Abstract
Familial adenomatous polyposis (FAP) is an autosomal dominant hereditary precancerous condition caused by germline pathogenetic variants in the tumor suppressor adenomatous polyposis coli (APC) gene. Patients with FAP develop multiple gastrointestinal adenomatous polyps usually at the age of ~20 years, which, if untreated, become cancerous in 100% of cases. Genotype-phenotype associations have been extensively described; however, inter- and intra-familial variability exists. It is crucial to characterize the causative pathogenetic variant in each pedigree in order to develop a cancer prevention program and follow-up strategy for at-risk families. The present report describes a severe case of sporadic FAP that was diagnosed when the patient was ~2 years old. The patient was a carrier of the de novo pathogenic c.4132 C>T (p.Gln1378X) variant. Additionally, the patient was a carrier of the homozygous c.5465 T>A (p.Asp1822Val) polymorphism, inherited from both parents. However, it remains unclear whether or not this polymorphism is involved in the phenotypic manifestation. This case highlights the need to extend molecular screening to very young children when they show iron-deficiency, anaemia and/or rectal bleeding, even in the absence of a familial history of disease.
Keywords: colorectal cancer, pediatric early onset familial adenomatous polyposis, de novo germline APC gene variants
Introduction
Colorectal cancer (CRC) is the third most common cancer in men and the second in women, with 1.4 million estimated cases worldwide, and 700,000 estimated deaths (1,2). Familial adenomatous polyposis (FAP) is an autosomal dominant pre-cancerous syndrome characterized by the development of hundreds to thousands of colorectal adenomatous polyps that, if untreated, lead to CRC in the third to fourth decade of life (3-5). According to the European Medicines Agency, in 2009, there were 3-10/100,000 new cases in the European Union (6).
Germline pathogenic variants in the tumor suppressor adenomatous polyposis coli (APC) gene are responsible for FAP (7). De novo pathogenetic variants in APC are also found in the majority of sporadic cases of FAP (8,9). The APC gene is located on chromosome 5q and encodes a 312 kDa protein that is involved in several cellular processes, such as cell migration, adhesion and cell cycle regulation, as well as chromosome segregation, signal transduction and apoptosis (10,11). The tumour suppressing activity of APC depends on its capacity to regulate β-catenin levels in the nucleus. In fact, in the absence of Wnt signalling, APC induces β-catenin degradation. If the extracellular Wnt signal is absent, APC-induced β-catenin degradation is inhibited, β-catenin accumulates in the nucleus and modulates gene transcription. Pathogenic variants that disrupt APC interaction with β-catenin are oncogenic (6-11).
The classical symptoms of FAP, including bleeding, diarrhoea and abdominal pain, are generally diagnosed at around 20-25 years of age. Genetic testing is performed to verify the clinical diagnosis and to identify asymptomatic carriers in affected families. Early FAP detection by genetic screening in at-risk families is crucial in order to implement effective prophylaxis strategies. Moreover, the results of genotyping should be considered together with clinical data to decide the type and time of surgery (12).
Various symptomatic young patients with a family history of FAP have been reported, however we describe a case of severe paediatric FAP caused by a de novo pathogenic variant.
Case report
The patient described herein is a ten-year-old boy clinically diagnosed with FAP at the age of nine and recruited to the Ambulatorio di Pediatria of AOU Federico II of Naples in December 2016. The anamnesis revealed that symptoms, i.e. diarrhoea and rectal bleeding, first appeared at the age of two and became more frequent during late childhood. Colonoscopies and esophagogastroduodenoscopy performed in December 2015, December 2016, March 2018 and February 2019 showed hundreds of subcentimetre polyps throughout the colon (Fig. 1A) as well as polyps in the gastric fundus (>10 mm) and body (<5 mm) (Fig. 1B), respectively, thereby confirming the diagnosis of FAP. Histological analysis revealed a Helicobacter pylori infection-negative chronic gastritis-like inflammation of the stomach, inflammatory infiltrate in the ileum and low grade dysplasia of the glandular epithelium of the colon. Haematochemical analysis revealed microcytic anaemia with a haemoglobin level of 10.3 g/dl and a mean cellular volume of 66.5fl. The results of physical analysis were unremarkable. As shown in Fig. 2A, there was no family history of FAP, other polyposis syndromes or colon cancer. The patient's parents received clinical and genetic counselling and provided informed consent to molecular screening.
