Skip to main content
PLOS One logoLink to PLOS One
. 2020 Aug 3;15(8):e0236944. doi: 10.1371/journal.pone.0236944

Impact of time and temperature on gut microbiota and SCFA composition in stool samples

Janet L Cunningham 1, Ludvig Bramstång 1, Abhijeet Singh 2, Shishanthi Jayarathna 2, Annica J Rasmusson 1, Ali Moazzami 2, Bettina Müller 2,*
Editor: Juan J Loor3
PMCID: PMC7398539  PMID: 32745090

Abstract

Gut dysbiosis has been implicated in the pathophysiology of a growing number of non-communicable diseases. High through-put sequencing technologies and short chain fatty acid (SCFA) profiling enables surveying of the composition and function of the gut microbiota and provide key insights into host-microbiome interactions. However, a methodological problem with analyzing stool samples is that samples are treated and stored differently prior to submission for analysis potentially influencing the composition of the microbiota and its metabolites. In the present study, we simulated the sample acquisition of a large-scale study, in which stool samples were stored for up to two days in the fridge or at room temperature before being handed over to the hospital. To assess the influence of time and temperature on the microbial community and on SCFA composition in a controlled experimental setting, the stool samples of 10 individuals were exposed to room and fridge temperatures for 24 and 48 hours, respectively, and analyzed using 16S rRNA gene amplicon sequencing, qPCR and nuclear magnetic resonance spectroscopy. To best of our knowledge, this is the first study to investigate the influence of storage time and temperature on the absolute abundance of methanogens, and of Lactobacillus reuteri. The results indicate that values obtained for methanogens, L. reuteri and total bacteria are still representative even after storage for up to 48 hours at RT (20°C) or 4°C. The overall microbial composition and structure appeared to be influenced more by laboratory errors introduced during sample processing than by the actual effects of temperature and time. Although microbial activity was demonstrated by elevated SCFA at both 4°C and RT, SCFAs ratios were more stable over the different conditions and may be considered as long as samples are come from similar storage conditions.

Introduction

The gut microbiota (GM) has become of increasing interest as gut dysbiosis has been implicated in the pathophysiology or exacerbation of a growing number of non-communicable diseases including diabetes mellitus, obesity, allergies, rheumatoid arthritis, inflammatory bowel disease, liver disease, colorectal cancer, Parkinson’s disease, Alzheimer’s disease, multiple sclerosis, autism spectrum disorder, depression and anxiety disorders [1–7]. The gut-brain-axis pertains to the bidirectional communication between gut microbiota and the central nervous system through neural, endocrine, immunological and metabolic means. Short-chain fatty acids (SCFAs) are the main metabolic products from bacterial fermentation in the intestine, and have a key role in microbiota-gut-brain cross talk [8]. The human microbiota consists of at least 1 000 species of bacteria with varying compositions and densities at different sites, as well as protozoa, viruses and fungi [9]. DNA sequencing technologies including 16S rRNA gene based amplicon sequencing is the main approach used to study microbial diversity, and to understand the role of the gut microbiome in human health and disease. A methodological problem with analyzing stool samples, however, is that the logistics of collecting samples can vary dramatically between the subjects which may influence the composition of the microbiota and its metabolic products. The current understanding is that time and temperature appears to have a low, but not negligible impact on bacterial composition and structure in stool samples [10–15]. Immediate freezing of samples at -20°C is considered to be the “gold standard”, but might not always be practically feasible. A number of fecal collection methods including immediate addition of preservation solutions such as ethanol or RNA stabilizers or direct application of commercial kits such as the OMNIgene•GUT have been tested and found to be comparable to the reference of instant freezing at least when analyzing more abundant taxa [11–13, 15, 16]. Although most of these collection methods are “participant-friendly”, participants are not always able to follow the instructions. Moreover, a vast amount of stool samples may have been collected and stored in repositories without any immediate preservation. In an ongoing large-scale study, we are aiming to explore the role of the gut microbiota and SCFAs in depression and mood disorders. We have, however, observed differences between the patients in terms of storage conditions before the time point for sample submission. To estimate to which degree different management of samples prior to freezing and without preservation might influence the results of future studies, the effect of different temperatures over time on microbial composition and SCFA profile of stool samples needs to be further investigated.

The evidence in the literature on this topic is very limited and, to our knowledge, there is no study done regarding this matter relating specifically to low abundant groups such as methanogens and Lactobacilli. Lactobacillus spp. are found in the gastrointestinal systems in variable amounts depending on species and age and has gained increasing attention due to their probiotic attributes [17–19]. The role of methanogens in human health and the possible association to infections and diseases are still poorly understood but a mounting body of evidences suggest a significant role [20–24]. Methanogens play an important role in removing excess hydrogen gas from the gut and improving efficiency of microbial fermentation, but also alter the SCFA production [25]. The impact of time and temperature on the SCFA concentration in stool samples, collected without an immediate preservation method, has been insufficiently studied. Recent studies reported rapid changes of the SCFA level in stool samples stored at RT and several human fecal sample collection protocols have been proposed [15, 26, 27]. So far, no conclusions have been drawn for the consideration of SCFA data originating from stool specimens that could not be obtained in accordance with proposed protocols.

