Skip to main content
NCBI home page
International Journal of Ophthalmology logoLink to International Journal of Ophthalmology
. 2020 Aug 18;13(8):1294–1305. doi: 10.18240/ijo.2020.08.17

Assessment of single nucleotide polymorphisms associated with steroid-induced ocular hypertension

Lakshmi Badrinarayanan 1,2, Srujana Chitipothu 3, Sharada Ramasubramanyan 4, Sarangapani Sripriya 5, Pukhraj Rishi 6, Ekta Rishi 6, Ronnie George 7, Baddireddi Subhadra Lakshmi 2, Sailaja V Elchuri 1
PMCID: PMC7387895  PMID: 32821685

Abstract

AIM

To access the association of forty-eight single nucleotide polymorphisms (SNPs) identified from Caucasian population with steroid-induced ocular hypertension (OHT) in India population.

METHODS

Fifty-four triamcinolone-acetonide (TA) and forty-seven dexamethasone (Dex) administered subjects were enrolled in the study after a written consent. Intraocular pressure (IOP) values were recorded for a period of 6-month post steroid injections and patients were grouped as steroid-responders (SR: IOP≥21 mm Hg) and non-responders (NR: IOP≤20 mm Hg). Genomic DNA was isolated from peripheral venous blood. Forty-eight SNPs identified in TA treated Caucasian patients by genome wide association study (GWAS) were genotyped using iPLEX™ MassARRAY among TA as well as Dex administered Indian patients. Genotyping data of 48 general subjects from a previous study were considered as reference controls for statistical analysis. Genotypic frequencies were calculated and P-value, Chi-square and odds ratio at 95% confidence-interval of group A (steroid treated vs controls), group B (SR vs NR), group C (phenotype correlation: influence of time, severity and gender on IOP rise), were calculated. P<0.05 was considered to be statistically significant.

RESULTS

OHT was observed in 50% of TA and 26% of Dex administered patients, respectively. IOP rise was mostly severe (>30 mm Hg) and immediate (<1wk) among TA-SR patients while it was noticed to be mild (<30 mm Hg) and between 1-2mo among Dex-SR patients. Logistic regression for risk factor correlation with OHT remained non-significant, hence these factors were not considered as confounding parameters for further analysis. rs133, rs34016742, rs274554, rs10936746, rs274547, rs804854, rs7751500, rs359498, and rs7547448 SNPs significantly varied even after Bonferroni corrections (P<0.0025; group A). rs1879370 (TA) and rs6559662 (Dex) were significantly (P<0.05) associated with OHT (group B). rs133 (severe IOP rise), rs11047639 and rs1879370 (male gender), and rs11171569 (immediate IOP rise) significantly (P<0.05) influenced the phenotype correlation only among TA-OHT patients. However, the significance of these SNPs in group B and phenotype analysis (group C) was lost upon Bonferroni corrections (P<0.0025).

CONCLUSION

Prevalence of OHT in study population is observed to be similar to other studies both in TA and Dex treated patients. We can correlate rs34016742 involved in diabetes signaling pathway to the occurrence of ocular edematous and inflammatory conditions. Except rs133 that is involved in neuro-degeneration and myopia occurrence, none of the other SNPs identified in Caucasian population possess any correlation with OHT incidence in TA and Dex administered Indian subjects.

Keywords: triamcinolone-acetonide, dexamethasone, ocular hypertension, single nucleotide polymorphisms, diabetes, neurodegeneration, myopia

INTRODUCTION

Intravitreal steroids such as triamcinolone-acetonide (TA) and dexamethasone/Ozurdex (Dex) are the current modality of treatment for certain ocular inflammatory conditions such as macular edema resulting from chronic diabetes; termed as diabetic macular edema (DME), retinal vein occlusion (RVO) and post cataract macular edema (CME)[1]–[2]. However, use of these intravitreal steroids in some cases is accompanied with either unwarranted elevation of intraocular pressure (IOP; >20%), cataract (>15%), endophthalmitis (>5%), or uveitis (>5%)[3]–[5]. Of these, an IOP rise commonly referred as steroid-induced ocular hypertension (SI-OHT), when left untreated could result in secondary glaucoma with optic nerve head (ONH) damage and permanent vision loss. SI-OHT is reported approximately in 58.3% of patients with existing glaucoma[5] and in 20%-30% of patients with no prior history or known risk factors for glaucoma[6]. Treatment for SI-OHT is primarily with anti-glaucoma medications (AGM). If medically uncontrolled, a surgical intervention procedure (glaucoma filtration surgery) is performed.

Pathophysiology of SI-OHT is remarkably similar to that of primary open angle glaucoma (POAG) with over-expression and excessive deposition of extracellular matrix (ECM) proteins on trabecular meshwork (TM). Dysfunction of TM due to differential expression of myocilin gene and protein, drug crystallization in TM layer and the consequent obstruction of aqueous humor (AH) outflow are the proposed mechanisms of POAG[6]. However, none of these mechanisms have been evidenced into their potential role for SI-OHT. As genetic influence on SI-OHT was reported as early as in 1966, research on identification of biomarkers has primarily focused on genetic variations in the varying drug response (SI-OHT). While initial studies that explored the genetic background of SI-OHT predisposition remains inconclusive[7]–[12], an earlier genome wide association study (GWAS) has identified 48 single nucleotide polymorphisms (SNPs) corresponding to 33 genes to be responsible for the variability in steroid response upon TA treatment[13]. As the genetic framework varies with race and geographical distribution, identification of these SNPs in different ethnic cohort of patients would be necessary to establish a global association of SNPs with SI-OHT.

Dex sustained drug delivery implant, a recent formulation is preferred due to its prolonged activity but also induces OHT in up to 20%-30% of those administered with the drug[14]–[15]. No such GWAS or validation of associated SNPs to identify the genetic determinants for Dex induced OHT have been reported in any population. Present study was carried out at a tertiary ophthalmic hospital, to look for an association of the reported 48 SNPs in causing OHT following TA and Dex administration in an Indian population.

SUBJECTS AND METHODS

Ethical Approval

Study was approved by the Institutional Ethics Committee (Ethics No.317-2012-P) and adhered to the Declaration of Helsinki. Peripheral venous blood was collected with duly signed informed consent. Patients didn't receive any stipend during their enrolment.

Subjects

TA (n=54) and Dex (n=47) administered patients at tertiary care eye hospital, Sankara Nethralaya in Chennai, India were enrolled in this study. Inclusion criteria: DME, RVO, CME patients; exclusion criteria: patients with pre-existing glaucoma, family history of glaucoma, baseline IOP>21 mm Hg, AGM usage, shallow anterior chamber, gonioscopy data revealing closed angles, eye injury, rubeosis of iris or angle uveitis. All patients underwent standard eye examination including optic disc evaluation for glaucomatous changes, prior to steroid administration. IOP was measured before steroid administration (baseline) and on first day (day 1) after intravitreal procedure. Follow-up IOP measurements were made at 1, 3, and 6mo post injection. ΔIOP values were calculated by subtracting maximum IOP from baseline IOP and patients were grouped as steroid-responders (SR) and non-responders (NR). Steroid responsiveness mentioned in this study is based only on the IOP changes following steroid administrations; wherein, SR's have IOP≥21 mm Hg/ΔIOP ≥6 mm Hg and NR's have IOP≤20 mm Hg/ΔIOP≤5 mm Hg up to 6mo post steroid administration. Details of DME, CME and RVO resolution were not discussed in this study.

Sample Collection, DNA Extraction and SNP Genotyping

Genomic DNA was extracted using Qiagen DNA extraction kit, according to the manufacturer's protocol. Of 48 SNPs were genotyped by iPlex GOLD SNP genotyping Sequenom MassARRAY® System (Sandeigo, USA). Briefly, forward, reverse and extension primers (Table 1) were designed using MassARRAY Assay Design Suite. With 50 ng of DNA, polymerase chain reaction was performed, amplified DNA fragments were treated with shrimp alkaline phosphatase to dephosphorylate and remove the unincorporated dNTPs. iPLEX single base extension primers with extension enzyme and mass modified dideoxynucleotide terminators were added to the products, purified using a resin coated plate, transferred to a SpectroChip array and analyzed by Matrix assisted laser desorption/ionization- (MALDI)-time of flight (TOF) Mass spectrometry (MS). SPECTROTYPER software was used to analyze specific chromatogram peaks corresponding to the nucleotides.

