Non-radioactive assay for measuring polynucleotide phosphorylation on small nucleotide substrates

Abstract

Polynucleotide kinases (PNKs) are enzymes that catalyze the phosphorylation of the 5′ hydroxyl end of DNA and RNA oligonucleotides. The activity of PNKs can be quantified using direct or indirect approaches. Here we present a direct in vitro approach to measuring PNK activity that relies on a fluorescently labeled oligonucleotide substrate and polyacrylamide gel electrophoresis. This approach provides resolution of phosphorylated products while avoiding the use of radiolabeled substrates. The protocol described herein details how to setup the phosphorylation reaction, prepare and run large polyacrylamide gels, and quantify the reaction products. The most technically challenging part of this assay is pouring and running polyacrylamide gels, thus we provide critical details to overcome some of the common difficulties. This protocol was optimized for Grc3, a PNK that assembles into an obligate pre-ribosomal RNA processing complex with its binding partner the Las1 nuclease; however, this protocol can be adapted to measure the activity of other PNK enzymes. Moreover, this assay can also be modified to determine the effects of different components on the reaction such as the nucleoside triphosphate, metal ion, and oligonucleotide.

SUMMARY:

This protocol describes a non-radioactive assay for measuring kinase activity of polynucleotide kinases on small DNA and RNA substrates.

INTRODUCTION:

Polynucleotide kinases (PNK) play critical roles in many DNA and RNA processing pathways such as DNA repair and ribosome assembly^1–5. These fundamental enzymes catalyze the transfer of the terminal (gamma) monophosphate from a nucleoside triphosphate (NTP, most often ATP) to the 5′ hydroxyl end of a nucleotide substrate. One of the most well characterized PNKs is bacteriophage T4 PNK, which has broad substrate specificity and is heavily utilized by molecular biology labs for incorporating radioactive isotope labels onto the 5′ terminus of a DNA or RNA substrate^6–12. Another example of a PNK enzyme is CLP1, which is found across all three walks of life and is implicated in several RNA processing pathways^4,13–15.

Historically most assays that measure polynucleotide kinase activity are dependent upon radioactive isotope labeling and subsequent autoradiography^5,16. In recent years a number of additional assays have been developed to measure PNK activity including single molecule approaches, microchip electrophoresis, molecular beacons, colorimetric, and luminescence-based assays^17–22. While many of these new approaches provide enhanced detection limits and avoid the use of radioactivity, there are drawbacks such as costs, reliance on immobilized resin, and limitations in substrate choice.

Grc3 is a polynucleotide kinase that plays a pivotal role in the processing of pre-ribosomal RNA^2,3,23. Grc3 forms a complex with the endoribonuclease Las1, which cleaves the Internal Transcribed Spacer 2(ITS2) of the pre-ribosomal RNA³. Cleavage of the ITS2 by Las1 generates a product harboring a 5′ hydroxyl which is subsequently phosphorylated by the Grc3 kinase³. To investigate the nucleotide and substrate specificity of Grc3, we needed an inexpensive assay that allowed us to test different oligonucleotide substrates. Therefore, we developed a PNK phosphorylation assay that uses fluorescently-labeled substrates. We successfully used this assay to determine that Grc3 can utilize any NTP for phosphoryl transfer activity, but prefers ATP²⁴. In this protocol we adapted our original assay to measure PNK activity of Grc3 towards an RNA mimic of its pre-ribosomal RNA substrate. One challenging aspect of this fluorescence-based approach is the reliance on large polyacrylamide gels to effectively resolve phosphorylated and non-phosphorylated substrates. The protocol described herein provides specific details on how to pour these large gels and avoid common pitfalls.

PROTOCOL:

Working with RNA requires particular care because it is strongly susceptible to degradation. There are simple preventative steps one can take to limit ribonuclease contamination. A separate RNA workstation that can be easily treated with an RNase-inhibitor containing cleaning agent is often helpful. Always wear gloves when handeling samples and use RNase-free certified consumables. Since water is another common source of contamination, it is best practice to use freshly purified water and sterilize all solutions using a 0.22 μm filter.

