  75 ng of the pUPD3 destination vector.

  2 μL of the synthetized fragment.

  1 μL BsmBI restriction enzyme.

  1 μL T4 DNA ligase.

  1 μL 10x T4 DNA ligation buffer.

  Add autoclaved MiliQ water up to a final volume of 10 μL.

  Note: We have built an alternative, the pUPD3 vector. Restriction enzyme overhangs are the same in pUPD and pUPD3 vectors so the cloning design is exactly the same, and both destination vectors can be substituted for each other. The only difference between both is that the pUPD vector is ampicillin resistant, and the pUPD3 vector is chloramphenicol resistant.

• 6Set up a thermocycler protocol, consisting of 25 cycles that oscillate between 2 minutes at 37°C (optimal for restriction enzymes) and 2 minutes at 16°C (optimal for ligases) (Figure 3E).

  Note 1: Alternatively, you can set up the thermocycler with an extended protocol encompassing 50 cycles, as illustrated in Figure 3F. After the 50 cycles, include an additional 1h digestion at 37°C followed by a 20 minute incubation at 85°C to inactivate the enzymes, and a prolonged incubation at 16°C (final incubations at 4ºC resulting in lots of condensation and unnecessary equipment burden are not recommended). This is a typical protocol we set when we start ligations at the end of the day and want to leave it overnight unattended.

  Note 2: While the optimal cutting temperature for BsmBI is 55ºC, cutting/ligation cycling is performed at 37ºC (Cutting activity for BsmBI at 37ºC is still 20%).

Transformation of the assembly reaction in E.coli, colony formation, culture growth, miniprep and verification of the plasmids

• 7Mix 2 μL of the ligation with 20 μL E.coli DH10B-T1R chemocompetent cells. Incubate for 30 minutes on ice.
• 8Give a 30 second heat shock at 42°C. Incubate on ice for an additional 2 minutes, and then add 500 μL of 2xLB media.
• 9Let the cells recover for 1h in a shaker at 37°C.
• 10Plate 50 μL of the culture on a LB plate containing chloramphenicol and Xgal.

  Note: Store the rest of the transformed cells at 4°C. Typically, you will obtain hundreds of colonies from 50 μL of a chemical transformation, but you can always plate more the next day if your colony count is very low.

• 11Incubate at 37°C overnight.
• 12Pick three white colonies into liquid LB medium containing chloramphenicol, and make a small line streak, serving as backup, on a chloramphenicol LB plate, so you can grow appropriately confirmed colonies again to make a glycerol stock at −80ºC for longterm storage. Grow overnight at 37°C for a maximum of 16h.

  Note 1: The pUPD/pUPD3 vectors carry a LacZ gene for blue/ white screening. The LacZ gene is removed from correctly assembled plasmids, resulting in white colonies. Blue colonies carry reconstituted intact destination plasmids (see Figure 3D).

  Note 2: We pick 3 colonies for ligations of synthetized DNA fragments into the pUPD3 vector. Synthetic linear DNA are not cloned and therefore not sequence guaranteed. Sanger sequencing is mandatory to verify the integrity of the clone. In our hands, assemblies at this stage generally end up all being correct after verification by Sanger sequencing. In the rare cases where the first clone isn’t sequence verified appropriately by dye terminator Sanger sequencing, a second clone is sent out for sequence verification.

• 13Isolate plasmids using the QIAprep Spin Miniprep, following the standard protocol.
• 14Quantify the DNA concentration of each miniprep using DeNovix DS-11+ spectrophotometer.
• 15Prepare the following restriction enzyme digestion:

  600 ng DNA.

  2.5 μL CutSmart Buffer.

  0.5 μL BsaI.

  Add autoclaved MilliQ water to a final volume of 25 μL.

• 16Incubate at 37°C for 1h.
• 17Run a 1% agarose gel electrophoresis separation experiment, according to Current Protocols in Molecular Biology (Voytas, 2001).
• 18Image the gel and compare it with Figure 3G. You should get two bands in the BsaI digestion, and the uncut plasmid should show the supercoiled and circular DNA bands, proving the plasmid integrity.
• 19Send one of the clones verified by restriction enzyme fingerprinting out for Sanger sequencing, using the M13F and M13R standard sequencing primers.
• 20Align the sequences with the theoretical sequence, using the SnapGene software.
• 21Take the LB plates where you made the streaks and pick the correct one into LB media containing chloramphenicol. Grow overnight in a shaker at 37°C.
• 22Make a glycerol stock with 500 μL of the overnight culture and 250 μL of 45% glycerol, for a final concentration of 15% glycerol. Store at −80°C for long-term storage.

Alternate Protocol 1

DNA synthesis and assembly cloning of a challenging transcriptional reporter element

Here we detail the protocol to build a new transcriptional reporter element from a synthetized DNA fragment that has extensive repetitive nature. In this example, we are building an insulated transcriptional reporter element based on the consensus FOXO responsive enhancer element (TTGTTTAC). Two of those elements are generally referred to as a Daf-16 family protein-binding element (DBE) (Furuyama et al., 2000). We decided to incorporate three copies of the DBE, previously determined to act optimally as a transcriptional reporter element (Zanella et al., 2009). Unfortunately, synthesis algorithms from two commercial DNA synthesis vendors, IDT and Eurofins, denied synthesis due to its amount of repetitiveness. Fortunately, the liberty of DNA synthesis allows to incorporate some tricks to decoy the synthesis algorithms resulting in circumventing the highlighted problems. This approach is presented here. The resulting construct has been deposited in Addgene (#124529).