Table 1. Details of primers used in the study.

SNP_ID 2nd-PCRP 1st-PCRP
rs312046 ACGTTGGATGCCATGGAAATGCAGAGAGAG ACGTTGGATGGGAAAATCCCTCTGGATGTG
rs10134871 ACGTTGGATGGGCTTTGTACATAGTAAATGG ACGTTGGATGCTGTCTGAGGAATTCAAGCC
rs259911 ACGTTGGATGAAATTGGGAGAAAGGATGGG ACGTTGGATGTTTGCGTTAACAGCAGGGTC
rs7325084 ACGTTGGATGGCTTGGGATATCGTCTGCTC ACGTTGGATGAACTCCCAGAGAAGAGAGAC
rs2382962 ACGTTGGATGCAGACACCCGAGAGATTTGC ACGTTGGATGGAAATACTTTTCCCATAACC
rs10751260 ACGTTGGATGGCACCAACATAGTAGTTGCT ACGTTGGATGGGTAACCAAATCACCACCTG
rs464690 ACGTTGGATGGATGGTATAGTCTTTTGTCC ACGTTGGATGTAAACCCAAGGAAGGATAAC
rs11171569 ACGTTGGATGGAGTAAGACTGTGGCTCAAA ACGTTGGATGAAACACATATAGATCTCAC
rs804854 ACGTTGGATGGCTCAAGAGAAAGGATGCAG ACGTTGGATGAGAGGCTCAGAGCTAAGAAC
rs7547448 ACGTTGGATGTTGCCTCATTCTAAATTCCC ACGTTGGATGGGATGATGGACTTAAAATA
rs866279 ACGTTGGATGTCCTTGTCCCCACTCTCTG ACGTTGGATGGCCGATAAAGATAGATATCC
rs1740317 ACGTTGGATGCTGCAGGTCATATAGGAAGC ACGTTGGATGCACCGTCAGTAAAAGCTTCC
rs274551 ACGTTGGATGTTCATGCTTTCCTCCCACTC ACGTTGGATGGCACAGCACAGAGAGATTAG
rs11047639 ACGTTGGATGTCTGTGACCACTGAAGTAGG ACGTTGGATGTGCCACTTCTAAGTGGAAGC
rs10936746 ACGTTGGATGCAAGCTATAAGCTTTAGACG ACGTTGGATGGTGTGTATATGCATGCAATG
rs8080886 ACGTTGGATGGTTCTTCCCAAAGTCATCTC ACGTTGGATGATGGTCACCATCCTCTGTTG
rs274547 ACGTTGGATGGGCACAGGCTCACTAAATTC ACGTTGGATGTGCCTTGGGAAATGAGAAAG
rs7002473 ACGTTGGATGAAGTAAAATTGATCCTCAG ACGTTGGATGGGGCAAGAGCAGAAGTAAAG
rs359498 ACGTTGGATGCAACTGGCAGGGCTAAATTG ACGTTGGATGCCAAAGATCAGCATCTCTCC
rs16878394 ACGTTGGATGTCAAAGAGACCATGGAGTAG ACGTTGGATGCCACATCATTCTATGTAGC
rs16925580 ACGTTGGATGTCCATCTGCTCTATATTGCC ACGTTGGATGTCTGTTTGCCGAATGTTGCC
rs6526393 ACGTTGGATGGGAGGGGCTCATTAATTGTG ACGTTGGATGACAGAGCCTAGACTCTCAAC
rs1766864 ACGTTGGATGGAACTTTGCTTGAACTAAC ACGTTGGATGCATAGTGTTGATCTACTATTG
rs34016742 ACGTTGGATGTACGCTGTGCTTCTCAAAGG ACGTTGGATGAGGTGAATGCTTGGTATTGG
rs2256917 ACGTTGGATGAACCAGAAGCCCTAAGACAG ACGTTGGATGTGCCCAATTGGTTCCTAAGC
rs1130674 ACGTTGGATGCACTCATCCCTGTCTTCCAC ACGTTGGATGCACCGCTCTCCAGGAATTTC
rs10112966 ACGTTGGATGTCTCATCGGGGTGGCTGTG ACGTTGGATGGCCTGGCCTCTTTTATCTTA
rs13149290 ACGTTGGATGTCTCTACTCAGACCCAGTTG ACGTTGGATGCATCTGTGGCATTTCAGTTC
rs1879370 ACGTTGGATGCAGCAGAGATCATGGAGTAG ACGTTGGATGTTCTCAAGAGTGAGCTCAGG
rs6596075 ACGTTGGATGAAAGGATGACCCTGTCACTG ACGTTGGATGGAAGAGCTCTGCCTTCAAAC
rs11654944 ACGTTGGATGTACACACAACTGGGATGAAC ACGTTGGATGTCCATCTTTATAATGTTTTC
rs274554 ACGTTGGATGCCCAAATTGGGCAAGGATTC ACGTTGGATGAATTGTGGAGGCTGTTGTGG
rs16993820 ACGTTGGATGTCATTACCCTAATAGTCCTC ACGTTGGATGACCATAACCACGTGAGGAAG
rs1000677 ACGTTGGATGACAGTGCTCCATCAACCTTC ACGTTGGATGGGATCAGAGGAAAGAGAACG
rs6559662 ACGTTGGATGTCCTTGTAGGCTGCTTTAGG ACGTTGGATGACGGTATGGAAGCGTATTTC
rs2382961 ACGTTGGATGGGCAGAGAAAACACGTCATC ACGTTGGATGCCCCGCTGTCATTTTTTAAC
rs16842190 ACGTTGGATGTAAAGGATGGGAGAGCTTGG ACGTTGGATGGTCACTTCTTCATTATCAAC
rs4649436 ACGTTGGATGGGCTTTTTCTACCCTAGCTG ACGTTGGATGTGTGGTTTCTCCATCTACTC
rs2861445 ACGTTGGATGAACACAAACGCCCAGAAGAG ACGTTGGATGTGGTCCTACCTCGGTTTTAC
rs750581 ACGTTGGATGCTACTCCCTTGCAGCAGAAG ACGTTGGATGTTGAACTCTGCAGGAGGAAG
rs274552 ACGTTGGATGTTTGAGGAGGAGGGAGAAGG ACGTTGGATGTCTGTGGGATACTAAGATAG
rs7751500 ACGTTGGATGAGACTTTCCTTATCCTCCCC ACGTTGGATGTGTTGAAAGCACTGGGTTAG
rs16842228 ACGTTGGATGGACTTACTTATCGTATCAC ACGTTGGATGAGCTTCTCTGTTACAGTGTG
rs11032376 ACGTTGGATGAGGTGAGGCAAGAAAGCTAC ACGTTGGATGGCATTAAAATGTTATTTATTTG
rs6699851 ACGTTGGATGGCTAGAATTCTTCCATGGAG ACGTTGGATGTCTCCATCTCAATGTCTGCC
rs133 ACGTTGGATGGACAGGAGAAGAGAGTGTTG ACGTTGGATGTGGGAAGCATGAGAACATGG
rs9864066 ACGTTGGATGCATGGTCAGTGATTGATTAG ACGTTGGATGGGAAGAAAGATCATGCTCTG
Open in a new tab

PCRP: Polymerase chain reaction primers.

Twenty SNPs previously identified using Affymetrix 250K NSP array from 48 healthy subjects in a previous study of the institute were used as control for data analysis. Association studies were performed between the following groups: A) Steroid treated (54 TA and 47 Dex) and healthy controls (n=48); B) SR and NR; C) Phenotype correlation: influence of time, severity [high-SR (IOP≥31 mm Hg) and mild/moderate-SR (IOP≤30 mm Hg)], gender on IOP rise.

