Skip to main content
Iranian Biomedical Journal logoLink to Iranian Biomedical Journal
. 2020 Feb 19;24(5):324–332. doi: 10.29252/ibj.24.5.319

In vivo and in vitro Pathogenesis and Virulence Factors of Candida albicans Strains Isolated from Cutaneous Candidiasis

Golnar Sadeghi 1, Seyed Fazllolah Mousavi 2, Mina Ebrahimi-Rad 3, Esmat Mirabzadeh-Ardekani 4, Ali Eslamifar 5, Masoomeh Shams-Ghahfarokhi 6, Zahra Jahanshiri 1, Mehdi Razzaghi-Abyaneh 1,*
PMCID: PMC7392142  PMID: 32429646

Abstract

Background:

The Candida albicans is one of the most important global opportunistic pathogens, and the incidence of candidiasis has increased over the past few decades. Despite the established role of skin in defense against fungal invasion, little has been documented about the pathogenesis of Candida species when changing from normal flora to pathogens of vaginal and gastrointestinal epithelia. This study was carried out to determine the in vivo and in vitro pathogenesis of clinical C. albicans strains isolated from skin lesions.

Methods:

In this study, association of in vivo and in vitro pathogenesis of C. albicans isolates with different evolutionary origins was investigated. Oral and systemic experimental candidiasis was established in BALB/C mice. The expression levels of SAP1-3 genes, morphological transformation, and biofilm-forming ability of C. albicans were evaluated.

Results:

All the strains showed in vitro and in vivo pathogenicity by various extents. The SAP1, SAP2, and SAP3 genes were expressed in 50%, 100%, and 75% of the strains, respectively. The biofilm formation ability was negative in 12% of the strains, while it was considerable in 38% of the strains. Fifty percent of the strains had no phospholipase activity, and no one demonstrated high level of this pathogenesis factor. Relatively all the strains had very low potency to form pseudohyphae.

Conclusion:

Our findings demonstrated that Candida albicans strains isolated from cutaneous candidiasis were able to cause oral and systemic infections in mice, so they could be considered as the potential agents of life-threatening nosocomial candidiasis in susceptible populations.

Key Words: Candida albicans, Experimental candidiasis, in vivo pathogenicity, Virulence factors

INTRODUCTION

The polymorphic fungus Candida albicans belongs to the normal flora of human mucosa and in most individuals is considered as a non-pathogenic commensal. Under certain conditions, C. albicans can, however, cause infection that ranges from superficial, such as cutaneous and oral, to life-threatening systemic candidiasis. The worldwide incidence of candidiasis has increased over the past few decades, which may be attributable to the increased numbers of immunocompromised patients[1,2]. Infection by Candida yeasts has been shown to be endogenous in origin. However, nosocomial infections are generally transmitted by the health care staff or relatives’ hands, from patient to patient, or even by medical devices[3]. Despite the established role of skin in defense against fungal invasion, little has been documented about the pathogenesis of Candida species when invading vaginal and gastrointestinal surfaces. C. albicans is the major causative agent of superficial Candida-related infections and causes skin thickening, crusting, inflammation, and erythema[4-6]. Although laboratory experiments provide reliable data on the virulence and pathogenesis of Candida-related infections, the data from host-fungal pathogen interaction will be quit important to clarify how the fungus affects the human tissue and invade the skin of various body parts[7,8].

Amongst the rodents, mice are the most widely used animal models for investigating clinical Candida isolates from oral mucosa or systemic candidiasis. Such types of candidiasis have been induced experimentally in outbred and inbred mice strains. The most commonly used inbred mice strains are BALB/C[9,10]. It assumes that the ability of C. albicans to be a pathogen from commensal results from producing various virulence factors. In this relation, the morphological transition between yeast and pseudohyphae (known as dimorphism), production of secretory enzymes i.e. Saps, and phospholipase and formation of biofilm are significant virulence factors contributed to C. albicans pathogenesis[11,12].

The present study was designed to evaluate the ability of molecular-typed C. albicans strains[13] isolated from skin lesions to induce systemic and oral candidiasis in murine models. In our study, the presumptive relation between in vivo and in vitro pathogenesis and differences in molecular types and evolutionary origin of C. albicans isolates were considered.