The primary aim of this methodological study was to analyze the impact of time and temperature on the absolute abundance of methanogens, Lactobacillus reuteri, as well as total bacteria, overall microbial composition and the SCFA profile. This would facilitate the determination of reliable thresholds that can be potentially useful in larger studies, where uniform sample collection conducted at home cannot be guaranteed. For doing so, we have chosen times and temperatures for sample storage before being handed-over to the hospital that are within the range of those reported by some participants in our large-scale studies.

Material and methods

Ethics and subject recruitment

The study includes ten subjects. To facilitate the collection of fresh samples, we recruited five patients from a psychiatric ward where they were undergoing treatment for affective disorders. Samples from patients were collected from the Uppsala Psychiatric Patient Samples (UPP) Framework approved by the Regional Ethics Committee in Uppsala: (Dnr 2012/81, 2012-03-21, Dnr 2012/81/1, 2012-12-20, Dnr 2013/219). Written informed consent was obtained from patients for material collection. The results from these samples are not linked to individual factors in this study. Additionally, five medical students without any specific inclusion or exclusion criteria participated voluntary and without any compensation. They contributed to this study anonymously and their data cannot be tied to specific subjects. They gave verbal informed consent for their donated samples to be analyzed anonymously with the purpose of method development and neither samples nor data can be traced back to control individuals. The Regional Ethics Committee waived the need for consent in this case in accordance with Swedish law.

Sample management

The subjects were given instructions to store their sample in fridge or cooler immediately upon acquiring and then initiate contact for transportation. Samples were collected within 4 hours and transported at < 4°C using a cooling bag with ice clamps. After arrival at the laboratory, the samples were mechanically homogenized with a sterile spatula, aliquoted into five Nunc Cryotube Vials™ and entered into the storing protocol including five storage conditions: the first aliquot was frozen immediately at -20°C (1), the second was frozen after keeping it 24 hours at room temperature (RT) (20–21°C) (2), the third after 48 hours at room temperature (3), the fourth after 24 hours at 4°C (4), and the fifth was frozen after 48 hours at 4°C (5). DNA was extracted from all frozen samples within 48–96 hours after completion of the storing protocol.

DNA purification

DNA was extracted using the QIAamp© Fast DNA Stool Mini Kit including an additional bead-beating step: 200±1 mg stool was weighed in Lysing Matrix E tubes (MPBiomedicals™) and placed on ice. One ml of InhibitEX Buffer was added and the sample was vortexed continuously for 1 min. The tube was placed in a FastPrep Instrument (MPBiomedicals™) for 40 seconds at speed setting 6.0, and centrifuged at 14 000 x g for 10 minutes. Then, 600 μl of the obtained supernatant was transferred into a new microcentrifuge tube and treated as described in the manufacturer´s protocol. The DNA concentration was approximated using Qubit© fluorometer dsDNA protocol (Invitrogen). DNA was purified in triplicates from every storage condition except for three samples due to insufficient material. Out of these three, one was purified in duplicates for all conditions (sample B), and two were purified in triplicates but covering only storage condition 1, 4 and 5 (sample I, and J).

Quantitative PCR (qPCR)

Absolute quantification using qPCR was performed for total bacteria, methanogenic archaea, and Lactobacillus reuteri. Methanogens were quantified using the group specific primers Met630f and Met803r [28], L. reuteri by using species specific primers [29] and total bacteria by using the primers Eub338 (ACTCCTACGGGAGGCAGCAG) and Eub518 (ATTACCGCGGCTGCTGG) [30, 31]. Before quantification, qPCRs were done with DNA dilutions ranging from 1:10, 1:20, 1:100, 1:500, and 1:1 000 including all primer sets in order to determine the dilution factor required for diminishing inhibitory factors, whilst remaining within the range of standard curve. Quantification of all DNA samples was performed in duplicates using two DNA dilutions (determined before as appropriate) using a Bio-Rad iQ5 multicolour real-time PCR detection system and the IQTM SYBR® Green Supermix (Bio-Rad laboratories, Inc.). qPCR reactions were set up to a final volume of 20 μL containing the following components: 2x IQTM SYBR® Green Supermix, 10 μM each forward and reverse primers, 3 μL DNA template and 5 μL milliQ water. Four to six non-template controls were included in each assay. Plasmid-coded partial 16S rRNA gene originating from methanogens (Methanoculleus bourgensis), bacteria (Escherichia coli) and L. reuteri, respectively were used as standard curves and applied in 108 to 101 copy numbers. The program used was as follows: initial temperature 95°C for 7 minutes, followed by 40 cycles at 95°C for 40 s, 60°C (L. reuteri 64°C) for 60 s (L. reuteri 30 s) and 72°C for 40 s (L. reuteri 30 s). The specificity of the PCR product was estimated by melting curve analysis, which consisted of 50 gradual denaturation cycles. The temperature range was set from 55 to 95°C, dwelled 10 s and increased 0.5°C in each cycle. PCR products were additionally checked by gel electrophoresis. The data generated were collected and analyzed with Bio-Rad iQ5 standard edition optical system software (version 2.0), from which sorted data were exported to Microsoft Excel for further analysis. Final values can be found in the supplementary file.