Figure 1.
Clinical features of the proband. Colonoscopy and esophagogastroduodenoscopy performed during the last hospitalization in February 2019 revealed evidence of multiple (A) colorectal and (B) gastric adenomatous polyps.
Figure 2.
Molecular analysis of c.4132 C>T (p.Gln1378X) variant within the family. (A) Pedigree of the analyzed family. (B) PCR-electrophoresis gel image of exon 15 (fragment H) amplified from the proband's and the proband's parents' genomic DNA and (C) sequence analysis of APC exon 15 (fragment H) performed on fragments amplified from the genomic DNA of the proband (II.1) and his parents (subjects I-1 and I-2). Electropherograms showing the identified variant c.4132 C>T (p.Gln1378X) are reported. Specific nucleotides at position 4132 are shown in black boxes in each electropherogram. APC, adenomatous poliposis coli; SM, DNA size marker; I-1, II-1 and I-2, amplicons obtained by using DNA template from subjects I-1, II-1 and I-2, respectively; B, blank, PCR negative control performed without DNA template.
Genomic DNA was extracted from peripheral blood lymphocytes of the proband and his parents as previously described (13). Briefly, 2 ml of the patient's blood were incubated at 37˚ in a red blood lysis buffer (0.15 M NH4Cl2 and 0.17 M Tris-HCl, pH 7.65) for 15 min and centrifuged. The lymphocyte pellet was resuspended in a DNA extraction buffer (1 M Tris.HCl, 0.5 M EDTA and 5 M NaCl) and digested with Proteinase K and 10% SDS at 60˚C for ten minutes. After adding 6M NaCl, the sample was centrifuged, the DNA in the supernatant was precipitated with absolute ethanol and resuspended in an appropriate volume of deionized sterile water. The quality and the quantity of the DNA was spectrophotometrically assessed with the NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). An absorbance ratio at 260 and 280 nm in the range of 1.8-2.0 was considered good for further analysis.
APC exons 1 to 15 were amplified by polymerase chain reaction (PCR) using 100 ng of the proband genomic DNA and primer pairs described by Groden et al (7) in a 50 µl reaction mixture (Table I). The amplification protocol was as follows: 5 min at 95˚C, then 35 cycles of 20 sec at 95˚C, 30 sec at 60˚C and 45 sec at 72˚C, and a final extension of 5 min at 72˚C. All reactions were run in the MyCycler thermal cycler (Bio-Rad). Amplified fragments were run on a 1X agarose gel and visualized with ethidium bromide, then purified using the QIAquick PCR Purification Kit (Qiagen) according to the manufacturer's recommendations and subjected to automated Sanger sequencing (Fig. 2B and C).
Table I.
Primer pairs used for the genetic analysis of adenomatous poliposis coli exons 1 to 15.