MATERIALS AND METHODS

Study population and sample collection

Eight clinical C. albicans isolates, as the cause of cutaneous candidiasis, typed by MLST were studied. A portion of the specimens was inoculated on SDA plates (Merck, Germany) supplemented with chloramphenicol (0.05 gL -1) and incubated at 37 °C for 24 h, to isolate the Candida species. All the isolates were identified by a combination of morphological and biochemical analysis including germ tube formation, chlamydospore formation, carbohydrate assimilation (using the commercial system ID32 C,biomérieux Marcy l’Etoile, France), and CHROMagar Candida screening (CHROMagar Candida, Paris, France). Species identification was confirmed by internal transcribed spacer sequencing.

Animal model

Isogenic female BALB/C mice (n = 120, 6-8 weeks old) were obtained from Pasteur Institute of Iran (Tehran, Iran). The mice were kept in plastic cages, allowed free access to water and maintained on a 12:12 h light/dark cycle. The temperature and humidity were controlled at 23 ± 1 °C and 55 ± 10%, respectively. A number of 56 mice were divided into eight groups of seven mice with different in vitro pathogenesis for each of the oral and systemic candidiasis. In each experiment, four mice were considered as the negative controls.

Experimental systemic candidiasis

The mice were challenged by the intravenous injection of an inoculum of 2 × 107 CFU in 100 µl of a yeast suspension from cultures grown on SDA via a 25-gauge syringe at 37 °C for 48 h. The mice were observed for seven days, and the mortality was noted. For CFU determination in organ, the mice were sacrificed by cervical dislocation after seven days. Kidneys were aseptically harvested as most of the Candida cells in systemic candidiasis murine models are found in the kidneys[14]. Each was divided into equal portions for fungal burden determination and histopathological evaluation. For fungal burden determination, the kidneys were weighed and then homogenized in 1 ml of PBS, and homogenates were serially diluted before plating on SDA. The plates were incubated at 37 °C for 24 h, and the fungal burden was expressed as the ratio of log10 of CFU to the organ weight[15].

Experimental oral candidiasis

The murine model of oral candidiasis was set up according to a formerly described method with some modifications[15,16]. Establishment of infection at mucosal sites generally requires treatment with immunosuppressive agents prior to infection. One day before infection, the mice were immunosuppressed by subcutaneous injection of prednisolone (100 mg/kg body weight), and the antibiotic tetracycline hydrochloride (0.83 mg/ml) was dispensed in the drinking water. Before infection, the mice were anesthetized with 100 µl of ketamine (100 mg/kg of mouse)/xylazine (10 mg/kg of mouse) administered intraperitoneally via intramuscular injection on each femur. The oral cavities of the anesthetized mice were swabbed with a sterilized cotton swab that had been dipped in a cell suspension of each strain of C. albicans (2.0 × 107 CFUs/ml from cultures grown on SDA at 37 °C for 48 h). The mice were sacrificed 72 hours after infection. The tongues were divided into equal portions for fungal burden determination and histopathological evaluation. For fungal burden determination, the tongue was weighed and then homogenized in 1 ml of PBS, and homogenates were serially diluted before plating on SDA. The plates were incubated at 37 °C for 24 hours, and fungal burden was expressed as the ratio of log10 of CFU to the organ weight[16].

Histopathological study

For histopathological analysis, kidneys and tongues were fixed in 4% paraformaldehyde, fixed with paraffin wax and stained with periodic acid-Schiff.

RNA isolation

Total RNA from C. albicans grown in culture was prepared using the RNeasy RNA isolation system, the Molecular Biology kit (Bio Basic Inc, Canada) according to the manufacturer’s instructions and stored at -70 °C until use. RNA concentration was measured by the absorbance at 260 nm.

Synthesis of cDNA

To synthesize the cDNA, PrimeScript First strand cDNA Synthesis Kit (Takara Bio Inc, Japan) was used according to the instructions recommended by the manufacturer.