Statistical Analysis

Clinical parameter correlation was performed using statistical package for the social sciences (SPSS) purchased from IBM, version 14. Hardy-Weinberg equilibrium (HWE) test was performed using Chi-square (χ2) analysis (α=0.05, df=2). Univariate logistic regression was performed for the reported risk factors of SI-OHT such as diabetes mellitus, connective-tissue disorders, and myopia along with age and sex criteria. Genotypic proportions were calculated using SNPSTATS (http://bioinfo.iconcologia.net/SNPstats) fisher exact test. P-value with odds ratio at 95% confidence interval (CI) was calculated. P≤0.05 was considered to be statistically significant.

Functional Analysis

Functional annotation of significant SNPs, was performed using dbSNP, regulomeDB, variant effect predictor (VEP) and polymiRTS databases.

RESULTS

Subjects

Clinical characteristics of our TA and Dex administered study cohort are represented in Table 2. Steroids were predominantly administered among male (>70%) population (TA: 46 male, 8 female and Dex: 33 male, 14 females) of age greater than 50y (TA: 54.59±9.82y and Dex: 56.76±7.82y) in our study cohort. TA was administered to twenty-one macular edema (ME), fourteen RVO, and nineteen CME subjects. And, Dex was administered to twenty-seven ME, fifteen RVO, and five CME subjects. SR (n=27) and NR (IOP≤20 mm Hg; n=27) were distributed equally (50%) under TA treated group. NR patients were seen at a higher percentage (74%; n=35) compared to SR patients (26%; n=12) among Dex treated group. No significant difference [P=0.87 (TA) and 0.19 (Dex)] among age distribution was observed between SR and NR of both the steroid treatment groups, respectively. Males had higher SI-OHT among TA (85%) and Dex (83%) treatment groups, respectively. In SR category, IOP rise was mostly observed between day 1 and 1wk (45%) after TA treatment and between 1 and 2mo (83%) post Dex administration, respectively. The change (Δ) in IOP measurements was significantly (P=0.001) higher in SR than NR for both the steroid administered groups; that ranged from 10-60 mm Hg and 10-40 mm Hg for TA and Dex administrations, respectively. In our study cohort, all SR patients responded well to AGM usage and no surgical intervention was required. Logistic regression analysis for multiple covariates of age, sex, diabetes mellitus, and myopia factors did not show any significant difference (Table 2) on comparison between SR and NR for both the steroid treatment groups.

Table 2. Demographics of TA and Dex administered study population.

Parameters TA Dex
Steroid responsiveness SR NR SR NR
No. of patients 27 27 12 35
Age (y) 54.59±9.16 55.03±10.61 54.16 ±11.83 57.65±6.01
Sex
 Male 23 (85.18%) 23 (85.18%) 10 (83.33%) 23 (65.71%)
 Female 4 (14.81%) 4 (14.81%) 2 (16.66%) 12 (34.28%)
ΔIOP (mm Hg)a 20.07±10.98 2.96±2.48 15.83±7.48 2.88±2.12
Time of IOP rise among SR
 Day 1 12 (45%) 0
 Month 1 6 (22%) 10 (83%)
 Month 3 6 (22%) 2 (17%)
 Month 6 3 (11%) 0
Magnitude of ΔIOP rise among SR
 <10 mm Hg 4 (15%) 2 (17%)
 11-20 mm Hg 12 (44%) 8 (67%)
 21-30 mm Hg 8 (30%) 1 (8%)
 31-40 mm Hg 1 (4%) 1 (8%)
 >41 mm Hg 2 (7%) 0
Risk factor analysis OR (95%CI) P OR (95%CI) P
 Age 0.99 (0.09-1.05) 0.867 0.95 (0.88-1.76) 0.22
 Sex 2.42 (0.63-9.29) 0.198 1.59 (0.36-6.98) 0.87
 DM 2.2 (0.63-7.74) 0.22 0.39 (0.09-1.76) 0.22
 Hypertension systemic 2.97 (0.97-9.12) 0.06 1.12 (0.3-4.15) 0.87
 Myopia 0.5 (0.13-1.95) 0.32 1.4 (0.29-6.68) 0.67
 Hypercholesterolemia 0.3 (0.08-1.1) 0.07 1.31 (0.35-4.93) 0.69
Open in a new tab

TA: Triamcinolone-acetonide; Dex: Dexamethasone; IOP: Intraocular pressure; SR: Steroid responder; NR: Steroid non-responder; OR: Odds ratio; CI: Confidence interval; DM: Diabetes mellitus. Data are represented as mean±SD or n (%). aP=0.001 (SR vs NR).

SNP Genotyping

A single SNP (rs1799919) that failed to pass the quality threshold was excluded from genotyping panel. SNPs at 7 loci (rs750581, rs6699851, rs6526393, rs2256917, rs1766864, rs16878394, rs4649436), without any minor alleles are represented in Tables 3–6. Power of the study was 0.913 (TA) and 0.895 (Dex) for the treatment groups, respectively.

Table 3. Distribution of 20 SNPs between steroid treated and healthy control subjects in association with SI-OHT.

SNO rs ID Genotype Steroid treated group
 Control
 OR (95%CI) P
A-B AA AB BB AA AB BB
TA
 1 rs9864066 A-C 40 14 0 37 13 0 1 (0.41-2.40) 1.000
 2 rs133 G-T 21 23 10 2 27 21 0.07 (0.01-0.30) 0.000a
 3 rs34016742 T-C 50 4 0 0 3 47 0.000a
 4 rs11047639 G-T 42 12 0 35 15 0 0.67 (0.28-0.61) 0.665
 5 rs11032376 A-G 45 7 2 39 10 1 0.71 (0.27-1.89) 0.566
 6 rs274554 C-T 38 16 0 4 13 33 0.04 (0.01-0.12) 0.000a
 7 rs274547 T-A 41 13 0 4 13 33 0.03 (0.01-0.09) 0.000a
 8 rs6596075 C-G 38 16 0 33 13 4 0.82 (0.36-1.87) 0.105
 9 rs1879370 A-T 39 14 1 43 7 0 2.36 (0.87-6.40) 0.185
 10 rs16842228 G-T 52 2 0 44 5 1 0.28 (0.05-1.47) 0.246
 11 rs10936746 G-A 42 9 2 1 5 43 0.01 (0.00-0.04) 0.000a
 12 rs804854 T-A 49 5 0 2 9 39 0.00 (0.00-0.02) 0.000a
 13 rs7751500 T-G 48 6 0 3 9 38 0.01 (0.00-0.03) 0.000a
 14 rs13149290 T-C 9 38 7 8 26 16 0.95 (0.34-2.70) 0.058
 15 rs359498 C-T 46 7 1 3 4 43 0.01 (0.00-0.04) 0.000a
 16 rs11171569 C-G 35 17 2 32 16 2 0.97 (0.43-2.16) 0.995
 17 rs6559662 C-T 53 1 0 46 2 2 0.22 (0.02-2.01) 0.262
 18 rs7547448 T-C 52 1 0 1 0 48 0.00 (0.00-0.01) 0.000a
 19 rs1000677 A-G 45 7 2 39 10 1 0.71 (0.27-1.89) 0.566
 20 rs274552 C-G 38 16 0 33 15 2 0.82 (0.37-1.87) 0.327
Dex
 1 rs9864066 A-C 35 12 0 37 13 0 0.98 (0.39-2.43) 0.999
 2 rs133 G-T 21 14 12 2 27 21 0.05 (0.01-0.24) 0.000a
 3 rs34016742 T-C 46 1 0 0 3 47 0.000a
 4 rs11047639 G-T 36 10 1 35 15 0 0.71 (0.29-1.77) 0.382
 5 rs11032376 A-G 33 13 1 39 10 1 1.50 (0.60-3.76) 0.671
 6 rs274554 C-T 26 21 0 4 13 33 0.07 (0.02-0.23) 0.000a
 7 rs274547 T-A 27 20 0 4 13 33 0.06 (0.02-0.21) 0.000a
 8 rs6596075 C-G 26 21 0 33 13 4 1.57 (0.69-3.56) 0.036a
 9 rs1879370 A-T 40 6 1 43 7 0 1.08 (0.35-3.34) 0.579
 10 rs16842228 G-T 42 4 0 44 5 1 0.70 (0.18-2.65) 0.609
 11 rs10936746 G-A 37 9 1 1 5 43 0.01 (0.00-0.05) 0.000a
 12 rs804854 T-A 37 10 0 2 9 39 0.01 (0.00-0.05) 0.000a
 13 rs7751500 T-G 37 10 0 3 9 38 0.02 (0.00-0.07) 0.000a
 14 rs13149290 T-C 16 20 11 8 26 16 0.37 (0.14-0.97) 0.117
 15 rs359498 C-T 38 8 1 3 4 43 0.02 (0.00-0.06) 0.000a
 16 rs11171569 C-G 28 17 2 32 16 2 1.21 (0.53-2.74) 0.903
 17 rs6559662 C-T 45 2 0 46 2 2 0.51 (0.09-2.93) 0.383
 18 rs7547448 T-C 44 2 1 1 0 48 0.00 (0.00-0.01) 0.000a
 19 rs1000677 A-G 32 14 1 39 10 1 1.66 (0.67-4.12) 0.531
 20 rs274552 C-G 26 21 0 33 15 2 1.57 (0.69-3.56) 0.154
Open in a new tab