1. Activity Assay

1.1. Buffer and Reagent Preparation

• 1.1.1.To make 1x Reaction Buffer, combine 20 µl 1M Tris pH 8.0, 40 µl 5M NaCl, 2.5 µl 2M MgCl₂, 100 µl 50% (v/v) glycerol and RNase-free water to reach a total volume of 1 ml.

  Note: This recipe may need to be altered depending on the specific polynucleotide kinase.

• 1.1.2.To make urea loading dye, combine 4.8 g urea, 200 µl 1M Tris pH 8.0, 20 µl 0.5 M EDTA pH 8.0, 0.5 mL 1% (w/v) bromophenol blue and RNase-free water to reach a total volume of 10 ml.
• 1.1.3.To make 10x TBE buffer, combine 108 g Tris base, 55 g boric acid, and 40 mL 0.5 M EDTA pH 8.0 and RNase-free water to reach a total volume of 1L.
• 1.1.4.To make 10% (w/v) ammonium persulfate (APS), weigh 0.5 g of APS and add 3 mL of RNase-free water to dissolve the solid. Add RNase-free water to reach a total volume of 5 ml. Wrap the tube in foil and store the solution at 4 °C.

  NOTE: Dissolved APS decays over time. Replace the 10% (w/v) APS stock every two weeks.

1.2. Obtain Polynucleotide Kinase Enzyme

Considering Grc3 relies on the presence of its binding partner the Las1 nuclease for stability and activity, we characterized the obligate complex formed between recombinant Saccharomyces cerevisiae Las1 and Grc3².

• 1.2.1.Acquire pure Las1-Grc3 PNK enzyme² at 20 μM and stored in Reaction Buffer (see 1.1.1).

  NOTE: Storage buffer will vary depending on the specific PNK.

1.3. Preparation of Nucleic Acid Substrate

In this protocol, we monitor 5’-phosphorylation using a 27-nucleotide RNA substrate that harbors the Las1-Grc3 processing site (C2 site) contained within the Saccharomyces cerevisiae pre-ribosomal internal transcribed spacer 2 (SC-ITS2)^2,25.

• 1.3.1.Chemically synthesize an RNA oligonucleotide substrate containing a 5’-hydroxyl end along with a 3’-fluorescent label. The fluorophore will be used for visualization of the RNA. Ensure that the fluorophore is positioned on the RNA end that is not targeted for phosphorylation.

  NOTE: A purification step will be required to remove excess fluorophore following the RNA labeling reaction. HPLC-purification is a reasonable RNA oligonucleotide clean-up step.

  NOTE: In addition to commercial sources, internal and terminal fluorescent labeling of RNA substrates can be performed in-house using cost-effective prototcols²⁶.

• 1.3.2.Resuspend the RNA using RNase-free water to 500 nM.
• 1.3.3.Store aliquots of RNA at −80 °C for long-term storage or −20 °C for short term storage.

1.4. In vitro RNA Kinase Reaction

NOTE: For this assay, several variables can be measuered such as time, nucleotide levels or enzyme concentration. The goal of this experiment is to assess the amount of phosphorylated RNA in the presence of constant Las1-Grc3 complex and varying ATP levels. The reaction will be set by combining the RNA-Enzyme mixture (described in step 1.4.1) with the ATP component (described in step 1.4.2). Addition of ATP will initiate the reaction. In this case, the reaction will be quenched following a 60-minute incubation at 37 °C.

1.4.1. Preparation of the RNA-Enzyme Mixture

Working stocks of enzyme and EDTA are prepared using Reaction Buffer (see step 1.1.1). For each RNA-Enzyme kinase reaction, combine 1 μL of 500 nM RNA substrate, 8.3 μL of 130 nM Las1-Grc3, and 0.2 μL of 5 mM EDTA.