| Primers | Forward sequence (5'-3') | Reverse sequence (5'-3') |
|---|---|---|
| 1 FP/RP | AGGTCCAAGGGTAGCCAAGG | TAAAAATGGATAAACTACAATTAAAAG |
| 2 FP/RP | AAATACAGAATCATGTCTTGAAGT | ACACCTAAAGATGACAATTTGAG |
| 3 FP/RP | TAACTTAGATAGCAGTAATTTCCC | ACAATAAACTGGAGTACACAAGG |
| 4 FP/RP | ATAGGTCATTGCTTCTTGCTGAT | TGAATTTTAATGGATTACCTAGGT |
| 5 FP/RP | CTTTTTTTGCTTTTACTATTAACG | TGTAATTCATTTTATTCCTAATAGCTC |
| 6 FP/RP | GGTAGCCATAGTATGATTATTTCT | CTACCTATTTTTATACCCACAAAC |
| 7 FP/RP | AAGAAAGCCTACACCATTTTTGC | GATCATTCTTAGAACCATCTTGC |
| 8 FP/RP | ACCTATAGTCTAAATTATACCATC | GTCATGGCATTAGTGACCAG |
| 9 FP/RP | AGTCGTAATTTTGTTTCTAAACTC | TGAAGGACTCGGATTTCACGC |
| 9a FP/RP | TCATTCACTCACAGCCTGATGAC | GCTTTGAAACATGCACTACGAT |
| 10 FP/RP | AAACATCATTGCTCTTCAAATAAC | TACCATGATTTAAAAATCCACCAG |
| 10a FP/RP | AGACTAGGACTGAGACATTAATCATC | GGTGAGGAGTGAGAAGAAGGTAATC |
| 11 FP/RP | GATGATTGTCTTTTTCCTCTTGC | CTGAGCTATCTTAAGAAATACATG |
| 12 FP/RP | TTTTAAATGATCCTCTATTCTGTAT | ACAGAGTCAGACCCTGCCTCAAAG |
| 13 FP/RP | TTTCTATTCTTACTGCCTAGCATT | ATACACAGGTAAGAAATTAGGA |
| 14 FP/RP | TAGATGACCCATATTCTGTTTC | CAATTAGGTCTTTTTGAGAGTA |
| 15A FP/RP | GTTACTGCATACACATTGTGAC | GCTTTTTGTTTCCTAACATGAAG |
| 15B FP/RP | AGTACAAGGATGCCAATATTATG | ACTTCTATCTTTTTCAGAACGAG |
| 15C FP/RP | ATTTGAATACTACAGTGTTACCC | CTTGTATTCTAATTTGGCATAAGG |
| 15D FP/RP | CTGCCCATACACATTCAAACAC | TGTTTGGGTCTTGCCATCTT |
| 15E FP/RP | AGTCTTAAATATTCAGATGAGCAG | GTTTCTCTTCATTATATTTTATGCTA |
| 15F FP/RP | AAGCCTACCAATTATAGTGAACG | AGCTGATGACAAGATGATAATG |
| 15G FP/RP | AAGAAACAATACAGACTTATTGTG | ATGAGTGGGGTCTCCTGAAT |
| 15H FP/RP | ATCTCCCTCCAAAAGTGGTGC | TCCATCTGGAGTACTTTCTGTG |
| 15I FP/RP | AGTAAATGCTGCAGTTCAGAGG | CCGTGGCATATCATCCCCC |
| 15J FP/RP | CCCAGACTGCTTCAAAATTACC | GAGCCTCATCTGTACTTCTGA |
| 15K FP/RP | CCCTCCAAATGAGTTACGTGA | TTGTGGTATAGGTTTTACTGGTG |
| 15L FP/RP | ACCCAACAAAAATCAGTTAGATG | GTGGCTGGTAACTTTAGCCTC |
| 15M FP/RP | ATGATGTTGACCTTTCCAGGG | ATTGTGTAACTTTTCATCAGTTGC |
| 15N FP/RP | AAAGACATACCAGACAGAGGG | CTTTTTTGGCATTGCGGAGCT |
| 15O FP/RP | AAGATGACCTGTTGCAGGAATG | GAATCAGACGAAGCTTGTCTAGAT |
| 15P FP/RP | CCATAGTAAGTAGTTTACATCAAG | AAACAGGACTTGTACTGTAGGA |
| 15Q FP/RP | CAGCCCCTTCAAGCAAACATG | GAGGACTTATTCCATTTCTACC |
| 15R FP/RP | CAGTCTCCTGGCCGAAACTC | GTTGACTGGCGTACTAATACAG |
| 15S FP/RP | TGGTAATGGAGCCAATAAAAAGG | TGGGAGTTTTCGCCATCCAC |
| 15T FP/RP | TGTCTCTATCCACACATTCGTC | ATGTTTTTCATCCTCACTTTTTGC |
| 15U FP/RP | GGAGAAGAACTGGAAGTTCATA | TTGAATCTTTAATGTTTGGATTTGC |
| 15V FP/RP | TCTCCCACAGGTAATACTCCC | GCTAGAACTGAATGGGGTACG |
| 15W FP/RP | CAGGACAAAATAATCCTGTCCC | ATTTTCTTAGTTTCATTCTTCCTC |
FP, forward primer; RP, reverse primer.