OR: Odds ratio; CI: Confidence interval; SI-OHT: Steroid induced ocular hypertension. aP values are significant.

Table 6. Distribution of significant SNPs involved in larger phenotype (IOP).

Parameters (A, B) Rs ID Genotype Group A
 Group B
 OR (95%CI) P
AA AB BB AA AB BB
TA SR: immediate (A) vs others (B) rs11171569 C-G 9 2 0 5 10 1 0.10 (0.016-0.650) 0.034
TA-SR: high-SR (A) vs moderate SR (B) rs133 G-T 8 5 0 3 6 4 0.18 (0.034-1.03) 0.042
Male: TA-SR (A) vs TA-NR (B) rs11047639 G-T 20 2 0 11 8 0 0.14 (0.02-0.76) 0.049
rs1879370 A-T 11 10 0 17 1 0 15.45 (1.72-138.23) 0.014
Open in a new tab

OR: Odds ratio; CI: Confidence interval; SR: Steroid responders; NR: Steroid non-responders; TA: Triamcinolone-acetonide; Dex: Dexamethasone.

Group A

Table 3 denotes the genotypic distribution of 20 SNPs available from a previous study in the institute; healthy reference control group (n=48), compared with steroid [TA (n=54), Dex (n=47)] treated cohort. Ten SNPs (rs133, rs34016742, rs274554, rs274547, rs10936746, rs804854, rs359498, rs7751500, rs7547448, and rs6596075) showed statistically significant (P<0.05) difference in distribution between steroid treated population and controls. Frequency of wild-type homozygous genotype of rs133, rs34016742, rs274554, rs10936746, rs274547, rs804854, rs7751500, rs359498, rs7547448 varied significantly in both steroid treated groups, even after Bonferroni correction (P<0.0025). Additionally, heterozygous genotype of rs6596075 was significantly higher (P<0.05) in Dex treated group than in controls; however, its significance was lost upon Bonferroni correction (P>0.0025).

SR vs NR (Group B)

Table 4 summarizes the genotypic distribution of 20 SNPs between SR and NR of steroid treatment groups in association with SI-OHT. Two SNPs (rs1879370 and rs6559662) were observed to be significantly different between SR and NR of TA and Dex administered groups, respectively. Higher frequency of heterozygous genotype (AT) of rs1879370 was observed among TA-SR compared to TA-NR, P=0.04; OR 5.62 [1.34-23.56 (95%CI)]. Similarly, higher frequency of heterozygous genotype (CT) of rs6559662 (P=0.048) was observed among Dex-SR compared to Dex-NR. However, significance of rs1879370 and rs6559662 was lost after Bonferroni correlation corrections (P>0.0025).

Table 4. Distribution of 20 SNP between SR and NR subjects in association with SI-OHT.

SNO rs ID Genotype
A-B		 SR
 NR
 OR (95%CI) P
AA AB BB AA AB BB
TA
1 rs9864066 A-C 20 7 0 20 7 0 1.00 (0.30-3.38) 1.00
2 rs133 G-T 12 11 4 9 12 6 0.73 (0.21-1.88) 0.65
3 rs34016742 T-C 24 3 0 26 1 0 3.25 (0.32-33.41) 0.58
4 rs11047639 G-T 24 3 0 18 9 0 0.25 (0.06-1.06) 0.15
5 rs11032376 A-G 22 4 1 23 3 1 1.31 (0.31-5.51) 0.92
6 rs274554 C-T 21 6 0 17 10 0 0.49 (0.15-1.61) 0.49
7 rs274547 T-A 20 7 0 21 6 0 1.23 (0.35-4.28) 0.95
8 rs6596075 C-G 21 6 0 17 10 0 0.49 (0.15-1.61) 0.49
9 rs1879370 A-T 15 11 0 23 3 0 5.62 (1.34-23.56) 0.04a
10 rs16842228 G-T 25 2 0 27 0 0 0.35
11 rs10936746 G-A 21 4 1 21 5 1 0.83 (0.22-3.16) 0.95
12 rs804854 T-A 24 3 0 25 2 0 1.56 (0.24-10.19) 0.90
13 rs7751500 T-G 23 4 0 25 2 0 2.17 (0.36-13.01) 0.69
14 rs13149290 T-C 3 19 5 6 19 2 2.29 (0.51-10.29) 0.32
15 rs359498 C-T 23 4 0 23 3 1 1.00 (0.22-4.49) 0.56
16 rs11171569 C-G 14 12 1 21 5 1 3.25 (1.00-10.58) 0.12
17 rs6559662 C-T 26 1 0 27 0 0 0.60
18 rs7547448 T-C 25 1 0 27 0 0 0.59
19 rs1000677 A-G 22 4 1 23 3 1 1.31 (0.31-5.51) 0.92
20 rs274552 C-G 21 6 0 17 10 0 0.49 (0.15-1.61) 0.49
Dex
1 rs9864066 A-C 8 4 0 27 8 0 1.69 (0.40-7.10) 0.773
2 rs133 G-T 8 2 2 13 12 10 0.30 (2.22-1.18) 0.205
3 rs34016742 T-C 12 0 0 34 1 0 0.839
4 rs11047639 G-T 8 4 0 28 6 1 2.00 (0.40-8.60) 0.438
5 rs11032376 A-G 7 5 0 26 8 1 2.06 (0.50-8.16) 0.405
6 rs274554 C-T 8 4 0 18 17 0 0.53 (0.40-2.09) 0.657
7 rs274547 T-A 8 4 0 19 16 0 0.59 (0.40-2.34) 0.756
8 rs6596075 C-G 8 4 0 18 17 0 0.53 (0.40-2.09) 0.657
9 rs1879370 A-T 10 2 0 30 4 1 1.20 (0.20-7.18) 0.763
10 rs16842228 G-T 11 1 0 31 3 0 0.94 (0.10-10.00) 0.999
11 rs10936746 G-A 8 4 0 29 5 1 2.42 (0.40-10.70) 0.311
12 rs804854 T-A 8 4 0 29 6 0 2.42 (0.40-10.70) 0.497
13 rs7751500 T-G 8 4 0 29 6 0 2.42 (0.40-10.70) 0.497
14 rs13149290 T-C 5 4 3 11 16 8 0.64 (3.43-2.48) 0.735
15 rs359498 C-T 10 2 0 28 6 1 0.80 (0.20-4.51) 0.837
16 rs11171569 C-G 8 4 0 20 13 2 0.67 (0.40-2.63) 0.651
17 rs6559662 C-T 10 2 0 35 0 0 0.048a
18 rs7547448 T-C 12 0 0 32 2 1 0.577
19 rs1000677 A-G 7 5 0 25 9 1 1.79 (0.50-6.97) 0.514
20 rs274552 C-G 8 4 0 18 17 0 0.53 (0.40-2.09) 0.657
Open in a new tab

OR: Odds ratio; CI: Confidence interval; SI-OHT: Steroid induced ocular hypertension; TA: Triamcinolone-acetonide; Dex: Dexamethasone. aP values are statistically significant.