Design of the synthetic DNA fragment

1. Use your preferred in silico DNA software to design the synthetic DNA fragment (Figure 4A and 4B).

2. The design includes:

   1. An EcoRI restriction enzyme site acting as a DNA watermark for DNA fingerprinting (Figure 4C), after the full multiplex luciferase vector is assembled (Figure 6A).
   2. Three GATCAAGTAAACAACTATGTAAACAA repeats, each incorporating two TTGTTTAC FOXO responsive enhancer elements in a reverse orientation (underlined), with scrambled spacers.
   3. Appropriate overhangs, determined by the pUPD/pUPD3 vector, guiding ligation of the fragments into the vector after cleavage with BsmBI. BsmBI cuts leave the CTCG and CGAG overhangs which are complementary to the ones in the pUPD/pUPD3 vector. BsmBI cut sites are indicated in blue (Figure 4D).
   4. Appropriate overhangs for future BsaI restriction enzyme cut, determined by the GoldenBraid2.0 grammar (Sarrion-Perdigones et al., 2013). These overhangs are GGAG and AATG, which will act as the seams between the vector and the promoter-like element, and between the promoter-like element and the coding sequence, respectively.

3. To circumvent the synthesis denial by the commercial vendors, two BsmBI flanked spacers were included, designed to disrupt two of the DBE repeats, as indicated in Figure 4E. The full redesigned sequence is shown in Figure 4G.

   Note 1: Commercial vendors use online algorithms to determine if a desired sequence can be synthesized by them (accepted) or not synthesized by them (denied).

   Note 2: Before ordering the to-be-synthesized fragment, it is a good idea to test the quality of the overhangs with the new “Ligase Fidelity Viewer” online tool developed by New England Biolabs: http://tools.neb.com/~potapov/cgi-bin/ligase-fidelity-viewer (Potapov et al., 2018b, 2018a). We made the simulation with the CTCG/CGAG, AACA/TGTT, CAAC/GTTG, and CGAG/CTCG overhangs and it predicted a 100% efficiency in the ligation with little trace mismatch ligation (Figure 4F).

4. The final DNA part will be built in a three-way ligation of three BsmBI fragments, released from the synthesized DNA part, into the pUPD/pUPD3 vector (Figure 4H).

5. The assembly protocol (Steps 4 to 6) and the transformation of the assembly reaction in E.coli (steps 7 to 11) is performed identically as indicated in BASIC PROTOCOL 1. Assembly conditions are illustrated in Figure 4I and Figure 4J.

6. After selection on chloramphenicol-supplemented LB plates, pick 4 white colonies for liquid growth and miniprep. Culture growth, miniprep and verification of the plasmids is performed similarly as indicated in BASIC PROTOCOL 1 (Steps 12–22). Perform diagnostic EcoRI and BsaI restriction enzyme digestions, and run them on a 1% agarose gel, together with the uncut plasmid. Compare digestion results with the image in Figure 4K, which includes 3 correct colonies (lanes 1 to 3) and one incorrect colony (lane 4). Send correctly digested plasmids for Sanger sequencing and compare the results with the in silico designed file. Make a glycerol stock of the sequence verified clone as explained before (BASIC PROTOCOL 1).

Figure 4. Example of domestication pipleline for the highly repetitive FoxO pathway response element (Alternate protocol 1).