Real-time PCR

Real-time PCR was used to quantify tity r the virulence genes (SAP1-3) mRNA levels in our isolates, with ACT1 used as a reference housekeeping gene. The PCR primers for amplification of SAP and ACT1 were previously described by Monroy-Pérez et al.[17] (Table 1). A final volume of 25 µl, including 12.5 µl of SYBER Green Master Mix, 1 µl of each forward and reverse primer, 2 µl of cDNA (20 ng), and 8.5 µl of RNase-free water, was used for each reaction. The amplification conditions were performed with an initial denaturation of 95 °C for 10 minutes, followed by 35 cycles of 20 s at 95 °C, 40 s at annealing temperature of 58 °C, and 30 s at 72 °C. The gene expression was evaluated by the ΔCT method using the control gene (ACT1) to normalize the data. Each reaction was performed in triplicate, and the mean values of relative expression were analyzed for each gene[18]. The C. albicans ATCC10231 strain was used as a positive control. The strains from our collection, each carrying a different deletion of SAP genes, were used as the negative controls[10].

Table 1.

Primers used in real-time PCR assay

Gene Primers Sequences (5'-3') Size of amplified product (bp)
SAP1 SAP1F TCAATCAATTTACTCTTCCATTTCTAACA 161
SAP1R CCAGTAGCATTAACAGGAGTTTTAATGACA
SAP2 SAP2F AACAACAACCCACTAGACATCACC 178
SAP2R TGACCATTAGTAACTGGGAATGCTTTAGGA
SAP3 SAP3F CCTTCTCTAAAATTATGGATTGGAAC 231
SAP3R TTGATTTCACCTTGGGGACCAGTAACATTT
ACT1 ACT1F GACCGAAGCTCCAATGAATC 181
ACT1R AATTGGGACAACGTGGGTAA

Virulence factors

The in vitro biofilm formation of Candida isolates was determined as described by Zago et al.[19]. The metabolic activity of the biofilm was measured by crystal violet (1% v/v) assay after 48 hours of incubation. Based on the average OD observed, the isolates were classified into three groups showing: (i) low (OD less than 0.12), (ii) medium (OD of 0.12–0.20), and (iii) high (OD higher than 0.20) biofilm-forming. Phospholipase activity was evaluated by the methods mentioned by Tsang et al.[20] and Galan-Ladero et al.[21]. Suspension of 108 cell/ml was dropped onto each test medium. After 48 hours of incubation at 37 °C, the diameters of the colonies (a) and the diameters of the precipitation zone around the colonies (b) were measured. The production of the enzyme was designated as Pz = a/b. The following ranges of activity according to Pz index were established: high, Pz = 0.40; medium, Pz = 0.41–0.60; low, Pz = 0.61–0.80; very low, Pz = 0.81–0.99; none, Pz = 1. The Pz index is a reproducible semi-quantitative technique used widely. Pseudohyphae formation was defined as a cell bearing a rounded outgrowth with a length greater than or equal to the diameter of the parent cell, with a constriction at the base. After two hours of cell growth in a liquid medium containing an equal volume of RPMI 1640 (Sigma, USA) and fetal bovine serum (GIBCO, USA), the percentage of cells in pseudohyphae form against blastopores was determined by microscopy, counted as described by Negri et al[22].

Statistical analysis

Results were analyzed using the Graph Pad Prism 6. One-way ANOVA and Unpaired t-test were used for the statistical analysis. p values <0.05 were considered statistically significant.

Ethical statement

The above-mentioned sampling/treatment protocols were approved by the Institutional Ethics Committee of Pasteur Institute of Iran (ethical code: IR.PII.REC. 1397.021).

RESULTS

Experimental systemic and oral candidiasis

The present study was designed to evaluate the virulence activity of the C. albicans strains isolated from skin lesions to induce systemic and oral candidiasis in murine models. Eight C. albicans isolates were selected according to the highest and the lowest in vitro virulence activity in four clades derived from typing by MLST method[13] (Fig. 1). Each of two isolates of separate minor clades showed different in vitro and in vivo pathogenicity, but there was no evident association between the strains in variant major clades and all studied forms of pathogenesis.

Fig. 1.

Fig. 1

The dendrogram constructed from UPGMA analysis based on concatenated MLST sequence of the seven loci of eight  C. albicans strains

SAP expression

The primers used in real-time PCR assay are shown in Table 1. Each of the different SAP primer sets were specified for each SAP gene, excluding the possibility that any one SAP primer set could cause a false-positive result. We examined the expression of genes encoding Sap1-3 in eight C. albicans isolates. Each of the SAP1, SAP2, and SAP3 genes was expressed in 50%, 100%, and 75% of the strains, separately. Three patterns in the genotypes of SAP1-3 were identified. Four strains expressed all the studied SAP genes, two isolates SAP2 and 3 and two isolates only one. The folding changes (2-ΔΔCT) of the SAP1-3 genes in all the isolates from different minor clades with their mean values are illustrated in Figure 2.