Distribution of the remaining 20 SNPs (without control population comparison) analyzed within steroid treated SR and NR cohort did not show any statistically significant difference after Bonferroni correction (P>0.0025; Table 5).

Table 5. Distribution of remaining 20 SNP between SR and NR subjects associated with steroid-induced ocular hypertension.

SNO rs ID Genotype Total
 Steroid responders
 Steroid non-responders
 OR (95%CI) P
AA AB BB AA AB BB AA AB BB
TA
1 rs10112966 T-C 13 22 19 7 10 10 6 12 9 0.82 (0.23-2.85) 0.856
2 rs10134871 T-C 10 44 0 5 22 0 5 22 0 1.00 (0.25-3.95) 1.000
3 rs10751260 C-G 41 13 0 24 3 0 17 10 0 0.084
4 rs1130674 A-G 38 16 0 19 8 0 19 8 0 1.00 (0.31-3.22) 1.000
5 rs16925580 C-G 53 1 0 26 1 0 27 0 0 0.601
6 rs1740317 A-G 53 1 0 26 1 0 27 0 0 0.601
7 rs2382962 A-G 33 17 4 16 10 1 17 7 3 1.17 (0.39-3.49) 0.458
8 rs259911 G-T 45 8 1 20 6 1 25 2 0 4.38 (0.82-23.43) 0.169
9 rs274551 C-T 40 14 1 20 7 0 20 7 0 1.00 (0.30-3.38) 1.000
10 rs312046 C-T 51 3 0 26 1 0 25 2 0 0.48 (0.04-5.64) 0.838
11 rs464690 T-C 53 1 0 26 1 0 27 0 0 0.601
12 rs7002473 G-A 38 16 0 20 7 0 18 9 0 0.70 (0.22-2.27) 0.837
13 rs7325084 A-G 27 23 4 14 11 2 13 12 2 0.86 (0.30-2.51) 0.961
14 rs8080886 A-G 45 7 1 23 2 1 22 5 0 0.57 (0.12-2.69) 0.318
15 rs866279 A-G 42 12 0 20 7 0 22 5 0 1.54 (0.42-5.64) 0.807
16 rs11654944 C-G 44 10 0 23 4 0 21 6 0 0.61 (0.15-2.46) 0.782
17 rs16842190 G-A 52 2 0 25 2 0 27 0 0 0.354
18 rs16993820 A-G 53 0 1 26 0 1 27 0 0 0.601
19 rs2382961 T-A 7 18 29 1 13 13 6 5 16 7.43 (0.83-66.63) 0.024
20 rs2861445 G-C 10 44 0 4 23 0 6 21 0 1.64 (0.41-6.64) 0.782
Dex
1 rs10112966 T-C 10 17 20 0 5 7 10 12 13 0.105
2 rs10134871 T-C 2 5 40 1 1 10 1 4 30 0.32 (0.02-5.62) 0.699
3 rs10751260 C-G 35 12 0 8 4 0 27 8 0 0.773
4 rs1130674 A-G 38 8 1 11 1 0 27 7 1 0.35 (0.04-3.19) 0.629
5 rs1740317 A-G 45 1 1 12 0 0 33 1 1 0.699
6 rs2382962 A-G 31 10 6 10 2 0 21 8 6 0.30 (0.06-1.58) 0.228
7 rs259911 G-T 38 9 0 9 3 0 29 6 0 1.61 (0.33-7.78) 0.837
8 rs274551 C-T 27 20 0 8 4 0 19 16 0 0.59 (0.15-2.34) 0.756
9 rs312046 C-T 44 3 0 12 0 0 32 3 0 0.577
10 rs464690 T-C 1 46 0 1 11 0 0 35 0 0.225
11 rs7002473 G-A 20 27 0 4 8 0 16 19 0 1.68 (0.43-6.64) 0.756
12 rs7325084 A-G 23 21 3 7 4 1 16 17 2 0.60 (0.16-2.27) 0.653
13 rs8080886 A-G 43 4 0 10 2 0 33 2 0 3.30 (0.41-26.51) 0.502
14 rs866279 A-G 37 10 0 10 2 0 27 8 0 0.68 (0.12-3.74) 0.903
15 rs11654944 C-G 37 8 1 11 1 0 26 7 1 0.30 (0.03-2.65) 0.503
16 rs16842190 G-A 5 41 1 1 11 0 4 30 1 1.42 (0.14-14.11) 0.795
17 rs16993820 A-G 44 1 1 12 0 0 32 1 1 0.691
18 rs2382961 T-A 6 11 29 0 3 9 6 8 20 0.287
19 rs2861445 G-C 16 30 1 5 7 0 11 23 1 0.64 (0.17-2.48) 0.707
20 rs4649436 A-G 45 1 1 12 0 0 33 1 1 0.699
Open in a new tab

OR: Odds ratio; CI: Confidence interval; TA: Triamcinolone-acetonide; Dex: Dexamethasone.

Association of SNPs with Elevated IOP (Group C)

Analysis of 20 SNPs for its influence in time of IOP rise, magnitude or severity of IOP rise and gender distribution with the respective genotypic P-values are presented in Table 6. None of these 20 SNPs were observed to be associated with IOP rise among Dex treated cohort (P>0.05).

Time of IOP rise: High frequency of CG genotype of rs11171569 among TA-SR showed an immediate rise in IOP [P=0.034; OR 0.10 (0.02-0.65; 95%CI)] when compared to TA-SR, who had IOP rise from 1 to 6mo post steroid administration. Degree of IOP rise: GT genotype of rs133 varied significantly (P=0.042) between high-SR and moderate-SR of TA treatments with OR 0.18 [0.03-1.03 (95%CI)]. SNPs rs11047639 and rs1879370 were significantly different (P<0.05) among the male gender of TA-SR compared with TA-NR groups. Males with high frequency of GT genotype (rs11047639) was observed in TA-SR group [P=0.049, OR 0.14 (0.02-0.76, 95%CI)] compared to TA-NR group. Similarly, higher frequency of AT genotype (rs1879370) was observed in TA-SR group [P=0.014; OR 15.45 (1.72-138.2, 95%CI)] compared to TA-NR group. Significance of all these SNPs (rs11171569, rs133, rs11047639, and rs1879370) associated with larger phenotype (IOP) was lost after Bonferroni corrections (P>0.0025).

Genotypic frequency P-values of the remaining SNPs involved in elevation of IOP are listed in Table 7. Distribution of the SNPs in general cohorts are provided in Table 8.

Table 7. P values of SNPs in association with larger phenotype (IOP).

SNO rsID 1mo vs others High-SR vs mild-SR Male-SR vs male-NR
TA
1 rs10936746 0.65 0.527 0.808
2 rs11047639 0.63 0.162 0.049a
3 rs11171569 0.03a 0.617 0.256
4 rs274547 0.59 0.858 0.740
5 rs34016742 0.63 0.793 0.666
6 rs359498 0.20 0.604 0.547
7 rs7547448 0.44 0.595 0.642
8 rs804854 0.63 0.793 0.994
9 rs1000677 0.52 0.653 0.269
10 rs11032376 0.52 0.374 0.269
11 rs13149290 0.52 0.106 0.231
12 rs133 0.25 0.029a 0.956
13 rs16842228 0.96 0.313 0.403
14 rs1879370 0.67 0.255 0.014a
15 rs274552 0.87 0.995 0.806
16 rs274554 0.87 0.995 0.806
17 rs6559662 0.70 0.617 0.642
18 rs6596075 0.87 0.995 0.806
19 rs7751500 0.32 0.508 0.896
20 rs9864066 0.75 0.484 0.992
Dex
1 rs10936746 0.91 0.911 0.193
2 rs11047639 0.91 0.687 0.329
3 rs11171569 0.69 0.687 0.580
4 rs274547 0.91 0.911 0.635
5 rs34016742 0.00 0.799
6 rs359498 0.55 0.549 0.546
7 rs7547448 0.00 0.629
8 rs804854 0.91 0.911 0.379
9 rs1000677 0.71 0.710 0.139
10 rs11032376 0.71 0.710 0.068
11 rs13149290 0.36 0.130
12 rs133 0.52 0.519 0.101
13 rs16842228 0.76 0.761 0.970
14 rs1879370 0.55 0.861 0.546
15 rs274552 0.91 0.911 0.501
16 rs274554 0.81 0.911 0.806
17 rs6559662 0.86 0.861 0.086
18 rs6596075 0.51 0.911 0.501
19 rs7751500 0.91 0.911 0.379
20 rs9864066 0.91 0.911 0.557
Open in a new tab

TA: Triamcinolone-acetonide; Dex: Dexamethasone. aP values are significant.