Preparation of libraries for Illumina amplicon sequencing

16S rRNA amplicon libraries were constructed as triplicates using two consecutive PCR procedures as described in [32]. The first PCR simultaneously targeted the V4 region of both bacteria and archaea, using the primers 515F (ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNGTGBCAGCMGCCGCGAA) and 805R (AGACGTGTGCTCTTCCGATCTGGACTACHVGGGTWTCTAAT) and attaches adaptors to the amplicons [32]. The reaction mixture contained 2x Phusion High-Fidelity DNA Polymerase/dNTP mix (Thermo Fischer Scientific, Hudson, NH, USA), 10 μM of each primer, and approx. 10 ng DNA template in a final volume of 25 μL. The condition for amplification was as following: initial denaturing at 98°C for 30 s, 20 cycles of 10 s at 98°C, 30 s at 60°C, 4 s at 72°C, and a final extension at 72°C for 2 min. The PCR products were checked for size and quality by electrophoresis. Amplicons were purified using Agencourt AMPure XP (Becker Coulter, Brea, CA, USA), using a magnetic particle/DNA volume ratio of 0.8:1. In the second PCR, Illumina-compatible barcodes were added to the amplicons. The PCR reaction contained 10 μL purified amplicon from the first step, 2x Phusion High-Fidelity DNA Polymerase/dNTP mix and 10 μM each of the primers 5’-AATGATACGGCGACCACCAGATCTACACX8ACACTCTTTCCCTACACGACG-3’ and 5’-CAAGCAGAAGACGGCATACGAGATX8GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’, where X8 in the primer sequence represented a specific Illumina-compatible barcode (Eurofins Genomics). The following conditions were used for the second PCR step: initial denaturing at 98°C for 30 s, 8 cycles of 10 s at 98°C, 30 s at 62°C, 5 s at 72°C, and a final extension at 72°C for 2 min. The PCR products were checked by electrophoresis and purified using Agencourt AMPure XP. The PCR products were then each diluted to a DNA concentration of approx. 30 nM and pooled together. Pair-end sequencing was performed on the MiSeq platform (Illumina, Inc., San Diego, CA, USA) at Eurofins GATC Biotech GmbH (Konstanz, Germany) resulting in an average of 110 000 raw reads per sample. Due to poor read quality the samples H, 4°C 24h and H, 4°C 48h have not been considered for further analyses. Illumina adapters and primers have been trimmed away using Cutadapt version 2.2 [33]. All reads shorter than 250 base-pairs (bp), longer than 300 bp or untrimmed were discarded. Amplicon sequence variants, abundancies and taxonomic affiliation were determined using the package dada2 (version 1.6.0) [34] in R (version 3.4.0), which is implemented on the SLUBI computing cluster in Uppsala (running on CentOS Linux release 7.1.1503; module handling by Modules based on Lua: Version 6.0.1; https://www.slubi.se/). Trimming and filtering was jointly performed on paired-end reads. Low quality reads were removed by setting the maximum number of expected errors to 2. The remaining sequence reads were denoised, dereplicated, merged and checked for chimeras in package dada2 according to the DADA2 pipeline tutorial (https://benjjneb.github.io/dada2/tutorial_1_8.html). Taxonomic classification of the 16S ribosomal RNA sequence variants and a phylogenetic tree were obtained by using the Silva taxonomic training dataset v132 formatted for DADA2 (https://zenodo.org/record/1172783/files/silva_nr_v132_train_set.fa.gz; https://zenodo.org/ record/1172783/files/silva_species_assignment_v132.fa.gz). A phyloseq object was created consisting of the taxonomy table and the OTU table and used for the visualization with package phyloseq (version 1.30.0) [35]. The sequence variants were extracted and a phylogenetic tree was generated using default parameters in FastTree (version 2.1.0) [34]. Sample metadata and phylogenetic tree were merged with the phyloseq object and visually analyzed by using the package phyloseq and ggplot2 (version 3.2.1) [35] in R Studio version 3.5.2 (http://www.r-project.org). Weighted Unifrac distances were calculated by function Unifrac in package phyloseq and used to plot the ordination in a Principal coordinate analysis plot with the function cmdscale in package stats (version 3.6.2) in R core packages. Experimental environmental factors were fitted to the ordination plot by using function envfit in package vegan (version 2.5.6) [36]. The sequencing raw data has been submitted to NCBI sequence read archive (SRA) under the BioProject accession number PRJNA609715.

Analysis of short chain fatty acids (SCFA)

SCFA has been analyzed using nuclear magnetic resonance (NMR) spectroscopy. Between 200–250 mg stool sample was diluted with 0.75 mL sodium phosphate buffer (0.4 M, pH 7.0), homogenized by using a vortex and centrifuged at 6300 rpm at 4°C for 15 min. From the supernatant, 0.75 mL of fecal water has been transferred to a fresh tube and subjected to centrifugation at 20 000 ×g at 4°C for 15 min. This step was repeated once with 600 μL of supernatant recovered from the previous centrifugation. Finally, 525 μL of the supernatant was mixed with 45 μL D2O, and 30 μL internal standard. Each sample solution (560 μL) was transferred to a 5 mm NMR tube, and the 1H NMR spectra were acquired using a Bruker Avance III spectrometer operating at 600 MHz proton frequency and equipped with a cryogenically cooled probe and an auto sampler. Each spectrum was recorded (25°C, 128 transients, acquisition time 1.8 s, relaxation delay 4 s) using a zgesgp pulse sequence (Bruker Biospin) using excitation sculpting with gradients for suppression of the water resonance. For each spectrum, 65 536 data points were collected over a spectral width of 17 942 Hz [37]. All NMR spectra were processed using Bruker TopSpin 4.1 software. The data were Fourier-transformed after multiplication by a line broadening of 0.3 Hz and referenced to internal standard peak TSP at 0.0 ppm. Baseline and phase were corrected manually. Each spectrum was integrated using Amix 3.7.3 (Bruker BioSpin GmbH, Rheinstetten, Germany) into 0.01-ppm integral regions between 0.5 and 10 ppm, in which areas between 4.52–5.06 ppm were excluded. Each integral region was referenced to the internal standard. The integral regions corresponding to short chain fatty acids were adjusted for mg of stool samples extracted and used for further statistical analysis. Five samples were analyzed using less amount than 250 mg stool respectively. Absolute numbers and calculation can be found in the supplementary file.