Fig. 2.

Fig. 2

Comparison of SAP1-3 expression according to the folding change (2-ΔΔCT) in eight C. albicans isolates. SAP1 (A), SAP2 (B), SAP3 (C), and the mean values of SAP1-3 expression (D).

Virulence factors

Table 2 displays the in vitro virulence ability such as SAP expression, biofilm formation, phospholipase production, and pseudohyphae creation. The biofilm formation rates in 12% of the isolates were negative and in 38% high. Also, 50% of the strains had no phospholipase activity, and no one demonstrated the high level of this pathogen factor. Relatively, all the strains had low capability to form pseudohyphae.

Table 2.

In vitro pathogenicity in eight different C. albicans isolates

No. SAP expression
Biofilm a Phospholipase
(P z ) b
Pseudohyphae
(%) c
SAP1 SAP2 SAP3
93-62 + + + +2 0.42 8
93-1428 + + + - 1.00 5
93-107 - + + +2 1.00 5
93-1878 + + + +3 0.84 29
93-2553 - + - +1 1.00 4
93-2381 - + + +3 0.66 17
93-1471 - + + +2 1.00 6
93-1095 - + - +3 0.70 11

(-) negative; a1+, 2+, and 3+: %Tbloc (Measure of light blocked when passing through the wells) 5-20, 20-35, and 35-50, respectively. bPz = the diameters of the colonies (A) and the precipitation zone (B) around the colonies (medium: Pz = 0.41–0.60, low: Pz = 0.61–0.80, very low: Pz = 0.81–0.99, and none: Pz = 1). cThe percentage of cells in pseudohyphae form. Seven mice were challenged for each of the isolates.

Histology in relation to virulence

Weights of mice and organs, mortality, and in vivo pathogenicity in animals challenged with eight C. albicans isolates to form oral and systemic infections demonstrated in Table 3 were different. All of these strains isolated from patients suffering from cutaneous candidiasis with different pathogenic potential were able to cause systemic and oral candidiasis in mice. Histopathological analysis of kidneys and tongues, collected from BALB/c mice in which systemic and oral candidiasis were induced, showed different incidence of established infection and inflammation by C. albicans fitting to their in vivo pathogenesis, with abundant yeasts and the formation of pseudohyphae/ hyphae (Fig. 3).

Table 3.

Weights of mice and organs, mortality, and in vivo pathogenicity in animals challenged with eight C. albicans isolates to form oral and systemic infections

No. Mouse weight change (g)
mean (range)
Organ weight (g)
mean (range)
Mortality
(day)
In vivo pathogenicity (Log CFU/g tissue) (median) range
Systemic Oral Systemic Oral Systemic Oral Systemic Oral
93-62 -3.9
((-5.2)-(-2.4))
- 4.0
((-5.3)-(-2.6))
0.21
(0.14- 0.30)
0.07
(0.04- 0.09)
2/7 (5) 0/7(0) (4.43)
3.69- 4.73
(4.41) 2.95- 5.26
93-1428 -1.5
((-2.5)-(-0.7))
-4.2
((-5.5)-(-2.8))
0.20
(0.12- 0.28)
0.07
(0.05- 0.10)
0/7 (0) 1/7(2) (1.75)
1.03- 2.78
(4.73) 4.59- 4.82
93-107 -1.0
((-2.3)-(-0.2))
-3.8
((-5.6)-(-0.5))
0.18
(0.14- 0.20)
0.07
(0.04- 0.09)
1/7 (7) 0/7(0) (2.67)
1.46- 4.33
(4.22) 3.87- 4.55
93-1878 -5.1
((-7.2)-(-2.6))
-4.2
((-5.2)-(-3.1))
0.20
(0.16- 0.24)
0.07
(0.05- 0.10)
0/7 (0) 0/7(0) (3.37)
2.39- 4.35
(4.72) 4.30- 5.27
93-2553 -3.9
((-6.0)-(-0.3))
-4.5
((-5.5)-(-3.5))
0.19
(0.18- 0.22)
0.07
(0.05- 0.09)
1/7 (5) 0/7(0) (3.89)
3.23- 4.44
(5.11) 4.13- 5.68
93-2381 -2.5
((-4.3)-(-0.7))
-4.1
((-5.2)-(-2.8))
0.19
(0.14- 0.22)
0.08
(0.03- 0.11)
0/7 (0) 1/7(2) (3.68)
1.93- 4.97
(4.81) 4.38- 5.19
93-1471 -5.2
((-8.7)-(-3.3))
-4.0
((-5.3)-(-2.9)
0.20
(0.14- 0..21)
0.09
(0.07- 0.11)
0/7 (0) 0/7(0) (3.59)
2.75- 4.79
(4.64) 4.32- 5.29
93-1095 -4.4
((-4.8)-(-3.5))
-4.5
((-5.3)-(-2.8))
0.19
(0.17- 0.21)
0.09
(0.07- 0.10)
1/7 (5) 0/7(0) (3.75)
2.48- 5.28
(5.19) 4.98- 5.54