The sequences analysis was performed by alignment with those present in the GenBank database using the BLASTn software (http://www.ncbi.nlm.nih.gov/blast/html). The accession number of the used reference sequence was NM_000038.4. The same procedure was followed for the genetic analysis of APC exon 15 (fragment H) on the DNA of both the patient's parents (Fig. 2B and C).
Genetic counselling excluded a family history of adenomatous polyposis syndrome. Indeed, the patient's parents reported that none of his first grade relatives, including themselves, had symptoms correlated to FAP or to those developed by the proband, such as chronic gastritis-like inflammation of the stomach in the absence of Helicobacter pylori infection. However, none of them underwent colonoscopy.
Sequence analysis of the APC gene revealed the causative pathogenetic variant in the proband: A heterozygous C to T transition in the exon 15H called c.4132 C>T (p.Gln1378X), which changes the glutamine at codon 1378 in a premature stop codon (Fig. 2C). The proband was also carrier of the rs459552, [c.5465 T>A (p.Asp1822Val)] polymorphism, in fragment L of exon 15 of the APC gene (data not shown). Such polymorphism causes the substitution of a valine with an aspartate at codon 1822 and is reported as benign in the ClinVar database (https://www.ncbi.nlm.nih.gov). Furthermore, the APC genetic carrier test for c.4132 C>T (p.Gln1378X) mutation was negative in the proband's parents (Fig. 2C), whereas both carried the rs459552 polymorphism.
Discussion
Approximately 70-80% of FAP cases are caused by inherited pathogenetic variants of the APC gene, whereas up to 25% of cases are attributed to de novo germline pathogenetic variants (3). Herein, we report the case of a ten-year old boy, clinically diagnosed with severe FAP, in the absence of a family history of polyposis. Genetic analysis of APC confirmed the clinical diagnosis. In fact, a stop codon variant, namely c.4132 C>T (p.Gln1378X) in fragment H of exon 15, was identified as the cause of FAP.
Although pathogenetic APC germline variants have a penetrance of ~100%, very close genotype-phenotype correlations and marked heterogeneity in the phenotypic expression of FAP are well known. Severe phenotypes, characterized by more than 5,000 polyps and early onset of the disease are associated with pathogenetic variants between codons 1250 and 1464, whereas patients with classical FAP develop hundreds to thousands of adenomatous polyps in the colorectum during the second and third decades of life (14,15). Germline pathogenetic variants between codons 168 and 1680 and deletion of entire APC locus are responsible for classical FAP (4,16). Attenuated phenotypes, characterized by a few polyps (~10-100) are associated with pathogenetic variants at the extreme 5' or 3' end of the APC gene or in alternatively spliced exon 9. Alterations in the region between codons 1286 and 1513, i.e., the mutation cluster region, probably provide a strong selective advantage to tumour cells. Indeed, the majority of somatic variants and germline APC variants are clustered in this region and cause aggressive phenotype (4,16). Thus, in accordance with previous studies, our patient, who carried a pathogenetic truncating variant at codon 1378, had a very early onset of the disease and severe FAP phenotype (17,18). The c.4132 C>T variant is reported as somatic by Liu et al (19) and in the ‘Catalogue of Somatic Mutations in Cancer (COSMIC)’ (http://cancer.sanger.ac.uk/cosmic/mutation/overview?id=18862). However, Friedl and Aretz (20) found this variant as germlinal in a FAP patient, but no information about the patient's history was provided (20). Moreover, to date, no genotype/phenotype correlations have been reported.