Table 8. Distribution of SNP in general population.

rs ID Minor allele frequency
TOPMED PAGE GnomAD 1000 G Estonian ALSPAC TWINSUK Northern Sweden Vietnamese
rs10936746 0.19482 0.2176 0.146 0.31 0.267 0.267 0.29 0.06
rs11047639 0.2209 0.2213 0.159 0.244 0.275 0.289 0.26 0.06
rs11171569 0.23355 0.2347 0.254 0.273 0.23 0.219 0.23 0.46
rs274547 0.25563 0.2459 0.256 0.146 0.151 0.172 0.16 0.11
rs34016742 0.02499 0.0222 0.023 0.013 0.017 0.017 0.01 0.01
rs359498 0.0776 0.0713 0.103 0.001 0.003 0.003 0.01
rs7547448 0.09616 0.0854 0.089 0.012 0.012 0.011 0.01
rs804854 0.09991 0.0978 0.070 0.117 0.145 0.138 0.18 0.00
rs1000677 0.1603 0.1501 0.209 0.112 0.082 0.073 0.07 0.36
rs11032376 0.12133 0.1181 0.163 0.11 0.082 0.073 0.06 0.32
rs13149290 0.28861 0.3878 0.2613 0.43 0.209 0.225 0.221 0.23 0.23
rs133 0.26510 0.2561 0.289 0.278 0.284 0.287 0.29 0.35
rs16842228 0.07777 0.0713 0.067 0.043 0.052 0.057 0.07 0.01
rs1879370 0.1872 0.2089 0.141 0.301 0.237 0.232 0.26 0.02
rs274552 0.25188 0.2431 0.252 0.146 0.151 0.172 0.16
rs274554 0.25533 0.254 0.146 0.151 0.171 0.16 0.11
rs6559662 0.10300 0.1376 0.0893 0.092 0.023 0.038 0.034 0.03 0
rs6596075 0.25808 0.3186 0.2482 0.258 0.147 0.151 0.172 0.16 0.11
rs7751500 0.15404 0.1463 0.1456 0.12 0.115 0.145 0.139 0.18 0.00
rs9864066 0.18228 0.1778 0.124 0.208 0.285 0.261 0.27 0.01
Open in a new tab

DISCUSSION

SI-OHT is of prime concern among ophthalmologists, as it leads to irreversible blindness in 20%-40% of steroid administered patients[6]. Pharamcogenetic studies are of importance in understanding this varying steroid response[13] and no such SI-OHT association studies are available in an Indian population. Hence, we aimed to validate the SNPs identified in Caucasian cohort, involved in TA and Dex induced OHT, in an Indian population. From the clinical characteristics of our study cohort (Table 2), it was observed that ocular edematous and inflammatory conditions mostly occurred among male subjects (70%) of age 50y, for whom steroids were administered[16]–[17]. Male population (80%) had higher SI-OHT prevalence in our cohort, which is in par with previous reports[18]. Immediate (1d/1wk) and severe (40-60 mm Hg) IOP rise among TA-SR patients, in contrary to the delayed (1-2mo) and less severe (30-40 mm Hg) IOP rise among Dex-SR treated cohort observed in this study might be attributed to the difference in drug characteristics or formulations. Crystalline nature of TA that is available in suspension form may result in a burst release of drug, clogging TM layer and blocking AH outflow[19]–[20]. Immediate IOP rise on day 1 may be misleading in categorizing patients as SR; which might be due to result of injection procedures[21]. However, our study cohort was carefully chosen wherein, patients having IOP rise on day 1 to 1wk, underwent through evaluation by clinicians, were monitored regularly and used AGM for more than 30d to control IOP rise. This cohort was then considered as SR group. Delayed (1-2mo) IOP rise among Dex-SR can be attributed to the sustained delivery system of Dex implant (Ozurdex)[22]–[23]. This varying time of IOP rise between two currently used steroids, necessitates careful IOP monitoring, at least for a minimum period of 3mo post steroid administration, as the ignored OHT may lead to irreversible glaucoma. Since, no significant association (P>0.05) was identified among the predicted risk factor for SI-OHT by univariate logistic regression test[24], these factors were not considered as confounding parameters for further analysis. Additionally, this may suggest the probable role of genetic factors in regulating the phenotype alteration (IOP) upon steroid administration.

We performed a replication study for the 48 SNPs identified in Caucasian cohort associated with TA-OHT, unlike the previous studies that validated only the targeted SNPs for few genes[9]–[12]. From the clinical parameters, it was observed that time and magnitude of IOP rise and male gender had predominantly influenced SI-OHT in both the steroid treated groups. Hence, we performed an association study of these factors with SI-OHT. Nine SNPs were identified to be different in distribution between steroid treated patients from the reference control cohort in our study (Table 3). This indicates that these SNPs may be associated with the occurrence of ocular edematous and inflammatory conditions of DME, RVO and CME.

rs133 is present at the chromosome position of 7:24913359 of oxysterol binding protein like 3 (OSBPL3) gene. This gene is involved in synthesis of bile salts and acids. In the current study, rs133 was associated with severe OHT (IOP >31 mm Hg) among TA-SR group. VEP tool which determines the effect of variants reports a modifier impact for this variant (100% intron variant activity). OSBPL3 has less likely effect on the binding of MYC associated Zinc finger (MAZ) protein. dbSNP database reports that MAZ is expressed in retina, choroid, sclera, retinal pigment epithelial cells. MAZ controls the loop formation of lens fiber generation and its gene expression[25]. MAZ has been suspected to be involved in neurodegeneration and was reported to predict the onset of glaucoma[26]. OSBPL3 is also informed as a risk factor of myopia in an US based study[27]. Since association of myopia is suggested risk factor for SI-OHT occurrence[28] and we also found myopia is significantly associated (P=0.042) with severity of IOP rise in our SR (n=27) patient cohort, we predict that the presence of this SNP may indicate severe IOP rise following TA administration. No regulatory effects and miRNA interactions has been reported till date by polymiRTS database.

In our study on 101 Indian subjects, except rs133 we couldn't associate remaining 8 SNPs with SI-OHT or glaucoma (Tables 4, 5; P>0.05), which might be attributed to the smaller cohort size and the difference in ethnicity. rs34016742 present at the chromosome position of 3:185753143 in insulin like growth factor binding protein 2 (IGF2BP2) gene is associated with diabetes signaling. Diabetes is involved in ME and RVO progression[29]–[30]. Diabetes is also a risk factor for glaucoma progression and SI-OHT[31]. Except rs34016742 (IGF2BP2), none of the other SNPs (rs274554, rs274547, rs359498 rs10936746, rs808548, rs7751500, rs7547448) with in their genes possess any correlation with the occurrence of ocular edematous conditions or any of its driving factors. rs274554 (chromosome position-5:132389258) and rs274547 (chromosome position-5:132395612) in solute carrier family 22 member 5 (SLC22A5) gene is involved in carnitine dysfunction. rs359498 (chromosome position-4:161937830) is present in Follistatin like 5 gene (FSTL5), which aids in calcium ion binding activity. The disease association of SNP rs10936746 at (chromosome position 3:173256741) LOC105374224 is not known. SNPs rs808548, rs7751500, and rs7547448 has no gene component or functional pathway associations according to dbSNP database.

Role of the remaining SNPs which were not significantly differed between steroid treated and control population but that were associated with SI-OHT (Table 4) or elevated IOP (Table 6) are discussed in Table 9.

Table 9. SNPs involved in steroid-induced ocular hypertension.