Fig. 3.

Fig. 3

Microscopic observation of typical lesions on the kidneys and tongues of mice with systemic and oral candidiasis on days 7 and 3 after the infection, respectively. Periodic acid-Schiff-stained sections show the extensive colonization by numerous Candida hyphae in the kidney (A) and on the epithelium of the dorsal surface of the tongue (B). (×1000 magnification)

Discussion

Candida infections are one of the most significant nosocomial infections that have proliferated by 3.5 to 14 folds over the past decades. Although the sources of infection are human normal flora, hospital environments have an undisputable role [23]. During both superficial and systemic infection, C. albicans strains depend on a complex of virulence factors. It has been shown that the injury of host epithelial cells induced by filamentous forms (hyphae and pseudohyphae) of C. albicans is the main factor facilitates the growth and invasion of the fungus [24].

Our results showed that in contrast to morphological transition, enzymatic activities were not involved in fungal pathogenesis. These findings are in accordance with the results of a previous study implying that a high percentage of phospholipase production (53.8- 74%) by C. albicans isolates [25]. In another study, authors showed that Candida isolates from candidemia has considerable phospholipase activity contributed to their virulence. Despite the known role of filamentous forms of C. albicans in fungal pathogenesis, yeast cells of the fungus were abundantly reported from infected tissues [26]. It has been demonstrated that biofilm- forming ability was more frequent among bloodstream isolates than that of the isolates from other clinical sources [27]. Other virulence factors of C. albicans in oral candidiasis are closely related to molecular factors such as Saps, in particular Sap1-3, whereas in denture stomatitis, biofilm formation is the most important factor [28]. To date, different roles are attributed to Saps (level of activity and number of SAP genes) of C. albicans in relation to pathogenesis, which mainly facilitate the fungal invasion and affect host immune responses [29].

Our findings showed that each of the SAP1, SAP2, and SAP3 genes was expressed in 50%, 100%, and 75% of the strains, separately. SAP2 and 3 expressions in our study were similar to a previous report for C. albicans strains with oral and vaginal source by Dabiri et al.[18] in Iran, whereas the result for SAP1 activity was different. According to a previous report by Lima et al.[30], the SAP1 gene had more expression in the process of vaginal infection in comparison to the oral infection. More investigation suggested that SAP1-3 appears to be essential for mucosal and SAP4-6 for systemic infections[31]. Our results demonstrated that the SAP2 gene can be considered as an effective pathogenic factor for tissue destruction in oral candidiasis. As indicated in another investigation, SAP2 gene may be a potential target for prevention or treatment of candidiasis[32].