(A) A first go at the to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP): both parts of the transcription blocker are indicated in grey, the FoxO DNA binding part is indicated in red, while the minimal promoter is indicated in black. (B) Overview schematic of the FoxO pathway response element (TB:3xDBE_RE:MiniP) highlighting the three parts: a transcription blocker (TB) part containing a synthetic polyA terminator (poly(A)) and the RNA polymerase II transcriptional pause signal from the human α2 globin gene (pause site), a FoxO DNA binding part consisting of three tandem FOXO response elements (3xDBE), and a minimal promoter (MiniP) part. (C) Close-up of the FoxO DNA binding part, highlighting three repetitive copies of the FoxO response element, DBE, all canonical FoxO-binding motifs (GATCAAGTAAACAACTATGTAAACAA) spaced by random nucleotides, and the recognition site for the type II restriction enzyme EcoRI to perform diagnostic DNA fingerprinting. (D) Detailed schematic of the initial to-be-synthetized FoxO pathway response element fragment (TB:3xDBE_RE:MiniP) highlighting the appropriate binding sites for the type IIs restriction enzyme BsmBI. Fragments with such repetitive nature often do not fulfill the requirements needed for successful DNA synthesis and can’t be ordered from commercial vendors. (E) Modified schematic of the FoxO pathway response element fragment, which incorporates two additional BsmBI spacers that disrupt the DBE repeats, reducing the repetitive nature and fulfilling the requirements needed for successful synthesis of the fragment by commercial vendors. Internal overhangs decided on for Type IIs restriction enzyme mediated assembly of the three DBE repeats are AACA and CAAC (see F). (F) Ligase fidelity chart, according to the NEB Tool (http://tools.neb.com/~potapov/cgi-bin/ligase-fidelity-viewer (Potapov et al., 2018b, 2018a)). Annealing and ligation fidelity of the chosen overhangs, CTCG/CGAG (Vector/DBE1 annealing), AACA/TGTT (DBE1/DBE1 annealing), CAAC/GTTG (DBE3/DBE3 annealing), and CGAG/CTCG (DBE3/Vector annealing), is estimated at 100% with minimal trace mismatch. (G) The to-be-synthesized sequence of the FoxO pathway response element (TB:3xDBE_RE:MiniP) with reduced repetitive nature: the FoxO DNA binding part, indicated in red, is now interrupted with two spacers (see E). (H) Overview of the in silico scarless assembly of the fragment in the domesticator plasmid pUPD3 (Universal Part Domesticator plasmid 3) using BsmBI and T4 DNA ligase, resulting in the final plasmid, pTB:3xDBE_RE:MiniP. The synthetic FoxO pathway response element (TB:3xDBE_RE:MiniP) will be cut into three smaller DNA fragments that after annealing and ligating will result in the precise reconstitution of the three repetitive copies of the FoxO response element DBE (see A). A second type IIs restriction enzyme, BsaI, is used for diagnostic DNA fingerprinting (see K), and will also be used to release the TB:3xDBE_RE:MiniP fragment during the next round of assembly when luciferase reporter transcriptional units will be stitched together (see Basic protocol 3 and Figure 5). Assembled plasmids are identified as white colored colonies that are characterized further (see K), while religated pUPD3 plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (I) Overview of the cloning reaction. Prepare a reaction mix containing 2 μL obtained synthetized fragment, 75 ng of pUPD3 domesticator plasmid, the type IIs restriction enzyme BsmBI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (J) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (K) Restriction enzyme digestions of 4 white colored colonies using EcoRI (2997, 233, 196 bp) or BsaI (3057, 369 bp), and uncut DNA. Three colonies show the correct digestion pattern, the fourth had probably incorporated only one of the three fragments.

Basic Protocol 3

Multipartite synthetic assembly cloning of individual pathway luciferase reporters

This protocol explains the steps to build a functional pathway-responsive luciferase transcriptional unit. As an example, we will generate a FOXO-responsive Renilla luciferase transcriptional reporter, using the response element described in the previous step (ALTERNATE PROTOCOL 1). The transcriptional unit is designed to occupy the AlphaC position of the assembly structure, the predefined position for the Renilla pathway reporter unit in our final multiplex luciferase vector (see Basic Protocol 4) (see Figure 1 and Figure 6).

Materials: Reagents, solutions, and starting samples or test organisms/cells

AlfaC vector, diluted to 50 ng mL⁻¹ (Addgene #124525).

DNA part entry vectors encoding the luciferase Renilla (pRenilla, Addgene #118059), the bovine growth hormone polyadenylation signal bGHpA (pbGHpA, Addgene #118061), and the part generated in the previous step (ALTERNATE PROTOCOL 1) (TB:3xDBE_RE:MiniP, Addgene #124529).

Bacterial plates containing LB agar supplemented with 30 μg mL⁻¹ kanamycin + 2% XGal.

LB liquid medium containing 30 μg mL⁻¹ kanamycin.

Restriction enzymes: BsaI (New England Biolabs, cat. no. R0535S), EcoRI-HF (New England Biolabs, cat. no. R3101S), KpnI-HF (New England Biolabs, cat. no. R3142S), SphI-HF (New England Biolabs, cat. no. R3182S), StyI-HF (New England Biolabs, cat. no. R3500S).

Restriction enzyme cutting buffer: CutSmart Buffer (New England Biolabs, cat. no. B7204S).

T4 DNA ligase and 10x ligase buffer (Promega, cat. no. M1801).

Home-made chemocompetent E. coli DH10B-T1R cells (ThermoFisher Scientifc, cat. no., 12331013) (see recipe).

2xLB media, no antibiotic (see recipe).

Note: 2xLB has double the amount of all ingredients except for NaCl.

Reagents for agarose gel electrophoresis as described in Current Protocols of Molecular Biology (Voytas, 2001).

45% glycerol in MiliQ water sterilized using autoclaving.

Materials: Hardware and instruments (e.g., glassware, disposables, microscopes, centrifuge)

14 mL sterile bacterial culture tubes (VWR, cat. no. 60818–689).

Table top centrifuge that can accommodate 1 mL tubes (Fisher Scientific, cat. no. 75230115).

1.7 mL microcentrifuge tubes (VWR, cat. no. 87003–294).

Table top microcentrifuge that can accommodate 1.7 mL tubes (Fisher Scientific, cat. no. 75002435).

0.2 μL PCR tubes (VWR, cat. no. 20170–012)

Thermocycler (Applied Biosystems, cat. no. 4375786)

42°C dry bead bath for bacterial transform

37°C incubator-shakers (Amerex, cat. no. 747/747R)

QIAprep Spin Miniprep Kit (QIAGEN, cat. no. 27106)

DeNovix DS-11+ spectrophotometer (DeNovix, cat. no. DS-11)

Equipment for agarose gel electrophoresis as described in Current Protocols in Molecular Biology (Voytas, 2001).