SNP Intron position Variant description Genes and pathway affected Functional analysis Ocular and systemic associations
rs1879370 associated with TA-OHT and male gender of TA-SR 3:173284335 None None VEP: 33% regulatory region variant, 33% intronic variant effect and 33% non-coding transcript variant effect. PolymiRTS: no regualtory and miRNA interactions. RegulomeDB (5): minimal binding evidence None
rs6559662 associated with Dex-OHT 9:69637580 3-intron variant and 1-geneic upstream variant Amyloid beta precursor protein family 1 (APBA1 gene) involved in brain functioning VEP: 50% regulatory region variant and 50% intronic variant activity. RegulomeDB: nil. PolymiRTS: No regulatory effects and miRNA interactions Expressed highly in brain phenotype correlation involves the occurrence of cognitive disease (dbSNP)
rs11171569 associated with immediate IOP rise among TA-SR 12:55573234 1-upstream transcript variant Olfactory receptor family 2 subfamily AP member 1 gene (OR2AP1) associated with smelling capability VEP: 33% non-coding transcript variant, 50% intron variant, 17% upstream variant activity. RegulomeDB (6): minimal binding activity. PolymiRTS: no regualtory and miRNA interactions Detection of chemical stimulus involved in sensory perception of smell (dbSNP)
rs11047639 associated with male gender of TA-SR LOC52825W 12:24798554 Intergenic: present between ribosomal protein L21 and branched chain amino acid None 100% intergenic variant, regulome (2b). Likely to affect binding None
Open in a new tab

SNP: Single nucleotide polymorphism; VEP: Variant effect predictor; TA: Triamcinolone-acetonide; Dex: Dexamethasone; IOP: Intraocular pressure.

rs6559662 is associated with Dex-OHT and is involved in neurological disorder, Alzheimer's disease (AD; Table 9). This made us to lay interest on APBAI gene, as glaucoma and AD share common feature of age-related neurodegeneration (irreversible loss of neurons). AD patients possess higher risk for glaucoma but their association is controversial[32]–[34]. Amyloid beta (AB) protein is an early stage definitive diagnostic marker for AD[35]. It has also been suggested that Amyloid precursor protein (APP) and AB accumulation in retinal ganglion cells (RGC), ONH, retinal nerve fibre and dural complex, alters the metabolism of APP elimination and RGC's loss that has a secondary direct influence on IOP rise in mouse OHT models[36]. Brimonidine (neuro-protective AGM) that is used as secondary treatment for AD, reduced AB proteins in mouse retina. AB proteins largely secreted in eye fluid could serve as a therapeutic target for stress-related glaucoma[37]. AB proteins are better biomarker for AD's early detection than assays using cerebrospinal fluid (easy, minimal invasive and inexpensive procedure)[38]–[39]. In this similar fashion, presence of CC genotype of rs6559662 in AB gene among Dex treated patients can acts as an indicator for Dex-OHT.

SNPs involved in OHT progression varied between TA and Dex administered groups. This differential response of SNPs to TA and Dex induced OHT might be due to the difference in chemical structure and formulation of these steroids. Potential limitations of this study are the smaller cohort size and the details of smoking habit and alcohol consumption were missing for few patients. Even though smoking and alcohol consumption was not reported to influence SI-OHT[24], the stratification analysis for these factors would have been valuable.

In conclusion, SI-OHT was observed in fifty percentage of TA and twenty-six percentage of Dex administered patients. rs133 (myopia and neurodegeneration) is associated with severe IOP rise and rs34016742 (diabetes) is associated with the ocular edematous and inflammatory conditions, for which these intravitreal steroids were preferred. Myopia, neurodegeneration, and diabetes are the reported risk factors for SI-OHT progression. Further, GWAS are desirable to identify novel SNPs associated with SI-OHT progression.

Acknowledgments

Authors' contributions: Badrinarayanan L and Elchuri SV conceived the idea, performed the experiment and designed the study. Badrinarayanan L, Ramasubramanyan S and Elchuri SV performed formal analysis. Badrinarayanan L, Sripriya S did data interpretation. Badrinarayanan L, Lakshmi BS, Sripriya S, Chitipothu S and Elchuri SV did manuscript preparation and editing. Rishi P, Rishi E and George R performed sample collection and clinical cohort determinations. Chitipothu S and Elchuri SV aided in financial support of the work.

Foundations: Supported by equally the Department of Biotechnology under the grant (No.BT/PR3580/PID/6/625/2011) and Indian Council of Medical Research (ICMR) under grant [No.82/19/2012/PHGEN (TF)/BMS].

Conflicts of Interest: Badrinarayanan L, None; Chitipothu S, None; Ramasubramanyan S, None; Sripriya S, None; Rishi P, None; Rishi E, None; George R, None; Lakshmi BS, None; Elchuri SV, None.