Statistics

Friedman’s test for related samples was performed. A p-value of less than 0.05 was considered significant.

Results

Effect of storage condition on the microbial community composition

Sufficient starting material and high quality raw read data were available to compare microbial changes between immediately frozen and storage for 24 h at RT for 8 individuals; changes between frozen and storage for 48 h at RT for 10 individuals, changes between frozen and storage for 24 h at 4°C for 7 individuals, and changes between frozen and storage for 48 h at 4°C for 9 individuals. In order to evaluate changes in the microbial structure and composition over time both alpha and beta diversity have been analysed. The alpha diversity indices Shannon and Simpson indicated small changes in the community structure for most of the samples considering the scaling (Fig 1). Larger variations were observed for individuals E, F, H. However, the variance in alpha diversity within the triplicates was in part much higher than that observed between aliquots of different storage conditions (S1 Fig).

Fig 1.

Fig 1

Variation in alpha diversity (Simpson (A) and Shannon (B)) displayed as box plot of individuals A-J. Extended lines indicate variability outside the upper and lower quantity of the box, whereas outliers are plotted as individual points. Blue: immediately frozen samples, orange: 4°C, red: 20°C.

Principal coordinate analysis (PCoA) using the weighted UniFrac matrix was used to compare the beta diversity. Most individuals showed variations in the community composition when comparing the differently stored stool samples. Although the majority of them did not form clear clusters with regard to the different storage temperatures, the PCoA revealed little influence of time and temperature on the microbial composition, as indicated by the arrows (Fig 2).

Fig 2. PCoA plot of weighted UniFrac distance.

Fig 2

Principal coordinate analysis displaying beta diversity of the bacterial communities in the stool samples of 10 individuals. blue: frozen, orange: 4°C, red: 20°C. Ellipses indicate the individuals.

Effect of storage condition of absolute abundance of total bacteria, methanogens and Lactobacillus reuteri

Generally, only marginal variations of the 16S rRNA gene copy numbers were observed in case of all three targets, independently if frozen immediately or stored at 4°C or RT for up to 48 h (Figs 3 and 4). The average deviations from the immediately frozen sample were between 1.6 and 2.3% (±2.5–3.2) in case of methanogens, 0.2 and 0.8% (±0.9–1.8) in case of total bacteria, and 2.0 and 3.2% (±2.2–2.8%) in case of L. reuteri (Table 1).

Fig 3.

Fig 3

Absolute 16S rRNA gene copy numbers of total methanogens (A) and total bacteria (B) from stool samples retrieved from individuals A-J, stored at the conditions as indicated in the legend. Frozen stands for immediately frozen at -20°C.

Fig 4. Absolute 16S rRNA gene copy numbers of L. reuteri from stool samples retrieved from individuals B, E, G, and I, stored at the conditions as indicated in the legend.

Fig 4

Frozen stands for immediately frozen at -20°C.

Table 1. Average deviation in percent (%) of absolute 16S rRNA gene copies from initial values obtained from untreated (immediately frozen) samples.

Detailed list of values can be found in S1 Appendix.

4ºC_24h 4ºC_48h RT_24h RT_48h
Methanogens 2.0±3.2 2.3±3.2 1.6±2.5 2.3±2.5
Total bacteria 0.7±1.8 0.2±1.6 0.5±0.9 0.8±1.5
L. reuteri 2.0±2.2 2.9±2.8 2.5±2.2 3.2±2.3

L. reuteri was found in sufficiently high numbers in only four out of ten samples to be above the detection limit of qPCR and to exclude inhibitory effects (Fig 4). No significant effect of storage time or temperature on the absolute abundance of methanogens or L. reuteri was observed (Figs 3 and 4, Table 1). A small significant difference (p = 0.024) in total bacteria (0.8%) was found between immediately frozen and RT_48h samples (S1 Appendix, Fig 3B, Table 1).

Effect of storage condition on the SCFA acetate, propionate and butyrate

Although all participants contributing to this study received detailed instructions on the amount/volume of sample to be delivered, only five stool samples contained sufficient material to examine both the microbial community and the SCFA composition. These five stool samples were subjected to SCFA analysis using NMR. Storage at RT had a dramatic effect on levels of acetate, propionate and butyrate (S2 Fig). Already the storage for 24 hours at RT promoted an increase of all three SCFA to more than 100% in some cases when compared to values obtained from immediately frozen stool sample.

Acetate values partly increased by more than 150%. The mean average deviation from the initial value (immediately frozen) for acetate, propionate and butyrate were between 94 to 105% (±35%-45%) after 48 h (Table 2). However, also storage at 4°C led to an increase of all three SCFA in four out of five samples albeit to a lesser extent (S2 Fig). In one sample, the concentration of SCFAs dropped during storage at 4°C. The average deviation for all SCFA from initial values was between 14 and 20% (±10–19%) after 24 h at 4°C considering both increase and decrease (Table 2). Storage up to 48 h resulted in slightly further increase of the average deviation (Table 2). However, when calculating SCFA ratios the picture changed.