Prepare the assembly reaction

• 1Prepare the ligation mix in a 0.2 mL PCR tube by pipetting:

  75 ng of the Alpha C destination vector (Addgene #124525)

  75 ng of TB:3xDBE:MiniP entry vector (Addgene #124529)

  75 ng of the Renilla luciferase entry vector (Addgene #118059)

  75 ng of the bGHpA entry vector (Addgene #118061)

  1 μL BsaI restriction enzyme

  1 μL T4 DNA ligase

  1 μL 10x T4 DNA ligase Buffer

  Autoclaved miliQ water, to 10 μL final volume.

• 2Set up the thermocycler protocol so that the instrument produces 25 cycles that oscillate between 2 minutes at 37°C (optimal for restriction enzymes) and 5 minutes at 16°C (optimal for ligases) (Figure 5B).

  Note: Alternatively, you can set the thermocycler with the expanded protocol as in Figure 5C.

Figure 5. Synthetic assembly of a luciferase reporter transcriptional unit (Basic protocol 2).

(A) Overview of the in silico scarless assembly of a a luciferase reporter transcriptional unit in the destination plasmid Alpha C. Three “part” plasmids, TB:3xDBE:MiniP (Addgene #124529), pRenilla luciferase (Addgene #124529) and bGHpA (Addgene #118061), and the destination vector AlphaC are incubated with BsaI and T4 DNA ligase. Correct multipartitie stitching of all three BsaI-released fragments into BsaI-opended AlphaC, results in the final plasmid, 3xDBE_RE::Renilla (Addgene #124535), consisting of transcription blocker, three copies of the FoxO response element DBE, minimal promoter, Renilla luciferase and transcriptional terminator. A second type IIs restriction enzyme, BsmBI, can be used for diagnostic DNA fingerprinting, and will also be used to release the 3xDBE_RE::Renilla fragment during the next round of assembly when multiple luciferase reporter transcriptional units will be stitched together (see Basic protocol 4 and Figure 6). Assembled plasmids are identified as white colored colonies that are characterized further (see D), while religated AlphaC plasmids are blue colored due to the presence of the colorimetric LacZ α-fragment. (B) Overview of the cloning reaction. Prepare a reaction mix containing 75 ng of each of the parts to be assembled (TB:3xDBE:MiniP, pRenilla luciferase #124529 and bGHpA #118061), 75 ng of the AlphaC destination vector, the type IIs restriction enzyme BsaI, T4 DNA ligase and 10x T4 DNA ligase buffer. Start the assembly protocol that cycles 25 times between 37°C (favoring cutting) and 16°C (favoring ligation). (C) Extended assembly cycling reaction conditions, with 50 cycles of 37°C and 16°C, followed by 1h at 37°C to favor digestion of uncut plasmids, 20 minutes at 85°C to denature the enzymes and a prolonged incubation at 16°C. (D) Restriction enzyme digestion of 2 white colored colonies using EcoRI/SphI (2521, 1014 and 334 bp) and KpnI/StyI (2304, 1176 and 389 bp), and uncut DNA. Both colonies show the correct digestion pattern.

Introduction by transformation of the assembly reaction (ligation mix) into E. coli, colony formation, culture growth, miniprep and verification of the plasmids

• 3Mix 2 μL of the ligation with 20 μL E. coli DH10B-T1R chemocompetent cells. Incubate for 30 minutes on ice.
• 4Give a 30 seconds heat shock at 42°C using a dry bead bath. Incubate on ice for an additional 2 minutes, and then add 500 μL of 2xLB media.
• 5Let the cells recover for 1h in a shaker at 37°C.
• 6Plate 50 μL of the culture on a LB plate containing kanamycin and X-gal.

  Note: Store the rest of the transformed cells at 4°C. Typically, you will obtain hundreds of colonies from 50 μL of a chemical transformation, but you can always plate more the next day if your colony count is very low for some unexpected reason.

• 7Incubate at 37°C overnight.
• 8Pick two white colonies into liquid LB medium containing kanamycin, and make a small streak on a kanamycin LB plate, so you can grow appropriately confirmed colonies again to make a glycerol stock at −80ºC for long-term storage. Grow overnight at 37°C for a maximum of 16h.

  Note 1: The AlphaC vector carries a LacZ gene for blue/white screening. The LacZ gene is removed from correctly assembled plasmids, resulting in white colonies. On the other hand, blue colonies mark unassembled intact destination plasmids (see Figure 4B).

  Note 2: We pick just 2 colonies for BsaI-driven assemblies of 3 fragments in one destination vector. BsaI reactions are consistently more efficient than BsmBI reactions.

• 9Isolate plasmids using the QIAprep Spin Miniprep, following the standard protocol.
• 10Quantify the DNA concentration of the minipreps using the DeNovix microspectrophotometer.
• 11Prepare the following restriction enzyme digestions:

  EcoRI+SphI

  600 ng of DNA

  2.5 μL CutSmart Buffer

  0.5 μL EcoRI

  0.5 μL SphI

  Add autoclaved miliQ water to a final volume of 25 μL.

  KpnI+StyI

  600 ng of DNA

  2.5 μL CutSmart Buffer

  0.5 μL KpnI

  0.5 μL StyI

  Add autoclaved miliQ water to a final volume of 25 μL.