We have experimented oral and systemic models of candidiasis using C. albicans strains isolated from skin lesions and selected four clades derived from typing by MLST method[13]. The murine model that is considered as the “gold standard” in the study of oral and systemic Candida infections can be used to prove genetic determinants of Candida virulence ability[32]. Although the source of the fungal isolates may be a neglected confounding factor in virulence studies in animal models, in our study, all the isolated strains from patients with skin lesions were able to cause systemic and oral candidiasis in mice. Each of two isolates of separate minor clades demonstrated various degree of comparable pathogenicity, but there was no evident association between strains in variant major clades and all studied forms of pathogenesis. For instance, strains of 93-62 and 93-1428 in a minor clade clearly vary in a number of properties not exactly related to the particular gene sequences that are used to express their clade assignation. A similar report to our study was presented by MacCallum et al.[33]. It has been shown that phenotypic amendment in C. albicans changes gradually over the years as a result of small alterations in the sequences of some genes[34]. In agreement with Tavanti et al.’s[35] report, the utility of MLST for determining clade assignments of clinical isolates will form a basis for the rational selection of a wider diversity of strains for future researches into C. albicans virulence. It is obvious that either fungal characteristics or host reactions determine the outcome of fungal infection and development of clinical manifestation. Although the importance of hypha production and phospholipase production in Candida pathogenicity is undisputed, the yeast can also disseminate and multiply in internal organs. Besides, our results, in a few isolates, indicated that other factors may account for the observed variation in the development of infection in animals (Table 2). Presumably, the ability to cause diseases in the mammalian host is the product of a combination of these phenotypes and others. This observation was similar to a previous report by Asmundsdóttir et al.[36]. Ideally, for meaningful comparison, many representative isolates should be used.

Taken together, our findings further indicate that virulence factors of C. albicans are important determinants of the outcome of Candida-related invasion in relation to phenotypic and genotypic characteristics. Inclusive comparative studies from different geographical areas of the world are highly recommended in order to make a global profile of virulence in C. albicans.

ACKNOWLEDGMENTS

This study was supported financially by a Ph.D. grant to Golnar Sadeghi and a research grant (no. 766) to Mahdi Razzaghi-Abyaneh by the Pasteur Institute of Iran, Tehran. Research reported in this publication was supported by Elite Researcher Grant Committee under award numbers 958634 and 963646 from the National Institute for Medical Research Development (NIMAD), Tehran, Iran.

CONFLICT OF INTEREST.

None declared.