Table 2. Average deviation +/- standard deviation of SCFA in percent from initial values obtained from immediately frozen samples.

Detailed list can be found in the supplementary file.

frozen → 4°C_24h frozen → 4°C_48h frozen → RT_24h frozen → RT_48h
Acetate 20 ±10 28 ±18 99 ±67 105 ±36
Butyrate 14 ±19 18 ±9 67 ±45 94 ±45
Propionate 15 ±13 21 ±12 76 ±30 102 ±38
Butyrate/Acetate 19 ±8 17 ±6 15 ±13 19 ±7
Butyrate/Propionate 9 ±3 12 ±10 30 ±28 18 ±20
Butyrate/(Acetate+Propionate) 18 ±7 15 ±6 14 ±12 16 ±6
Acetate/(Acetate+Propionate+Butyrate) 3 ±1 3 ±2 3 ±3 4 ±1
Propionate/(Acetate+Propionate+Butyrate) 7 ±2 7 ±4 10 ±8 9 ±4
Butyrate/(Acetate+Propionate+Butyrate) 17 ±7 15 ±6 14 ±11 15 ±6

(Fig 5): For the majority of the calculated ratios the mean standard deviation remains below 20% when compared to the respective ratios obtained for the immediately frozen sample (Table 2, Fig 5, S2 and S3 Figs). The average deviation from the initial value was least pronounced in those ratios containing more than one SCFA in the divisor. The ratios acetate/(acetate+propionate+butyrate) and propionate/(acetate+propionate+butyrate) differ by less than 10% from the ratios obtained from immediately frozen samples (Table 2, Fig 5, S2 and S3 Figs). Most important and in contrast to the absolute values, the majority of the SCFA ratios indicate a much less pronounced impact of increased temperature or storage time on the SCFA levels. The observed variations in the SCFA ratios remain comparatively independent of temperature and how long a sample was stored before extraction. There was no statistically significant difference between the SCFA ratios with respect to sample handling (see Fig 5, lower panels).

Fig 5. Deviation of SCFA ratios in % from those ratios obtained from the immediately frozen samples displayed as box plots.

Fig 5

Blue: samples stored at 4°C up to 48 h, red: samples stored at 20°C up to 48 h. Extended lines indicate variability outside the upper and lower quantity of the box, whereas outliers are plotted as individual points. Ratios are also displayed in S2 and S3 Figs. Calculations and values can be found in the supplementary file (S1 Appendix).

Discussion

It is generally not recommended to store fecal samples at RT or longer than 12 h at 4°C since metabolism and proliferation of some bacteria might continue, with consequences on microbial structure and SCFA profile. Moreover, the intake of oxygen might damage strictly anaerobic microorganisms [38]. A number of attempts have been made to determine the optimal collection method to preserve microbial community and metabolic composition. Direct freezing at -80°C is considered the reference method, however is not feasible for many settings. Instead, a -20°C freezer is available in most homes and freezing at -20°C may also be applied [38, 39] but this requires willingness to place samples in the freezer and resources for shipping the samples in a frozen state. Several studies reported positive effects of preservation media and stabilizers [11–16]. However, even if patients are asked to describe how samples were handled before submission to the laboratory, it is difficult to have complete control over what has happened and samples, for diverse reasons, may have been exposed to room temperature for hours before reaching the laboratory. There are only few studies that looked at the effects of short-term storage conditions on unpreserved microbial community and those came to different conclusions [10, 12, 39–41]. Ott et al reported a significant reduction of both bacterial diversity and total number of bacteria after already 8 h at both 4°C and RT and Cardona et al observed alterations in the relative abundance across most taxa when fecal sample were subjected to RT for 24 h [39, 41]. On the other hand, two studies reported only minor alterations in taxa abundances when stored at both 4°C or RT for up to 24 h [10, 12]. Lauber et al. reported stability of the microbiota even for up to 14 days at 4°C and 20°C [40].

In the present study, we simulated the sample acquisition of a large-scale study, in which some patients reported storing stool samples for up to two days in the fridge or at room temperature before handed over to the hospital. To our knowledge, this is the first study evaluating the impact of storage time and temperature on the absolute abundance of methanogens, and of L. reuteri in particular. Methanogens are extremely oxygen sensitive and even trace amount of oxygen causes stress to most of methanogenic species by damaging the cell membrane and proteins [42]. However, we could demonstrate that the absolute abundance of Methanogens appeared stable at both RT and 4°C for up to 48 h. Only small variation occurred, which did not correlate to time or temperature. The same findings were observed for Lactobacillus reuteri, which is facultative anaerobe and might be therefore able to proliferate under certain conditions. Alpha diversity indices and PCoA plots indicated small changes in the overall microbial community, when stored at 4°C or RT for up to 24 h, which is in agreement with the findings of Ott and Caroll [10, 41]. We also found that even a prolonged storage up to 48 h did not significantly alter the microbial composition any further. The variations observed within the triplicates indicates that other factors including differences in sample handling, PCR and sequencing may also account for the observed alterations in the microbial community. This is further supported by the finding that the total number of bacteria remained stable over time, even if a significant decrease was found after 48 h at RT. However, the effect of this decrease was considered very small and less than 1%. This is contradictory to Ott et al who reported a dramatic reduction of total bacteria, however the different techniques used might not allow a direct comparison of the results [41]. Although the composition and structure of the microbial community has only changed little over time, the community still appeared to be active, especially at RT. The absolute levels of acetate, propionate and butyrate increased dramatically within 24 hours, indicating general metabolic activities. Even storage at 4°C could not completely suppress metabolic activities, but proved to be clearly beneficial. Interestingly enough, the effect of time and temperature was strongly diminished when looking at ratios instead of absolute values. Obviously, the SCFAs increase almost proportionally with time at both 4°C and in RT, so that the factors time and temperature became irrelevant. This means that samples collected cool or kept at RT can be compared to each other, but not with immediately frozen samples. The deviations from the immediately frozen samples were only negligible for the ratio acetate/(acetate+propionate+butyrate). A direct comparison with frozen samples should only be considered taking into account the threshold values identified here as mean deviations. Several other studies show that the immediate preservation by e.g. ethanol or RNAlater can replace an immediate freezing of the samples [15, 43]. However, this may not always be feasible. The results found here can thus support those studies that cannot implement immediate freezing or stabilizing methods, but still want to integrate metabolomics.