• 12Incubate at 37°C for 1h.
• 13Run a 1% agarose gel electrophoresis separation experiment, according to Current Protocols in Molecular Biology (Voytas, 2001).
• 14Image the gel using a gel documentation system and compare it with Figure 4D. You should get three bands in each digestion: 2521, 1014 and 334 bp bands for the EcoRI+SphI digestion; 2304, 1176 and 389 bp bands for the KpnI+StyI digestion, and the uncut plasmid should show the supercoiled and circular DNA bands, proving plasmid integrity.
• 15Take the LB plates where you made the corresponding streaks and pick the correct clone and inoculate into LB media containing kanamycin. Grow overnight in a shaker at 37°C.
• 16Make a glycerol stock with 500 μL of the overnight culture and 250 μL of 45% glycerol, for a final concentration of 15% glycerol. Store at −80°C for long-term storage.

Basic Protocol 4

One step assembly into final multiplex hextuple luciferase vectors

The last protocol in this unit demonstrates how to build a multiplex hextuple luciferase vector, tailored to user-specified reporter needs, in a one-step assembly. As proof-of-concept, we will use 4 pre-built pathway luciferase reporters that were previously generated (Sarrion-Perdigones et al., 2019) but were adapted to multi transcriptional unit assembly put forward here by moving them into the appropriate alpha vectors, and the custom FOXO:MiniP:Renilla built in a previous step (BASIC PROTOCOL 3) (Figure 5A). We deposited this final construct in Addgene with number #124536.

Materials: Reagents, solutions, and starting samples or test organisms/cells

Omega destination-CMV:ELuc vector, diluted to 75 ng mL⁻¹ (Addgene #124528)

Addgene entry vectors encoding the NF-κβ-responsive RedF luciferase transcriptional unit in alphaA(5xNF-κβ _RE::RedF, Addgene #124530), the SMAD-responsive FLuc luciferase transcriptional unit in alphaB (7xSMAD_RE::FLuc, Addgene #124531), the p53-responsive NLuc luciferase transcriptional unit in alphaD (2xP53_RE::NLuc, Addgene #124533), the MAPK/JNK-responisve GrRenilla transcriptional unit in alphaE (6xAP-1_RE::GrRenilla, Addgene #124534), and the FOXO-responsive Renilla luciferase transcriptional unit in alphaC (3xDBE_RE::Renilla, Addgene #1245435).

Bacterial plates containing LB agar supplemented with 100 μg mL⁻¹ spectinomycin.

LB liquid medium containing 100 μg mL⁻¹ spectinomycin.

Restriction enzymes: BsmBI (New England Biolabs, cat. no. R0580), ScaI-HF (New England Biolabs, cat. no. R3122), XhoI (New England Biolabs, cat. no. R0146).

Restriction enzyme cutting buffer: CutSmart Buffer (New England Biolabs, cat. no. B7204S).

T4 DNA ligase and 10x ligase buffer (Promega, cat. no. M1801).

Home-made chemocompetent E. coli DH10B-T1R cells (ThermoFisher Scientifc, cat. no., 12331013; see recipe).

2xLB media, no antibiotic (see recipe).

Note: 2xLB has double the amount of all ingredients except for NaCl.

Reagents for agarose gel electrophoresis as described in Current Protocols of Molecular Biology (Voytas, 2001).

45% glycerol in MiliQ water sterilized using autoclaving.

Materials: Hardware and instruments (e.g., glassware, disposables, microscopes, centrifuge)

14 mL sterile bacterial culture tubes (VWR, cat. no. 60818–689)

Table top centrifuge that can accommodate 14 mL tubes (Fisher Scientific, cat. no. 75230115)

1.7 mL microcentrifuge tubes (VWR, cat. no. 87003–294)

Table top microcentrifuge that can accommodate 1.7 mL tubes (Fisher Scientific, cat. no. 75002435)

0.2 μL PCR tubes (VWR, cat. no. 20170–012)

Thermocycler (Applied Biosystems, cat. no. 4375786)

37°C incubator-shakers (Amerex, cat. no. 747/747R)

QIAprep Spin Miniprep Kit (QIAGEN, cat. no. 27106)

DeNovix DS-11+ spectrophotometer (DeNovix, cat. no. DS-11)

55°C incubator (VWR, cat. no. 89409–216)

Equipment for agarose gel electrophoresis as described in Current Protocols in Molecular Biology (Voytas, 2001).

Prepare the assembly reaction

• 1Prepare the ligation mix in a 0.2 mL PCR tube by pipetting:

  75 ng of the Omega destination-CMV:ELuc vector (Addgene #124528).

  75 ng of the 5xNF-κβ_RE::RedF alphaA entry vector (Addgene #124530).

  75 ng of the 7xSMAD_RE::FLuc alphaB entry vector (Addgene #124531).

  75 ng of the 2xp53_RE::NLuc alphaD entry vector (Addgene #124533).

  75 ng of the 6xAP-1_RE::GrRenilla alphaE entry vector (Addgene #124534).

  75 ng of the TB:3xDBE:miniP:Renilla alphaC entry vector, built in the previous step (BASIC PROTOCOL 3) but also deposited at Addgene (Addgene #124535).

  1 μL BsmBI restriction enzyme.

  1 μL T4 DNA ligase.

  1 μL 10x T4 DNA ligase buffer.

  Autoclaved milliQ water, to 15 μL final volume.

• 2Set the thermocycler protocol, to generate 25 cycles that oscillate between 2 minutes at 37°C (optimal for restriction enzymes) and 5 minutes at 16°C (optimal for ligases) (Figure 6B).

  Note: Alternatively, you can program the thermocycler with the expanded protocol as in Figure 6C.