REFERENCES

  • 1.Pacella F, Ferraresi AF, Turchetti P, Lenzi T, Giustolisi R, Bottone A, Fameli V, Romano MR, Pacella E. Intravitreal injection of ozurdex(®) implant in patients with persistent diabetic macular edema, with six-month follow-up. Ophthalmol Eye Dis. 2016;8:11–16. doi: 10.4137/OED.S38028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Ashraf M, Souka AA. Steroids in central retinal vein occlusion: is there a role in current treatment practice? J Ophthalmol. 2015;2015:594615. doi: 10.1155/2015/594615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chang YC, Wu WC. Elevation of intraocular pressure after intravitreal injection of triamcinolone acetonide in Taiwanese patients. Kaohsiung J Med Sci. 2008;24(2):72–77. doi: 10.1016/S1607-551X(08)70100-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Nurözler Tabakcı B, Ünlü N. Corticosteroid treatment in diabetic macular edema. Tjo. 2017;47(3):156–160. doi: 10.4274/tjo.56338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Srinivasan R, Sharma U, George R, Raman R, Sharma T, Sankara Nethralaya Vitreoretinal Study Group (SNVR Study Group) Intraocular pressure changes after dexamethasone implant in patients with glaucoma and steroid responders. Retina. 2019;39(1):157–162. doi: 10.1097/IAE.0000000000001924. [DOI] [PubMed] [Google Scholar]
  • 6.Fini ME, Schwartz SG, Gao X, Jeong S, Patel N, Itakura T, Price MO, Price FW, Jr, Varma R, Stamer WD. Steroid-induced ocular hypertension/glaucoma: Focus on pharmacogenomics and implications for precision medicine. Prog Retin Eye Res. 2017;56:58–83. doi: 10.1016/j.preteyeres.2016.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fingert JH, Clark AF, Craig JE, Alward WL, Snibson GR, McLaughlin M, Tuttle L, MacKey DA, Sheffield VC, Stone EM. Evaluation of the myocilin (MYOC) glaucoma gene in monkey and human steroid-induced ocular hypertension. Invest Ophthalmol Vis Sci. 2001;42(1):145–152. [PubMed] [Google Scholar]
  • 8.Sohn S, Hur W, Choi YR, Chung YS, Ki CS, Kee C. Little evidence for association of the glaucoma gene MYOC with open-angle glaucoma. Br J Ophthalmol. 2010;94(5):639–642. doi: 10.1136/bjo.2009.158261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Fingert JH, Alward WL, Wang K, Yorio T, Clark AF. Assessment of SNPs associated with the human glucocorticoid receptor in primary open-angle glaucoma and steroid responders. Mol Vis. 2010;16:596–601. [PMC free article] [PubMed] [Google Scholar]
  • 10.Hogewind BF, Micheal S, Bakker B, Hoyng CB, den Hollander AI. Analysis of single nucleotide polymorphisms in the SFRS3 and FKBP4 genes in corticosteroid-induced ocular hypertension. Ophthalmic Genet. 2012;33(4):221–224. doi: 10.3109/13816810.2012.716488. [DOI] [PubMed] [Google Scholar]
  • 11.Hogewind BF, Micheal S, Schoenmaker-Koller FE, Hoyng CB, den Hollander AI. Analyses of sequence variants in the MYOC gene and of single nucleotide polymorphisms in the NR3C1 and FKBP5 genes in corticosteroid-induced ocular hypertension. Ophthalmic Genet. 2015;36(4):299–302. doi: 10.3109/13816810.2013.879598. [DOI] [PubMed] [Google Scholar]
  • 12.Gerzenstein SM, Pletcher MT, Cervino AC, Tsinoremas NF, Young B, Puliafito CA, Fini ME, Schwartz SG. Glucocorticoid receptor polymorphisms and intraocular pressure response to intravitreal triamcinolone acetonide. Ophthalmic Genet. 2008;29(4):166–170. doi: 10.1080/13816810802320217. [DOI] [PubMed] [Google Scholar]
  • 13.Gerzenstein SM. Pharmacogenomics of the intraocular pressure response to glucocorticoids. Doctorate of philosopahy University of Miami, Unites states of America. 2009;2008-11-21:285. [Google Scholar]
  • 14.Choi W, Park SE, Kang HG, et al. Intraocular pressure change after injection of intravitreal dexamethasone (Ozurdex) implant in Korean patients. Br J Ophthalmol. 2019;103(10):1380–1387. doi: 10.1136/bjophthalmol-2018-312958. [DOI] [PubMed] [Google Scholar]
  • 15.Chin EK, Almeida DRP, Velez G, Xu KY, Peraire M, Corbella M, Elshatory YM, Kwon YH, Gehrs KM, Boldt HC, Sohn EH, Russell SR, Folk JC, Mahajan VB. Ocular hypertension after intravitreal dexamethasone (ozurdex) sustained-release implant. Retina. 2017;37(7):1345–1351. doi: 10.1097/IAE.0000000000001364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Rishi P, Rishi E, Uparkar M, Sharma T, Gopal L, Bhende P, Bhende M, Sen PR, Sen P. Coats' disease: an Indian perspective. Indian J Ophthalmol. 2010;58(2):119–124. doi: 10.4103/0301-4738.60081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Eze BI, Uche JN, Shiweobi JO. The burden and spectrum of vitreo-retinal diseases among ophthalmic outpatients in a resource-deficient tertiary eye care setting in South-eastern Nigeria. Middle East Afr J Ophthalmol. 2010;17(3):246–249. doi: 10.4103/0974-9233.65491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gruener AM, Sharma P, Ameen S, Ahmed F. Severe corticosteroid-induced ocular hypertension requiring bilateral trabeculectomies in a patient with takayasu's arteritis. Case Rep Ophthalmol Med. 2016;2016:5253029. doi: 10.1155/2016/5253029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Arikan G, Osman Saatci A, Hakan Oner F. Immediate intraocular pressure rise after intravitreal injection of ranibizumab and two doses of triamcinolone acetonide. Int J Ophthalmol. 2011;4(4):402–405. doi: 10.3980/j.issn.2222-3959.2011.04.16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Yang Y, Bailey C, Loewenstein A, Massin P. Intravitreal corticosteroids in diabetic macular edema: pharmacokinetic considerations. Retina. 2015;35(12):2440–2449. doi: 10.1097/IAE.0000000000000726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Shikari H, Silva PS, Sun JK. Complications of intravitreal injections in patients with diabetes. Semin Ophthalmol. 2014;29(5-6):276–289. doi: 10.3109/08820538.2014.962167. [DOI] [PubMed] [Google Scholar]
  • 22.Zhang XY, Ognibene CM, Clark AF, Yorio T. Dexamethasone inhibition of trabecular meshwork cell phagocytosis and its modulation by glucocorticoid receptor beta. Exp Eye Res. 2007;84(2):275–284. doi: 10.1016/j.exer.2006.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kasetti RB, Maddineni P, Patel PD, Searby C, Sheffield VC, Zode GS. Transforming growth factor β2 (TGFβ2) signaling plays a key role in glucocorticoid-induced ocular hypertension. J Biol Chem. 2018;293(25):9854–9868. doi: 10.1074/jbc.RA118.002540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Phulke S, Kaushik S, Kaur S, Pandav SS. Steroid-induced glaucoma: an avoidable irreversible blindness. J Curr Glaucoma Pract. 2017;11(2):67–72. doi: 10.5005/jp-journals-l0028-1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Audette DS, Anand D, So T, Rubenstein TB, Lachke SA, Lovicu FJ, Duncan MK. Prox1 and fibroblast growth factor receptors form a novel regulatory loop controlling lens fiber differentiation and gene expression. Development. 2016;143(2):318–328. doi: 10.1242/dev.127860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kinoshita S, Tashiro K, Nakano M, Yagi T, Mori K, Ikeda Y, Taniguchi T, Kageyama M. Methods of onset risk of glaucoma. 2010: US 2010/0196895 A1 Patent.
  • 27.Hawthorne FA. Convergence of genetic disease association and ocular expression. University Program in Genetics and Genomics Duke University. Dissertation. 2012:1–224. [Google Scholar]
  • 28.Tanuj D, Soman N, Munish D, Shibal B. Steroid induced glaucoma. Kerala Journal of Ophthalmology. 2009;21(4):345–350. [Google Scholar]
  • 29.Toshiyuki O. Association between diabetes mellitus and glaucoma. IJOES. 2014;02(1e):1–2. [Google Scholar]
  • 30.Santiago JG, Walia S, Sun JK, Cavallerano JD, Haddad ZA, Aiello LP, Silva PS. Influence of diabetes and diabetes type on anatomic and visual outcomes following central rein vein occlusion. Eye (Lond) 2014;28(3):259–268. doi: 10.1038/eye.2014.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Razeghinejad MR, Katz LJ. Steroid-induced iatrogenic glaucoma. Ophthalmic Res. 2012;47(2):66–80. doi: 10.1159/000328630. [DOI] [PubMed] [Google Scholar]
  • 32.Cesareo M, Martucci A, Ciuffoletti E, Mancino R, Cerulli A, Sorge RP, Martorana A, Sancesario G, Nucci C. Association between Alzheimer's disease and glaucoma: a study based on Heidelberg retinal tomography and frequency doubling technology perimetry. Front Neurosci. 2015;9:479. doi: 10.3389/fnins.2015.00479. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Moon JY, Kim HJ, Park YH, Park TK, Park EC, Kim CY, Lee SH. Association between open-angle glaucoma and the risks of Alzheimer's and Parkinson's diseases in south Korea: a 10-year nationwide cohort study. Sci Rep. 2018;8(1):11161. doi: 10.1038/s41598-018-29557-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tsolaki F, Gogaki E, Tiganita S, Skatharoudi C, Lopatatzidi C, Topouzis F, Tsolaki M. Alzheimer's disease and primary open-angle glaucoma: is there a connection? Clin Ophthalmol. 2011;5:887–890. doi: 10.2147/OPTH.S22485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sambamurti K, Venugopal C, Suram A, Pappolla MA, Rohrer B, Annamalai P. Amyloid precursor protein metabolism in retinal degeneration. Investig Ophthalmol Vis Sci. 2007;48(13):26. [Google Scholar]
  • 36.Kipfer-Kauer A, McKinnon SJ, Frueh BE, Goldblum D. Distribution of amyloid precursor protein and amyloid-beta in ocular hypertensive C57BL/6 mouse eyes. Curr Eye Res. 2010;35(9):828–834. doi: 10.3109/02713683.2010.494240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Duffy M. New glaucoma research from the United Kingdom: could a glaucoma treatment also help prevent Alzheimer's disease? VisionAware. 2017:1–6. [Google Scholar]
  • 38.Tian T, Zhang BA, Jia YJ, Li ZM. Promise and challenge: the lens model as a biomarker for early diagnosis of Alzheimer's disease. Dis Markers. 2014;2014:826503. doi: 10.1155/2014/826503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Jeremiah KHL, Qiao-Xin L, Zheng H, Algis JV, Vickie HYW, Nicolas C, Jamie M, Bang VB, Christine TN. The eye as a biomarker for Alzheimer's disease. Frot in Neurosci. 2016;10(536):1–14. doi: 10.3389/fnins.2016.00536. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from International Journal of Ophthalmology are provided here courtesy of Press of International Journal of Ophthalmology

RESOURCES