The patient also carried a second DNA variant, namely, c.5465 T>A (Asp1822Val). This polymorphism, which was also identified in the patient's parents, causes a valine/aspartate substitution at codon 1822. Several studies have investigated the role of polymorphisms in determining the risk of developing FAP or CRC, hypothesizing that the common variants in CRC genes now considered benign variants are, rather, low-risk alleles.
De Rosa et al (21) were the first to identify the Asp1822Val polymorphism. They analysed the genotype of two generations of individuals in ten families and concluded that it was not a disease-causing variant since it was found almost with the same frequency in normal and affected individuals, and it didn't modify the phenotype in any of the FAP patients. Furthermore, according to Fernández-Rozadilla et al (22), Asp1822Val is unrelated to CRC development and alleles T and A are equally distributed among cases and controls (P=0.2197) (22). In contrast, in a case-control study in which 1,785 CRC patients and 1,306 controls were analyzed, Picelli et al (23) found that the Asp1822Val polymorphism showed an odds ratio slightly lower in subjects carrying CRC than in controls (OR=0.75, CI=0.59-0.94), which suggested that the Asp1822Val substitution could protect from CRC (23). Finally, Wong et al (24) evaluated the association between eight APC single nucleotide polymorphisms and the risk of developing colorectal adenoma and concluded that none of the single nucleotide polymorphisms were associated with an increased risk. However, p. Asp1822Val was reported to influence the risk of colorectal adenoma in individuals with higher fat intake.
In conclusion, we found that the germline Gln1378X APC variant is the cause of a very severe sporadic FAP in the proband analyzed in the present study. Notably, the patient had the initial typical symptoms of the disease at the age of two years, although the clinical diagnosis was made when he was nine years old. Young symptomatic FAP patients have been described previously, but rarely in families with negative family history (25). We reported a severe case of FAP with onset in the toddler years, which represents a de novo pathogenetic variant (9). In both cases, the very young age at initial presentation (~2 years), as well as the absence of a family history of FAP, delayed the diagnosis for many years. Therefore, we reiterate the importance of endoscopic investigation in a child with iron-deficiency anaemia and a history of rectal bleeding should undergo endoscopic investigation notwithstanding no having a family history of FAP.
Further studies are required to determine whether Gln1378X and p.Val1822Asp play an additive role in his FAP phenotypic manifestations or not.
Acknowledgements
The authors would like to thank Dr Jaen Ann Gilder for the text editing.
Funding
The present study was supported by Università di Napoli Federico II (CTB_ATENEO_2017_DR_3577/2017).
Availability of data and materials
All data generated or analyzed during this study are included in this published article.
Authors' contributions
MDR and PI designed the study. MDR, AC, AA and FC performed genetic analysis. EM and MR provided sample collection and clinical support. MDR and PI contributed to data interpretation. MDR and AC wrote the manuscript, and FD and RL critically revised the manuscript and participated in the analysis and interpretation of the data. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Written informed consent has been provided by the proband's parents. All methods are part of the clinical practice necessary to carry out the molecular analysis of the APC gene, requested by the proband's parents. Furthermore, the proband's parents agree that the DNA sample no longer needed for the study is used for medical research purposes in an anonymous form and/or in epidemiological cases. The procedures reported in this study were performed in accordance with the rules of the Good Clinical Practice Guidelines (GCP) and the ethical principles set out in the Declaration of Helsinki. The study was also authorized by ‘Comitato etico per le attività Biomediche-Carlo Romano of the University of Naples Federico II’ (protocol no. 35/17).