Conclusions

By analyzing the impact of storage time and temperature, we conclude that realistic values for the absolute abundance of methanogens, L. reuteri and total bacteria can still be obtained even after storage for up to 48 hours at RT or 4°C. The overall microbial composition appears to be influenced more by laboratory error introduced during sample processing than by the actual effects of storage temperature and time. Although significant microbial activities have been demonstrated at both 4°C and RT, the SCFAs may be considered as long as these are taken into account as ratios and originated from similar storage conditions.

Supporting information

S1 Fig. Alpha diversity (Simpson and Shannon) of the replicates displayed as box plot at the different time points and temperatures analyzed.

Individuals are indicated by different colors and capitals A-J. Extended lines indicate variability outside the upper and lower limits of the box, whereas outliers are plotted as individual points.

(JPEG)

S2 Fig. Effect of time and temperature on SCFA concentrations and SCFA ratios displayed as average deviation from the initial values obtained from immediately frozen samples.

(PDF)

S3 Fig. Deviation of SCFA ratios in % from those ratios obtained from the immediately frozen samples after 24 h and 48h displayed as box plots.

Blue: samples stored at 4°C, red: samples stored at 20°C. Extended lines indicate variability outside the upper and lower quantity of the box, whereas outliers are plotted as individual points.

(TIFF)

S1 Appendix. Data obtained from short chain fatty acid and qPCR analyses can be found in the supplementary file “S1_Appendix”.

(XLSX)

Data Availability

The sequencing raw data has been submitted to NCBI sequence read archive (SRA) under the BioProject accession number PRJNA609715.