NOTE: There are two benefits to adding a trace amount of EDTA into the reaction. First, this is an approach to favor magnesium-bound Grc3 by preventing the enzyme from binding to trace amounts of contaminating metals in the mixture. Second, a small amount of EDTA inhibits the activity of contaminating metal-dependent ribonucleases without disrupting the activity of the associated Las1 metal-independent ribonuclease. The concentration of EDTA may be altered depending on the source of the specific PNK.

NOTE: We prefer to make a master stock of the RNA-Enzyme mixture and aliquot 9.5 μL of this master mix to each reaction tube.

1.4.2. Preparation of the ATP Concentration Series

NOTE: The ATP concentration range will depend on the specific PNK.

• 1.4.2.1.

  Make a 20 mM working stock of ATP using Reaction Buffer (see step 1.1.1). This working stock will be used to generate a dilution series ranging from 20 mM to 0.02 mM.

• 1.4.2.2.

  To make the first dilution of the concentration series, mix 1 μL of the 20 mM ATP working stock with 9 μL of Reaction Buffer. This will result in a 10-fold dilution of the ATP with a final concentration of 2 mM.

• 1.4.2.3.

  The 2 mM ATP stock generated in step 1.4.2.2. will be used to make the next dilution in the concentration series. Mix 1 μL of the 2 mM ATP stock with 9 μL of Reaction Buffer. This will make a new ATP stock concentration of 0.2 mM.

• 1.4.2.4.

  Continue diluting 1 μL of the previous ATP stock with 9 μL of Reaction Buffer to make the subsequent ATP stock in the concentration series. A concentration series ranging from 20 mM to 0.02 mM will result in a total of four ATP concentrations.

1.4.3. Initiation of the Assay

• 1.4.3.1.

  Set the heat block to 37 °C.

• 1.4.3.2.

  At 10 second intervals, mix 0.5 μL of the ATP component (ATP concentration series prepared in step 1.4.2) with the RNA-Enzyme mixture (prepared in step 1.4.1) and place the reaction in the 37 °C heat block.

  NOTE: Add 0.5 μL of Reaction Buffer instead of ATP to the RNA-Enzyme mixture for a PNK negative control.

  NOTE: Another necessary control is RNA substrate in the absence of PNK enzyme.

• 1.4.3.3.

  Incubate the reactions for 60 minutes at 37 °C.

  NOTE: Fluorescently-labeled RNA is light sensitive, therefore cover the reactions with foil.

• 1.4.3.4.

  Using the same order as seen in step 1.4.3.2., quench each reaction every 10 seconds by spiking the reaction with 10 μL of 2x urea loading dye (see step 1.1.2.).

  NOTE: In addition to 4 M urea, proteinase K maybe be added at this step to degrade the enzyme. Follow the instructions provided by the supplier to determine the required protease amount and reaction conditions.

• 1.4.3.5.

  Quenched in vitro RNA kinase reactions can either be immediately analyzed by denaturing gel (see step 2) or stored at −20 °C to be analyzed at a later date.

2. Gel Electrophoresis

2.1. Preparing 15% Acrylamide/8M Urea Gel Solution

CAUTION: Acrylamide must be handled with care since it is a neurotoxin. Always wear gloves, a lab coat, and goggles when handling this chemical.

• 2.1.1.In a 150 mL glass beaker, combine 22.5 mL of premixed 40% acrylamide/bis-acrylamide 29:1 solution, 6 mL 10x TBE (see step 1.1.3.), 28.8 g of urea, and RNase-free water to a total volume of 59 ml. Gently swirl the solution.

  NOTE: Depending on RNA substrate length, altering the percentage of polyacrylamide may improve the resolution between unphosphorylated and phosphorylated RNA.

• 2.1.2.Dissolve the urea by heating the solution in the microwave for 20 seconds, swirl the liquid, immediately place the solution back into the microwave for another 20 seconds. Gently swirl the solution until the urea completely dissolves.
• 2.1.3.Slowly cool the solution by placing the glass beaker into a shallow water bath containing cold water. Make sure that the level of cold water surrounding the glass beaker is above the level of solution inside the glass beaker. This will promote efficient heat transfer. Wait 5 minutes.