Patient consent for publication
Not applicable. All identifying information, case details, personal information or images that may enable an individual to be identified, are not included in the text.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D, Bray F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136:E359–E386. doi: 10.1002/ijc.29210. [DOI] [PubMed] [Google Scholar]
- 2.De Rosa M, Rega D, Costabile V, Duraturo F, Niglio A, Izzo P, Pace U, Delrio P. The biological complexity of colorectal cancer: Insights into biomarkers for early detection and personalized care. Therap Adv Gastroenterol. 2016;9:861–886. doi: 10.1177/1756283X16659790. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Ma H, Brosens LA, Offerhaus GJ, Giardiello FM, de Leng WW, Montgomery EA. Pathology and genetics of hereditary colorectal cancer. Pathology. 2018;50:49–59. doi: 10.1016/j.pathol.2017.09.004. [DOI] [PubMed] [Google Scholar]
- 4.Fearnhead NS, Britton MP, Bodmer WF. The ABC of APC. Hum Mol Genet. 2001;10:721–733. doi: 10.1093/hmg/10.7.721. [DOI] [PubMed] [Google Scholar]
- 5.De Rosa M, Galatola M, Borriello S, Duraturo F, Masone S, Izzo P. Implication of adenomatous polyposis coli and MUTYH mutations in familial colorectal polyposis. Dis Colon Rectum. 2009;52:268–274. doi: 10.1007/DCR.0b013e318197d15c. [DOI] [PubMed] [Google Scholar]
- 6.Half E, Bercovich D, Rozen P. Familial adenomatous polyposis. Orphanet J Rare Dis. 2009;4(22) doi: 10.1186/1750-1172-4-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, Joslyn G, Stevens J, Spirio L, Robertson M, et al. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 1991;66:589–600. doi: 10.1016/0092-8674(81)90021-0. [DOI] [PubMed] [Google Scholar]
- 8.Leoz ML, Carballal S, Moreira L, Ocaña T, Balaguer F. The genetic basis of familial adenomatous polyposis and its implications for clinical practice and risk management. Appl Clin Genet. 2015;8:95–107. doi: 10.2147/TACG.S51484. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Auricchio R, De Rosa M, Quaglietta L, Miele E, Boccia G, Staiano A, Izzo P. A dramatic case of early-onset familial adenomatous polyposis. Clin Genet. 2005;67:104–106. doi: 10.1111/j.1399-0004.2005.00381.x. [DOI] [PubMed] [Google Scholar]
- 10.Aoki K, Taketo MM. Adenomatous polyposis coli (APC): A multi-functional tumor suppressor gene. J Cell Sci. 2007;120:3327–3335. doi: 10.1242/jcs.03485. [DOI] [PubMed] [Google Scholar]
- 11.Polakis P. The adenomatous polyposis coli (APC. tumor suppressor. Biochim Biophys Acta. 1997;1332:F127–F147. doi: 10.1016/s0304-419x(97)00008-5. [DOI] [PubMed] [Google Scholar]
- 12.Dodaro C, Grifasi C, Florio J, Santangelo ML, Duraturo F, De Rosa M, Izzo P, Renda A. The role of mutation analysis of the APC gene in the management of FAP patients. A controversial issue. Ann Ital Chir. 2016;87:321–325. [PubMed] [Google Scholar]
- 13.Galatola M, Paparo L, Duraturo F, Turano M, Rossi GB, Izzo P, De Rosa M. Beta catenin and cytokine pathway dysregulation in patients with manifestations of the ‘PTEN hamartoma tumor syndrome’. BMC Med Genet. 2012;13(28) doi: 10.1186/1471-2350-13-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Nagase H, Nakamura Y. Mutations of the APC (adenomatous polyposis coli) gene. Hum Mutat. 1993;2:425–434. doi: 10.1002/humu.1380020602. [DOI] [PubMed] [Google Scholar]