Funding Statement

Funding for this study was obtained by Janet Cunningham from the Ekhaga foundation (http://www.ekhagastiftelsen.se), The Swedish Society of Medicine (https://www.sls.se); and ALF Funds from Uppsala University Hospital (https://www.akademiska.se). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Cong J, Zhang X: How human microbiome talks to health and disease. European journal of clinical microbiology & infectious diseases: official publication of the European Society of Clinical Microbiology 2018, 37(9):1595–1601. [DOI] [PubMed] [Google Scholar]
  • 2.Dwivedi M, Ansarullah, Radichev I, Kemp EH: Alteration of Immune-Mechanisms by Human Microbiota and Development and Prevention of Human Diseases. Journal of immunology research 2017, 2017:6985256 10.1155/2017/6985256 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Kang DW, Adams JB, Gregory AC, Borody T, Chittick L, Fasano A, et al. : Microbiota Transfer Therapy alters gut ecosystem and improves gastrointestinal and autism symptoms: an open-label study. Microbiome 2017, 5(1):10 10.1186/s40168-016-0225-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Kushak RI, Winter HS: Intestinal microbiota, metabolome and gender dimorphism in autism spectrum disorders. Research in Autism Spectrum Disorders 2018, 49:65–74. [Google Scholar]
  • 5.Szablewski L: Human Gut Microbiota in Health and Alzheimer's Disease. Journal of Alzheimer's disease: JAD 2018, 62(2):549–560. 10.3233/JAD-170908 [DOI] [PubMed] [Google Scholar]
  • 6.Yang Y, Tian J, Yang B: Targeting gut microbiome: A novel and potential therapy for autism. Life sciences 2018, 194:111–119. 10.1016/j.lfs.2017.12.027 [DOI] [PubMed] [Google Scholar]
  • 7.Zheng P, Zeng B, Zhou C, Liu M, Fang Z, Xu X, et al. : Gut microbiome remodeling induces depressive-like behaviors through a pathway mediated by the host's metabolism. Molecular psychiatry 2016, 21(6):786–796. 10.1038/mp.2016.44 [DOI] [PubMed] [Google Scholar]
  • 8.Clarke G, Stilling RM, Kennedy PJ, Stanton C, Cryan JF, Dinan TG: Minireview: Gut microbiota: the neglected endocrine organ. Molecular endocrinology (Baltimore, Md) 2014, 28(8):1221–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gilbert JA, Blaser MJ, Caporaso JG, Jansson JK, Lynch SV, Knight R: Current understanding of the human microbiome. Nature medicine 2018, 24(4):392–400. 10.1038/nm.4517 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Carroll IM, Ringel-Kulka T, Siddle JP, Klaenhammer TR, Ringel Y: Characterization of the fecal microbiota using high-throughput sequencing reveals a stable microbial community during storage. PLoS ONE 2012, 7(10):e46953 10.1371/journal.pone.0046953 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Flores R, Shi J, Yu G, Ma B, Ravel J, Goedert JJ, et al. : Collection media and delayed freezing effects on microbial composition of human stool. Microbiome 2015, 3:33 10.1186/s40168-015-0092-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Penington JS, Penno MAS, Ngui KM, Ajami NJ, Roth-Schulze AJ, Wilcox SA, et al. : Influence of fecal collection conditions and 16S rRNA gene sequencing at two centers on human gut microbiota analysis. Scientific reports 2018, 8(1):4386 10.1038/s41598-018-22491-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Szopinska JW, Gresse R, van der Marel S, Boekhorst J, Lukovac S, van Swam I, et al. : Reliability of a participant-friendly fecal collection method for microbiome analyses: a step towards large sample size investigation. BMC Microbiol 2018, 18(1):110 10.1186/s12866-018-1249-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vogtmann E, Chen J, Amir A, Shi J, Abnet CC, Nelson H, et al. : Comparison of Collection Methods for Fecal Samples in Microbiome Studies. American journal of epidemiology 2017, 185(2):115–123. 10.1093/aje/kww177 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Wang Z, Zolnik CP, Qiu Y, Usyk M, Wang T, Strickler HD, et al. : Comparison of Fecal Collection Methods for Microbiome and Metabolomics Studies. Frontiers in cellular and infection microbiology 2018, 8:301 10.3389/fcimb.2018.00301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Voigt AY, Costea PI, Kultima JR, Li SS, Zeller G, Sunagawa S, et al. : Temporal and technical variability of human gut metagenomes. Genome Biol 2015, 16:73 10.1186/s13059-015-0639-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Duar RM, Lin XB, Zheng J, Martino ME, Grenier T, Perez-Munoz ME, et al. : Lifestyles in transition: evolution and natural history of the genus Lactobacillus. FEMS Microbiol Rev 2017, 41(Supp_1):S27–s48. 10.1093/femsre/fux030 [DOI] [PubMed] [Google Scholar]
  • 18.Giraffa G, Chanishvili N, Widyastuti Y: Importance of lactobacilli in food and feed biotechnology. Research in microbiology 2010, 161(6):480–487. 10.1016/j.resmic.2010.03.001 [DOI] [PubMed] [Google Scholar]
  • 19.Mu Q, Tavella VJ, Luo XM: Role of Lactobacillus reuteri in Human Health and Diseases. Front Microbiol 2018, 9:757 10.3389/fmicb.2018.00757 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Attaluri A, Jackson M, Valestin J, Rao SS: Methanogenic flora is associated with altered colonic transit but not stool characteristics in constipation without IBS. The American journal of gastroenterology 2010, 105(6):1407–1411. 10.1038/ajg.2009.655 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bang C, Weidenbach K, Gutsmann T, Heine H, Schmitz RA: The intestinal archaea Methanosphaera stadtmanae and Methanobrevibacter smithii activate human dendritic cells. PLoS ONE 2014, 9(6):e99411 10.1371/journal.pone.0099411 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pimentel M, Mayer AG, Park S, Chow EJ, Hasan A, Kong Y: Methane production during lactulose breath test is associated with gastrointestinal disease presentation. Digestive diseases and sciences 2003, 48(1):86–92. 10.1023/a:1021738515885 [DOI] [PubMed] [Google Scholar]
  • 23.Weaver GA, Krause JA, Miller TL, Wolin MJ: Incidence of methanogenic bacteria in a sigmoidoscopy population: an association of methanogenic bacteria and diverticulosis. Gut 1986, 27(6):698–704. 10.1136/gut.27.6.698 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zhang H, DiBaise JK, Zuccolo A, Kudrna D, Braidotti M, Yu Y, et al. : Human gut microbiota in obesity and after gastric bypass. Feb 15 2009, 106(7):2365–2370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Abell GCJ, Conlon MA, McOrist AL: Methanogenic archaea in adult human faecal samples are inversely related to butyrate concentration. Microbial Ecology in Health and Disease 2006, 18(3–4):154–160. [Google Scholar]
  • 26.Liebisch G, Ecker J, Roth S, Schweizer S, Öttl V, Schött HF, et al. : Quantification of Fecal Short Chain Fatty Acids by Liquid Chromatography Tandem Mass Spectrometry-Investigation of Pre-Analytic Stability. Biomolecules 2019, 9(4). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gratton J, Phetcharaburanin J, Mullish BH, Williams HRT, Thursz M, Nicholson JK, et al. : Optimized Sample Handling Strategy for Metabolic Profiling of Human Feces. Analytical chemistry 2016, 88(9):4661–4668. 10.1021/acs.analchem.5b04159 [DOI] [PubMed] [Google Scholar]
  • 28.Christophersen CT: Ph.D. University of Western Australia, Perth 2007.
  • 29.Matsuda K, Tsuji H, Asahara T, Matsumoto K, Takada T, Nomoto K: Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules. Appl Environ Microbiol 2009, 75(7):1961–1969. 10.1128/AEM.01843-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lane DJ: 16S/23S rRNA sequencing Stackebrandt E and Goodfellow M, Eds, Nucleic Acid Techniques in Bacterial Systematic, John Wiley and Sons, New York: 1991:115–175. [Google Scholar]
  • 31.Muyzer G, de Waal EC, Uitterlinden AG: Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 1993, 59(3):695–700. 10.1128/AEM.59.3.695-700.1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Hugerth LW, Wefer HA, Lundin S, Jakobsson HE, Lindberg M, Rodin S,et al. : DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies. Appl Environ Microbiol 2014, 80(16):5116–5123. 10.1128/AEM.01403-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Martin M: Cutadapt removes adapter sequences from high-throughput sequencing reads. 2011 2011, 17(1):3. [Google Scholar]
  • 34.Price MN, Dehal PS, Arkin AP: FastTree 2—approximately maximum-likelihood trees for large alignments. PLoS ONE 2010, 5(3):e9490 10.1371/journal.pone.0009490 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wickham H: ggplot2: Elegant Graphics for Data Analysis. Journal of Statiscal Software 2016. [Google Scholar]
  • 36.Jari Oksanen FGB, Michael Friendly, Roeland Kindt, Pierre Legendre, Dan McGlinn, Peter R. Minchin, et al. : 2018, vegan: Community Ecology Package. [Google Scholar]
  • 37.Rohnisch HE, Eriksson J, Mullner E, Agback P, Sandstrom C, Moazzami AA: AQuA: An Automated Quantification Algorithm for High-Throughput NMR-Based Metabolomics and Its Application in Human Plasma. Analytical chemistry 2018, 90(3):2095–2102. 10.1021/acs.analchem.7b04324 [DOI] [PubMed] [Google Scholar]
  • 38.Thomas V, Clark J, Dore J: Fecal microbiota analysis: an overview of sample collection methods and sequencing strategies. Future microbiology 2015, 10(9):1485–1504. 10.2217/fmb.15.87 [DOI] [PubMed] [Google Scholar]
  • 39.Cardona S, Eck A, Cassellas M, Gallart M, Alastrue C, Dore J, et al. : Storage conditions of intestinal microbiota matter in metagenomic analysis. BMC Microbiology 2012, 12(1):158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Lauber CL, Zhou N, Gordon JI, Knight R, Fierer N: Effect of storage conditions on the assessment of bacterial community structure in soil and human-associated samples. FEMS Microbiol Lett 2010, 307(1):80–86. 10.1111/j.1574-6968.2010.01965.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ott SJ, Musfeldt M, Timmis KN, Hampe J, Wenderoth DF, Schreiber S: In vitro alterations of intestinal bacterial microbiota in fecal samples during storage. Diagnostic microbiology and infectious disease 2004, 50(4):237–245. 10.1016/j.diagmicrobio.2004.08.012 [DOI] [PubMed] [Google Scholar]
  • 42.Jarrell KF: Extreme Oxygen Sensitivity in Methanogenic Archaebacteria. BioScience 1985, 35(5):298–302. [Google Scholar]
  • 43.Loftfield E, Vogtmann E, Sampson JN, Moore SC, Nelson H, Knight R, et al. : Comparison of Collection Methods for Fecal Samples for Discovery Metabolomics in Epidemiologic Studies. Cancer epidemiology, biomarkers & prevention: a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 2016, 25(11):1483–1490. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Juan J Loor