Transformation of the assembly reaction into E. coli, colony formation, culture growth, miniprep and verification of the plasmids

• 3Mix 3 μL of the ligation reaction with 20 μL E. coli DH10B-T1R chemocompetent cells. Incubate for 30 minutes on ice.
• 4Give a 30 seconds heat shock at 42°C. Incubate on ice for 2 minutes, and then add 500 μL of 2xLB media.
• 5Let the cells recover for 1h in a shaker at 37°C.
• 6Plate 50 μL of the culture on a LB plate containing spectinomycin and X-gal.

  Note: Store the rest of the transformed cells at 4°C. Typically, you will obtain hundreds of colonies from 50 μL of a chemical transformation, but you can always plate more the next day if your colony count is very low.

• 7Incubate at 37°C overnight.
• 8Pick three white colonies into liquid LB medium containing spectinomycin, and make a small streak on a spectinomycin LB plate, so you can grow appropriately confirmed colonies again to make a glycerol stock at −80ºC for longterm storage. Grow overnight at 37°C for a maximum of 16h.

  Note 1: The Omega Destination-CMV:ELuc vector carries a purple chromogenic protein for purple/white screen. The tinsel purple gene is removed from the correctly assembled plasmids, resulting in white colonies. Purple colonies mark unassembled intact destination plasmids (see Figure 6A).

  Note 2: We pick 3 colonies for complex assemblies like this one (i.e., 5 fragments to be assembled in one destination vector). For easier assembles, 2 colonies are usually enough to find a correct one.

• 9Isolate plasmids using the QIAprep Spin Miniprep kit, following the standard protocol.
• 10Quantify the DNA concentration of the minipreps using a DeNovix microspectrophotometer.
• 11Prepare the following digestions:

  ScaI

  600 ng of DNA

  2.5 μL CutSmart Buffer

  0.5 μL ScaI

  Add autoclaved milliQ water to a final volume of 25 μL.

  XhoI

  600 ng of DNA

  2.5 μL CutSmart Buffer

  0.5 μL XhoI

  Add autoclaved milliQ water to a final volume of 25 μL.

• 12Incubate at 37°C for 1h.
• 13Run a 1% agarose gel electrophoresis separation experiment, according to Current Protocols in Molecular Biology (Voytas, 2001).
• 14Image the gel using a gel documentation system and compare it with Figure 6D. You should get multiple bands in each digestion: 6510, 2219, 1790, 1543, 1088 and 486 bps for the ScaI digestion; 6500, 2263, 1508, 1098, 979, 794, and 494 bps for the XhoI digestion. The uncut plasmid should show the supercoiled and circular DNA bands, proving the plasmid integrity.
• 15Take the LB plates where you made the streaks and pick the correctly verified clone into LB media containing spectinomycin. Grow overnight in a shaker at 37°C.
• 16Make a glycerol stock with 500 μL of the overnight culture and 250 μL of 45% glycerol, for a final concentration of 15% glycerol. Store at −80°C for long-term storage.

Support Protocol 1

Generation of home-made chemocompetent E. coli DH10B-T1R cells

Competent cells should consistently yield >1.0 ×10⁸ transformants/μg pUC19 with non-saturating amounts of DNA.

Materials: Reagents, solutions, and starting samples or test organisms/cells

LB liquid medium

S.O.C. medium

Ice cold TFB-1 and TFB-II buffers (see recipes)

pUC19 DNA, 0.01 μg/mL

LB agar plates containing 100 μg mL⁻¹ ampicillin

Materials: Hardware and instruments (e.g., glassware, disposables, microscopes, centrifuge)

37°C incubator-shaker.

14 mL sterile bacterial culture tubes (VWR, cat. no. 60818–689).

50 mL sterile conical tubes (VWR, cat. no. 89039–664).

Table-top centrifuge that can accommodate 14 mL and 50 mL tubes (Fisher Scientific, cat. no. 75230115)

500 mL Erlenmeyer flask, with 100 mL LB medium, autoclaved inside the flask

Ice water bath

42°C water bath

Preparation of the cells

• 1Streak DH10B-T1R cells from a glycerol stock onto an LB plate.
• 2Grow overnight at 37°C towards single colonies.
• 3Grow a single colony overnight at 37°C in 3 mL LB.
• 4Dilute 100 times, by adding 1 mL to 100 mL LB which was autoclaved inside an Erlenmeyer flask.
• 5Grow up at 37°C for 2.5 hrs. O.D. should be around 0.4–0.5.

  Note: We typically don’t measure the optical density of the culture, to avoid contaminating the cells, but you should measure it until you are familiar with the protocol.

• 6Set the temperature of the centrifuge at 4°C
• 7Transfer the culture to two 50 mL conical tubes and equilibrate.
• 8Chill cells in an ice water bath for 10’ to 15’.
• 9Spin at 4000 rpm for 10 minutes, at 4°C.
• 10Remove supernatant by decanting, and final supernatant remnants with pipet tip.
• 11Carefully resuspend the bacteria from each tube in 2 mL of ice-cold TFB-I.
• 12Add 18 mL of cold TFB-I.
• 13Incubate 15’ in an ice water bath.
• 14Spin at 4,000 rpm for 10 minutes, at 4°C.
• 15Remove as much supernatant as possible, with tip.
• 16Carefully resuspend the bacteria from each tube in 2 mL ice-cold TFB-II resulting in 4 ml total.
• 17Incubate 15’ on an ice water bath.
• 18Divide in 40 aliquots of 100 μl cells and flash-freeze using a dry-ice Et/MeOH bath.
• 19Store aliquotes at –80°C.