  NOTE: Do not continue with this protocol if the glass beaker feels warm (water should be below 35 °C). If it still feels warm after 5 minutes then replace the water inside the water bath with fresh cold water and wait another 5 minutes.

  NOTE: Cooling this solution too quickly can lead to the formation of crystals. This protocol is designed to cool the solution slowly. In the presence of crystals, the acrylamide solution should not be used.

• 2.1.4.Filter and degas the solution using a 0.22 μm disposable filtration unit to remove particulates and microscopic air bubbles, respectively.

2.2. Pouring the Denaturing Gel

• 2.2.1.Use soap and warm water to clean a short and long glass plate designed for gels with an overall dimension of 31.0 x 38.5 cm. Spray each glass plate with 95% ethanol and wipe the glass to remove any moisture.

  NOTE: One of the two plates can be siliconized to prevent damage to the gel when separating the glass plate sandwich. However, this step is not necessary since this protocol is designed to visualize the RNA without separating the glass plates.

• 2.2.2.Place the long glass plate horizontally on top of a box so it is elevated off the benchtop.

  CAUTION: Acrylamide is toxic, therefore the gel pouring station must be covered in bench paper that can absorb any spilled liquid and will be immediately placed in a waste bag after the experiment is complete.

• 2.2.3.Place a clean 0.4 mm spacer along the long edges of the long glass plate.
• 2.2.4.Lay the short glass plate atop the long plate and ensure the edges of the short plate, long plate, and spacers are aligned. Clamp the glass plates to each spacer using three evenly spaced metal clamps.
• 2.2.5.Add 24 μL of TEMED to the 15% acrylamide/8M urea solution (prepared in step 2.1.) and mix the solution.
• 2.2.6.Add 600 μL of 10% (w/v) APS (see step 1.1.4.) to the solution in step 2.2.5. and gently mix the solution.
• 2.2.7.Immediately pour the solution between the glass plates.

  NOTE: To avoid the formation of bubbles, tap the glass as the solution is poured.

• 2.2.8.Carefully add a clean 0.4 mm 32-well comb to the top of the glass plate sandwich.
• 2.2.9.Allow a minimum of 30 minutes for the acrylamide to polymerize.

2.3. Running the Denaturing Gel

• 2.3.1.Set the heat block to 75 °C.
• 2.3.2.Remove the metal clamps holding the glass plate sandwich together and thoroughly wash and dry the glass plate sandwich.
• 2.3.3.Place the glass plate sandwich into the gel apparatus with the short plate facing inward.
• 2.3.4.Prepare 0.5x TBE running buffer by combining 100 mL 10x TBE with 1.9 L RNase-free water. Add the appropriate volume of running buffer to the upper and lower chambers of the gel apparatus.
• 2.3.5.Gently remove the comb and rinse the wells thoroughly using a syringe.

  NOTE: This step is critical to remove urea from the wells.

• 2.3.6.Pre-run the gel for 30 minutes at 50-watts (voltage is approximately 2000 V).

  CAUTION: This gel apparatus is operating at a high wattage and users should exhibit precaution.

• 2.3.7.Rinse the wells thoroughly using a syringe.

  NOTE: This step is critical for even loading of sample into the wells.

• 2.3.8.Pulse spin the quenched reactions from step 1.4.3.5. Then incubate the tubes at 75 °C for 3 minutes. Repeat the pulse spin.
• 2.3.9.Immediately load 10 μL of sample per well and run the gel for 3 hours at 50-watts.

  NOTE: Fluorescently-labeled RNA is light sensitive, therefore cover the gel apparatus with foil.

2.4. Imaging the Denaturing Gel

• 2.4.1.Turn off the power supply and drain the upper chamber of the gel apparatus.
• 2.4.2.Wash and dry the glass plate sandwich using soap and water, respectively.