References

  1. Ortega M, Marco F, Soriano A, Almela M, Martínez JA, López J, Pitart C, Mensa J. Candida species bloodstream infection: epidemiology and outcome in a single institution from 1991 to 2008. Journal of hospital infection. 2011;77(2):157–161. doi: 10.1016/j.jhin.2010.09.026. [DOI] [PubMed] [Google Scholar]
  2. Razzaghi-Abyaneh M, Sadeghi G, Zeinali E, Alirezaee M, Shams-Ghahfarokhi M, Amani A, Mirahmadi R, Tolouei R. Species distribution and antifungal susceptibility of Candida spp isolated from superficial candidiasis in outpatients in Iran. Journal de mycologie médicale. 2014;24(2):43–50. doi: 10.1016/j.mycmed.2014.01.004. [DOI] [PubMed] [Google Scholar]
  3. Yildirim M, Sahin I, Kucukbayrak A, Ozdemir D, Tevfik Yavuz M, Oksuz S, Cakir S. Hand carriage of Candida species and risk factors in hospital personnel. Mycoses. 2007;50(3):189–192. doi: 10.1111/j.1439-0507.2006.01348.x. [DOI] [PubMed] [Google Scholar]
  4. Kühbacher A, Burger-Kentischer A, Rupp S. Interaction of Candida species with the skin. Microorganisms. 2017;5(32) doi: 10.3390/microorganisms5020032. doi: 10.3390/micro-organisms5020032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Pfaller MA, Diekema DJ. Epidemiology of invasive mycoses in North America. Critical reviews in microbiology. 2010;36(1):1–53. doi: 10.3109/10408410903241444. [DOI] [PubMed] [Google Scholar]
  6. Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Virulence. 2013;4(2):119–128. doi: 10.4161/viru.22913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Rahman D, Mistry M, Thavaraj S, Challacombe SJ, Naglik JR. Murine model of concurrent oral and vaginal Candidaalbicans colonization to study epithelial host pathogen interactions. Microbes andinfection. 2007;9(5):615–622. doi: 10.1016/j.micinf.2007.01.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. MacCallum DM. Hosting infection: experimental models to assay Candida virulence. International journal of microbiology. 2012;2012:Article ID 363764. doi: 10.1155/2012/363764. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Szabo EK, MacCallum DM. The contribution of Mouse models to our understanding of systemic candidiasis. FEMS microbiology letters. 2011;320(1):1–8. doi: 10.1111/j.1574-6968.2011.02262.x. [DOI] [PubMed] [Google Scholar]
  10. Yu S, Li W, Liu X, Che J, Wu Y, Lu J. Distinct expression levels of ALS, LIP, and SAP genes in Candida tropicalis with diverse virulent activities. Frontiers in microbiology. 2016;7 doi: 10.3389/fmicb.2016.01175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Frenkel M, Mandelltat M, Alastruey-Izquierdo A, Mendlovic S, Semis R, Segal E. Pathogenicity of Candidaalbicans isolates from bloodstream and mucosal candidiasis assessed in mice and Galleria mellonella. Journal de mycologie médicale. 2016;26(1):1–8. doi: 10.1016/j.mycmed.2015.12.006. [DOI] [PubMed] [Google Scholar]
  12. Richardson JP, Ho J, Naglik JR. Candida-epithelial interactions. Journal of fungi. 2018;4(1) doi: 10.3390/jof4010022. doi: 10.3390/ jof4010022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Sadeghi G, Ebrahimi-Rad M, Shams-Ghahfarokhi M, Jahanshiri Z, Ardakani E, Eslamifar A, Mousavi SF, Razzaghi-Abyaneh M. Cutaneous candidiasis in Tehran-Iran: From epidemiology to multilocus sequence types, virulence factors and antifungal susceptibility of etiologic Candida species. Iranian journal of microbiology. 2019;11(4):267–279. [PMC free article] [PubMed] [Google Scholar]
  14. Lionakis MS, Lim JK, Lee CC, Murphy PM. Organ-specific innate immune responses in a mouse model of invasive candidiasis. Journal of innate immunity. 2011;3(2):180–199. doi: 10.1159/000321157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Wong SS, Kao RY, Yuen KY, Wang Y, Yang D, Samaranayake LP, Seneviratne CJ. Invitro and in vivo activity of a novel antifungal small molecule against Candida infections. PLoS one. 2014;9(1):e85836. doi: 10.1371/journal.pone.0085836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Conti HR, Huppler AR, Whibley N, Gaffen SL. Animal models for candidiasis. Current protocols in immunology. 2014;105(1):19.6.1–19. doi: 10.1002/0471142735.im1906s105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Monroy-Pérez E, Paniagua-Contreras GL, Vaca- Paniagua F, Negrete-Abascal E, Vaca S. SAP expression in Candida albicans strains isolated from Mexican patients with vaginal candidiasis. International journal of clinical medicine. 2013;4(1):25–31. [Google Scholar]
  18. Dabiri S, Shams-Ghahfarokhi M, Mehdi Razzaghi-Abyaneh M. SAP(1-3) gene expression in high proteinase producer Candida species strains isolated from Iranian patients with different candidosis. Journal of pure and applied microbiology. 2016;10(3):1891–1896. [Google Scholar]