Verification of the transformation efficiency

• 20Take one aliquot of cells from –80°C, and thaw on ice.
• 21Add 10 pg of pUC19, which is 1 μL of the pUC19 stock.
• 22Mix gently by tapping.
• 23Leave on ice for 30’.
• 24Heat shock exactly 30” at 42°C.
• 25Immediately chill on ice.
• 26Add 500 mL S.O.C. medium.
• 27Incubate shaking at 37°C for 1h.
• 28Dilute the transformed cells 10 times, by pipetting 50 μL of the culture into 500 μL of S.O.C. medium.
• 29Plate 50 μL of the diluted transformed cells onto an LB plate containing ampicillin.
• 30Incubate overnight at 37°C.
• 31Count the colonies and calculate the total number of transformants per μg of DNA.

$$Transformationefficiency=\frac{Numberofcolonies}{\mathrm{\mu }\mathrm{g}\mathrm{p}\mathrm{U}\mathrm{C}19}\times \frac{Final\mathrm{\mu }\mathrm{L}recovery}{\mathrm{\mu }\mathrm{L}plated}\times Dilutionfactor$$

$$Transformationefficiency=\frac{Numberofcolonies}{{10}^{-5}\mathrm{\mu }\mathrm{g}}\times \frac{550\mathrm{\mu }\mathrm{L}}{50\mathrm{\mu }\mathrm{L}}\times 10$$

Reagents and Solutions

2xLB

This is an enriched LB medium, which we use for bacterial recovery instead of the usual S.O.C. medium, since it is easier to prepare. It has twice the amounts of all ingredients with the exception of NaCl.

1. Weigh the following reagents:

   10 g of tryptone (WVR, cat. no. 97063–386).

   5 g of yeast extract (Alfa Aesar, cat. no. H26769–22).

   2.5 g of NaCl (Alfa Aesar, cat. no. A12313–0B).

2. Dissolve in 400 mL water, with agitation.

3. Adjust the volume to 500 mL.

4. Autoclave for 20 minutes.

Buffer TFB-I (KCl-based)

Note: the very expensive Rubidium Chloride normally used in this protocol is substituted by the much cheaper KCl.

1. Weigh the following reagents:

   1.47g g CH₃CO₂K (VWR, cat. no. BDH9254), for a final concentration of 30 mM.

   3.72 g KCl (VWR, cat. no. 97061–566), for a final concentration of 100 mM.

   0.735 g CaCl₂×2·H₂O (VWR, cat. no. BDH9224), for a final concentration of 10 mM.

   75 mL glycerol (VWR, cat. no. BDH1172), for a final concentration of 15%.

2. Dissolve in 425 mL MiliQ water, with agitation.

3. Adjust pH to 5.8 with diluted acetic acid and fill up to 500 mL.

4. Add 4.95 g MnCl₂×4·H₂O (VWR, cat. no. 89230–036), for final concentration of 50 mM. It is critical to add this reagent after adjusting the pH.

5. Filter sterilize in previously washed and autoclaved bottle.

Buffer TFB-II (KCl-based)

Note: the very expensive Rubidium Chloride normally used in this protocol is substituted by the much cheaper KCl.

1. Weight the following reagents:

   0.419 g MOPS (VWR, cat. no. 97062–156), for final concentration of 10 mM

   0.149 g KCl (VWR, cat. no. 97061–566), for final concentration of 10 mM

   2.205 g CaCl₂×2·H₂O (VWR, cat. no. BDH9224), for final concentration of 75 mM

   30 mL glycerol (VWR, cat. no. BDH1172), for final concentration of 15%.

2. Dissolve in 170 mL MiliQ water, with agitation.

3. Adjust pH to 6.5 with diluted NaOH (0.2N and 0.02N) and fill up to 200 mL.

4. Filter sterilize in previously washed and autoclaved bottle.

Commentary

Background Information

The simultaneous and sensitive assessment of pathway signaling through multiple cellular pathways within the same cells necessitates orthogonal reporters that can assay over large dynamic ranges. Luciferases are cost-effective, versatile candidates whose output signals can be sensitively detected. Commonly used dual luciferase reporter assays detect one luciferase that is coupled to a single cellular pathway, and a second that is coupled to a control pathway for normalization purposes. We recently improved this approach by expanding this assay’s multiplexing capabilities from two to six (Sarrion-Perdigones et al., 2019). Multiplex hextuple luciferase assaying is able to report on five cellular signaling pathways and one control, each of which is encoded by a unique luciferase. Light emission by the six luciferases is distinguished by the use of distinct substrates and by decomposing the emitted light using the emission spectra of each enzyme. Using an adaptable synthetic assembly cloning pipeline that can be applied to any cellular pathways, all six luciferase reporter units are stitched together into a single vector. Using a single multiplex reporter plasmid, cellular uptake of all luciferase reporters in each transfected cell is guaranteed, and changes in activity for all five signaling pathways can be measured with less experimental variability.