  Cover the glass plate sandwich with foil while transporting the gel.

• 2.4.3.Mount the glass plate sandwich onto the stage of a laser scanner capable of quantitative and sensitive fluorescence detection.

  NOTE: This gel is extremely thin for maximum resolution. For this reason, this protocol is designed to avoid the difficulties of removing the gel from the glass plate sandwich by directly visualizing the fluorescently-labeled RNA through the glass plates.

  NOTE: The use of commercially available low-fluorescence glass plates will increase the captured signal by improving the signal-to-noise ratio.

• 2.4.4.Set the excitation and emission wavelengths of the laser scanner for the desired fluorophore.

  NOTE: The optimal excitation and emission wavelengths may differ for specific fluorophores. For the FAM fluorophore, the excitation and emission wavelengths are 495 nm and 535 nm, respectively.

• 2.4.5.Define the area on the laser scanner stage to be visualized and image the gel according to manufacturer’s instructions (Figure 1).

Figure 1: Example of denaturing gel analysis of phosphorylated RNA.

In vitro RNA kinase assay of Las1-Grc3 (110 nM) incubated with 500 nM SC-ITS2 RNA. X marks the reaction set in the absence of Las1-Grc3 and the black triangle represents the titration of ATP from 0 to 10 mM. C2 RNA is the result of SC-ITS2 RNA cleavage by the Las1 nuclease and is the endogenous substrate for Grc3 PNK activity.

2.5. Quantification

• 2.5.1.Load the digital gel image acquired in step 2.4.5. into an image processing package.
• 2.5.2.Define a template box that will be used to mark the boundaries on the digital gel image that will be used to quantify each RNA band. The RNA band seen in the the reaction mixture set in the absence of PNK enzyme is usually a good band to generate this template.

  NOTE: Quantitation programs can also draw boxes automatically following the software user manual.

• 2.5.3.Copy and paste the template box generated in step 2.5.2. to mark the location of the unphosphorylated and phosphorylated RNA bands in each reaction.

  NOTE: In denaturing gels, the phosphorylated RNA specie will migrate faster than its unphosphorylated counterpart.

  NOTE: To avoid bias caused by background signal, it is critical that the area surrounding each RNA band is identical. For this reason, best practice is to copy and paste the template box defined in step 2.5.2. to demarcate each RNA band.

• 2.5.4.Measure the integrated density within each box.
• 2.5.5.To calculate the relative amount of phosphorylated RNA in a reaction, divide the integrated density of the phosphorylated RNA band by the sum of the integrated densities of the unphosphorylated and phosphorylated RNA bands from the same reaction. This approach can also be applied to calculate the relative amount of unphosphorylated RNA.
• 2.5.6.To visualize the accumulation of phosphorylated RNA product and the corresponding depletion of unphosphorylated RNA substrate across the ATP concentration series, plot the relative amount of RNA calculated in step 2.5.5. against the concentration of ATP (Figure 3).

Figure 3: Quantification of RNA phosphorylation.

Densiometric plot of Las1-Grc3 RNA kinase activity expressed as a percentage of unphosphorylated C2 RNA (grey line; 5′-OH C2 RNA) and phosphorylated C2 RNA (brown line; 5′-P C2 RNA) across an ATP concentration series. Error bars mark the standard deviation from three independent technical replicates.

REPRESENTATIVE RESULTS:

A successful representative denaturing gel of a titration of ATP with a fixed amount of Las1-Grc3 complex is shown in Figure 1. Addition of enzyme results in Las1-mediated RNA cleavage of the SC-ITS2 RNA substrate leading to a defined RNA fragment (5′-OH C2 RNA). Upon the addition of ATP, the C2 RNA fragment is subsequently phosphorylated by Grc3 PNK (5′-P C2 RNA). Phosphorylation alters the migration of the C2 RNA through the gel matrix. Grc3 PNK also phosphorylates the 5′-end of the uncut SC-ITS2 substrate, albeit at a lower rate. This confirms previous work suggesting Grc3 PNK shows substrate preference towards it C2 RNA substrate²⁴. An unsuccessful denaturing gel is shown in Figure 2. This gel was unsuccessful because the 21-nt RNA substrate contained degradation products (Figure 2, first lane). These degradation products overlap with the phosphorylated product and make it impossible to accurately quantify phosphorylation. In contrast, the shortest RNA degradation product (Figure 2, gray arrows) could be successfully analyzed since this area of the gel does not contain any additional RNA species that could hinder accurate quantification of its phosphorylated counterpart. To avoid RNA degradation bands, take care to keep your work space and solutions RNase-free, as well as, limit the number of times your RNA undergoes a freeze-thaw cycle.

Figure 2: Example of an unsuccessful denaturing gel analysis of phosphorylated RNA.

In vitro RNA kinase assay of T4 PNK (0–0.625 units) incubated with 5 μm 21-nt RNA. X marks the reaction set in the absence of T4 PNK. This RNA alone control contains degraded RNA products which makes it impossible to distinguish the phosphorylated product from the degradation product.

DISCUSSION:

Here we describe an assay to measure kinase activity of Grc3 PNK on a fluorescently labeled nucleotide substrate. This assay provides an advantage over traditional PNK phosphorylation assays which are reliant on short half-life radioactively labeled oligonucleotides (i.e. two-week half-life for Phosphorus-32). This protocol can be adapted to measure specific enzyme activity and Michaelis-Menten kinetics as well as determine the dependence of phosphorylation on various parameters such as nucleotide, substrate, and metal ion.

This protocol relies on running large denaturing polyacrylamide gels in order to achieve sufficient resolution to distinguish between an unphosphorylated substrate from its phosphorylated product. Pouring and handling of these gels are critical steps in the protocol. Care must be taken to avoid introducing air bubbles and dust while pouring and setting the gel. We also recommend imaging the gel without removing the glass plates to avoid ripping the gel, which is thin and difficult to handle once removed from the glass plates.

This protocol can be adapted to measure the phosphorylation of different sized oligonucleotide substrates. In this particular assay we used a 15% acrylamide gel to achieve resolution of phosphorylation of 27-nt (SC-ITS2 RNA) and 18-nt (C2 RNA) substrates. The addition of one phosphate group to the 5′-end of SC-ITS2 RNA produces a modest shift compared to the mobility change induced upon 5′-phosphorylation of the shorter C2 RNA (Figure 1). This highlights a limitation in RNA length when using this technique. With longer RNA substrates, the contribution of a phosphate group to the overall molecular weight of the RNA specie is diminished. For this reason, the percentage of acrylamide as well as the gel running time can be optimized to achieve resolution of different sized substrates²⁷. In general, higher percentages of acrylamide are used for smaller oligonucleotide substrates while lower percentages of acrylamide (down to 8% acrylamide) provide better resolution of larger oligonucleotide substrates.

The major limitation of this assay is that it is low-throughput. Pouring and running denaturing gels takes a significant amount of time, limiting the number of gels and samples that can be analyzed in a day. A future application to overcome this limitation could be the development of microfluidic chips that can resolve phosphorylated oligonucleotide products. Microfluidic-based gel electrophoresis has many advantages over traditional gel electrophoresis such as smaller sample size, automation, and speed, however current microfluidic chips to not have single nucleotide resolution.

Table 1:

Fluorescently-labeled RNA Substrates.

	Sequence (5′→3′)	Oligo Code	Source
SC-ITS2	GUCGUUUUAGGUUUUACCAACUGCGGC/36-FAM/	mp 911	(Pillon et al. NSMB 2019)26
C2 RNA	GGUUUUACCAACUGCGGC/36-FAM/	N/A	Las1 cleavage product of SC-ITS2
21-nt	ACGUACGCGGAAUACUUCGAA/36-TAMSp/	mp 596	(Pillon et al. RNA, 2018)24