- 15.Gayther SA, Wells D, SenGupta SB, Chapman P, Neale K, Tsioupra K, Delhanty JD. Regionally clustered APC mutations are associated with a severe phenotype and occur at a high frequency in new mutation cases of adenomatous polyposis coli. Hum Mol Genet. 1994;3:53–56. doi: 10.1093/hmg/3.1.53. [DOI] [PubMed] [Google Scholar]
- 16.De Rosa M, Scarano MI, Panariello L, Carlomagno N, Rossi GB, Tempesta A, Borgheresi P, Renda A, Izzo P. Three submicroscopic deletions at the APC locus and their rapid detection by quantitative-PCR analysis. Eur J Hum Genet. 1999;7:695–703. doi: 10.1038/sj.ejhg.5200344. [DOI] [PubMed] [Google Scholar]
- 17.Newton KF, Mallinson EK, Bowen J, Lalloo F, Clancy T, Hill J, Evans DG. Genotype-phenotype correlation in colorectal polyposis. Clin Genet. 2012;81:521–531. doi: 10.1111/j.1399-0004.2011.01740.x. [DOI] [PubMed] [Google Scholar]
- 18.Fostira F, Thodi G, Sandaltzopoulos R, Fountzilas G, Yannoukakos D. Mutational spectrum of APC and genotype-phenotype correlations in Greek FAP patients. BMC Cancer. 2010;10(389) doi: 10.1186/1471-2407-10-389. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Liu X, Shan X, Friedl W, Uhlhaas S, Propping P, Li J, Wang Y. May the APC gene somatic mutations in tumor tissues influence the clinical features of Chinese sporadic colorectal cancers? Acta Oncol. 2007;46:757–762. doi: 10.1080/02841860600996439. [DOI] [PubMed] [Google Scholar]
- 20.Friedl W, Aretz S. Familial adenomatous polyposis: Experience from a study of 1164 unrelated german polyposis patients. Hered Cancer Clin Pract. 2005;3:95–114. doi: 10.1186/1897-4287-3-3-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.De Rosa M, Scarano MI, Panariello L, Salvatore F, Izzo P. A novel Mbo II polymorphism in exon 15 of the human adenomatous polyposis coli gene. Clin Genet. 1998;53:315–316. doi: 10.1111/j.1399-0004.1998.tb02704.x. [DOI] [PubMed] [Google Scholar]
- 22.Fernández-Rozadilla C, de Castro L, Clofent J, Brea-Fernández A, Bessa X, Abulí A, Andreu M, Jover R, Xicola R, Llor X, et al. Single nucleotide polymorphisms in the Wnt and BMP pathways and colorectal cancer risk in a spanish cohort. PLoS One. 2010;5(e12673) doi: 10.1371/journal.pone.0012673. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Picelli S, Zajac P, Zhou XL, Edler D, Lenander C, Dalén J, Hjern F, Lundqvist N, Lindforss U, Påhlman L, et al. Common variants in human CRC genes as low-risk alleles. Eur J Cancer. 2010;46:1041–1048. doi: 10.1016/j.ejca.2010.01.013. [DOI] [PubMed] [Google Scholar]
- 24.Wong HL, Peters U, Hayes RB, Huang WY, Schatzkin A, Bresalier RS, Velie EM, Brody LC. Polymorphisms in the adenomatous polyposis coli (APC) gene and advanced colorectal adenoma risk. Eur J Cancer. 2010;46:2457–2466. doi: 10.1016/j.ejca.2010.04.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Septer S, Lawson CE, Anant S, Attard T. Familial adenomatous polyposis in pediatrics: Natural history, emerging surveillance and management protocols, chemopreventive strategies, and areas of ongoing debate. Fam Cancer. 2016;15:477–485. doi: 10.1007/s10689-016-9905-5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this published article.