To distinguish classical “cotransfection” methods from the transfection method of a single plasmid stitched together by synthetic assembly cloning, we proposed the new term “solotransfection” (Sarrion-Perdigones et al., 2019) (Figure 7). A multiplex reporter vector carries all transcription units on the same plasmid, ensuring identical copy number of each luciferase reporter in each transfected cell (Figure 7A), as opposed to cotransfection of individual plasmids that each encode one luciferase unit (Figure 7B). Therefore, luminescence emission values obtained after solotransfection demonstrate lower experimental variability (measured by the coefficient of variation, %CV) and smaller error bars, compared to cotransfection, under experimental conditions when two, three, four, five or six transcriptional units were transfected (Sarrion-Perdigones et al., 2019). Hence, synthetic assembly cloning to stitch together all six luciferase reporter units into a single plasmid ensures will ensure the delivery of all reporter units into every transfected cell, diminishing experimental errors and aiding experimental rigor and reproducibility.

Figure 7. Solotransfection of one multiplex luciferase reporter generated by synthetic assembly results in equal stoichiometric cellular uptake, lower experimental variability, and smaller error bars, compared to cotransfection of six individual luciferase reporters.

Schematic of multiplex hextuple luciferase assaying to monitor changes in five experimental cellular signaling pathways (c-Myc, NF-κβ, TGF-β, p53, and MAPK/JNK) against a control cellular signaling event (constitutive CMV promoter), after cotransfection of six individual luciferase reporter plasmids (A), or solotransfection of a single multiplex luciferase reporter vector generated by synthetic assembly cloning (B). A cell sample, previously transfected with experimental and control luciferase reporters using cotransfection (A) or solotransfection (B), and treated with genetic knockdown or small molecules, is washed and lysed, followed by (1) the addition of D-Luciferin substrate and measuring a first collection of the resulting spectrally separable emission spectra, and (2) the addition of quenching reagent as well as coelenterazine substrate and measuring once more the resulting spectrally separable emission spectra. All six emission measurements are subsequently used to calculate quantitative changes in five experimental cellular signaling pathways at once (c-Myc, NF-κβ, TGF-β, p53, and MAPK/JNK signaling). Issues with equal stoichiometric cellular uptake of all luciferase reporters are encountered during cotransfection but not during solotransfection, resulting in lower experimental varianbility (measured by the coefficient of variation, %CV) and smaller error bars during solotransfection, but not cotransfection.

Critical Parameters

1. You need good quality DNA for the assembly reactions. Prepare your DNA and dilute to 75 ng/μl for easier pipetting into the assembly reactions. Store the DNA at −20°C.

2. Pick two or three colonies in each assembly reactions, and you will likely find a correct one by restriction enzyme DNA fingerprinting. Type IIs assemblies are very efficient, no matter if they consist of 2, 3, 4, or 5 parts put together in a destination vector.

3. Find good restriction enzymes to verify your assemblies. This is key for the validation of the constructs. You should do two parallel digestions that cut your vector in very distinctive DNA fragments.

4. Run uncut DNA while you do the plasmid digestions. Uncut plasmid produces two bands on a gel, representing the open-circular and super coiled DNA; for the same over-all size, supercoiled DNA runs faster than open-circular DNA. A relaxed plasmid configuration is also possible, generating a third band, but this one is the minority and is often not seen. Uncut DNA will inform you of unwanted plasmid dimerization which will have a larger size than expected.

Troubleshooting

I followed the BsmBI insert strategy to build a DNA part, as explained in the Alternate Protocol 1. I sequenced several clones, and they still have one or both small BsmBI stuffer fragments

Repeat the assembly reaction using the restriction enzyme BsmBI and T4 DNA ligase as described in Basic Protocol 2. The small stuffer fragments will be released, and the plasmid will religate into the correctly assembled plasmid. Transform the assembly reaction back into E.coli and pick new colonies. Miniprep and digest, now it should be fine.

I have repeated an assembly reaction several times, but it keeps failing

You have probably a problem with one of the synthesized parts you are trying to assemble or with the destination vector you are using (usually DNA degradation). Perform a digestion with the enzyme that releases all the parts and opens the vector (i.e., BsaI or BsmBI depending on the step you are in), to verify the integrity and stability of each of them. Repeat a miniprep of the one you find that is degraded or unstable.

Anticipated/Understanding Results

GoldenBraid2.0 assembly reactions are usually very straightforward and should not present any problem to the user. Typically, 2 to 4 colonies are picked in each assembly step, and there are always more than one correct clones (if not all of them). It should be easy to customize the multiplex luciferase vector, using the deposited plasmids from Addgene and newly generated transcriptional response elements adapted to the user’s research.

Time Considerations

The complete procedure can be performed in less than two work weeks (Figure 8), provided that the plasmids have been requested from Addgene, and that the new response elements have been designed, and the synthetic fragments have been ordered. The preparation of the plasmids will take a total of 3 days and end on day 3 and overlaps with the assembly of the new response element into the domesticator vector, that starts on day 3, and by day 5 correct colonies can be sent out for confirmation by Sanger sequencing. Results should be back by day 1 of the second week, and upon confirmation of the integrity of the clone, the multipartite reaction is set. This finishes on day 8, and the final multiluciferase assembly starts. This last step should be finalized by day 10.

Figure 8. Expected timeline.

Gantt chart illustrating tasks and milestones for basic protocols (BP), and alternate protocols (AP), as well as working days across two calendar weeks (D1 to D10).