  19. Zago CE, Silva S, Sanitá PV, Borbugli PA, Dias CM, Lordello VB, Vergani CE. Dynamics of biofilm formation and the interaction between Candidaalbicans and methicillin-susceptible (MSSA) and -resistant Staphylococcus aureus (MRSA) PLoS one. 2015;10(4) doi: 10.1371/journal.pone.0123206. doi: 10.1371/journal.pone.0123206. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Tsang CS, Chu FC, Leung WK, Jin LJ, Samaranayake LP, Siu SC. Phospholipase, proteinase and hemolytic activities of Candida albicans isolated from oral cavities of patients with type 2 diabetes mellitus. Journal of medical microbiology. 2007;56(Pt 10):1393–1398. doi: 10.1099/jmm.0.47303-0. [DOI] [PubMed] [Google Scholar]
  21. Galán-Ladero MA, Blanco MT, Sacristán B, Fernández- Calderón MC, Pérez-Giraldo C, Gómez-García AC. Enzymatic activities of Candida tropicalis isolated from hospitalized patients. Medical mycology. 2010;48(1):207–210. doi: 10.3109/13693780902801242. [DOI] [PubMed] [Google Scholar]
  22. Negri M, Martins M, Henriques M, Svidzinski TIF, Azeredo J, Oliveira R. Examination of potential virulence factors of Candida tropicalis clinical isolates from hospitalized patients. Mycopathologia. 2010;169(3):175–182. doi: 10.1007/s11046-009-9246-0. [DOI] [PubMed] [Google Scholar]
  23. Taghipour S, Rezaei-Matehkolaei A, Zarei Mahmoudabadi A. Antifungal susceptibility profiles of Candida species isolated from Ahvaz Jundishapur educational hospitals. Jundishapur journal of microbiology. 2018;11(11):e78851. [Google Scholar]
  24. Nasution AI. Virulence factor and pathogenicity of Candida albicans in oral candidiasis. World journal of dentistry. 2013;4(4):267–271. [Google Scholar]
  25. Costa CR, Passos XS, Souza LK, Lucena PA, Fernandes Ode F, Silva Mdo R. Differences in exoenzyme production and adherence ability of Candida spp isolates from catheter, blood and oral cavity. Revista do instituto de medicina tropical de são paulo. 2010;52(3):139–143. doi: 10.1590/s0036-46652010000300005. [DOI] [PubMed] [Google Scholar]
  26. Wibawa T. The role of virulence factors in Candida albicans pathogenicity. Journal of medical science. 2016;48(1):58–68. [Google Scholar]
  27. Bruder-Nascimento A, Camargo CH, Mondelli AL, Fátima Sugizaki M, Sadatsune T, Bagagli E. Candida species biofilm and Candida albicans ALS3 polymorphisms in clinical isolates. Brazilian journal of microbiology. 2014;45(4):1371–1377. doi: 10.1590/s1517-83822014000400030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jabra-Rizk MA, Kong EF, Tsui C, Nguyen MH, Clancy CJ, Fidel PL Jr, Noverr M. Candida albicans pathogenesis: fitting within the host-microbe damage response framework. Infection and immunity. 2016;84(10):2724–2739. doi: 10.1128/IAI.00469-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Staniszewska M, Bondaryk M, Siennicka K, Piłat J, Schaller M, Kurzątkowski W. Role of aspartic proteinases in Candida albicans virulence PART II: Expression of SAP 1-10 aspartic proteinase during Candida albicans infection in vivo. Postępy Mikrobiologii. 2012;51(2):127–135. [Google Scholar]
  30. Lima JS, Braga KRGS, Vieira CA R, Souza WWR, Chávez-Pavoni JH, de Araújo C, Goulart LS. Genotypic analysis of secreted aspartyl proteinases in vaginal Candidaalbicans isolates. Jornal brasileiro de patologia e medicina laboratorial. 2018;54(1):28–33. [Google Scholar]
  31. Taylor BN, Staib P, Binder A, Biesemeier A, Sehnal M, Röllinghoff M, Morschhäuser J, Schröppel K. Profile of Candida albicans-secreted aspartic proteinase elicited during vaginal infection. Infection and immunity. 2005;73(3):1828–1835. doi: 10.1128/IAI.73.3.1828-1835.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Chin VK, Lee TY, Rusliza B, Chong PP. Dissecting Candidaalbicans infection from the perspective of C albicans virulence and omics approaches on host–pathogen interaction: a review. International journal of molecular science. 2016;17(10):E1643. doi: 10.3390/ijms17101643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. MacCallum DM, Castillo L, Nather K, Munro CA, Brown AJ, Gow NA, Odds FC. Property differencesamong the four major Candida albicans strain clades. Eukaryotic cell. 2009;8(3):373–387. doi: 10.1128/EC.00387-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Odds FC, Jacobsen MD. Multilocus sequence typing of pathogenic Candida species. Eukaryotic cell. 2008;7(7):1075–1084. doi: 10.1128/EC.00062-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Tavanti A, Davidson AD, Mark J, Fordyce MJ, Gow NAR, Maiden MC, Odds FC. Population structure and properties of Candida albicans, as determined by multilocus sequence typing. Journal of clinical microbiology. 2005;43(11):5601–5613. doi: 10.1128/JCM.43.11.5601-5613.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Asmundsdóttir LR, Erlendsdóttir H, Agnarsson BA, Gottfredsson M. The importance of strain variation in virulence of Candida dubliniensis and Candida albicans: results of a blinded histopathological study of invasive candidiasis. Clinical microbiology and infection. 2009;15(6):576–585. doi: 10.1111/j.1469-0691.2009.02840.x. [DOI] [PubMed] [Google Scholar]

Articles from Iranian Biomedical Journal are provided here courtesy of Pasteur Institute of Iran

RESOURCES