30 Apr 2020

PONE-D-20-07045

Impact of time  and temperature  on gut microbiota and SCFA composition in stool samples

PLOS ONE

Dear Dr. Müller,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Jun 14 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for including the following consent information in the ethics statement of your manuscript:

'Control subjects gave verbal informed consent for their donated samples to be analyzed anonymously with the purpose of method development and neither samples nor data cannot be traced back to control individuals. The Regional Ethics Committee waived the need for consent in this case in accordance with Swedish law'

Please specify whether the consent was given verbally by control subjects or waived by your local ethics committee.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this article, the authors want to verify the effect of delaying the freezing of the samples for conservation on the composition of the microbiome and its related metabolism. To do so, they use qPCR to measure the abundance of some low abundance species, which could have an effect on health (methanogens and Lactobacillus reuteri). They also use 16S sequencing to measure the alpha and beta diversity of samples and NMR spectroscopy to measure 3 different short-chain fatty acids (SCFA), which are known to have a role in the gut-brain axis. The sample size is low but corresponds to the size used by similar studies on the effect of storage and stabilizers. The use of three different analysis is a good procedure to show the effect of storage protocols on the microbiome at various levels. The lack of any statistical analysis is a bit concerning in view of the large standard deviations seen in most comparisons. Overall, it is an analysis of interest for the community at large but still needs some work to be more convincing.

Major comments :

1. The discussion and results talk about small variations and changes in the levels of various measures but no statistical analysis is presented to support those variations. Why no statistical tests were realized at any point in the analysis to verify if the observed differences were significant or not?

2. I understand that samples were obtained from two different groups of subjects with different types of consent forms and that those “patients” are relevant to your ongoing large-scale study. However, why use two groups of participant (patient and control) in this study when these are never discussed in the paper and that the selected patients have affective disorders whose effect on the microbiome is not discussed?

3. In the sample management section (lines 131 to 139), it is mentioned that there are 5 different storage conditions used on all the samples but for some of the samples or some of the analysis, some of the sample/condition pairs are missing. The absence of 24h treatment data for both temperature for sample I and J is explained in the methods (line 150) but sample H had no results for 4°C in figure 2 and supplementary figure 1 but has results in the rest of the analysis?

4. Lactobacillus reuteri is a bacterium with many potential positive effects on health due to its antimicrobial activities and its effect on the reduction of pro-inflammatory cytokines production. However, since it is detected in less than half of the samples, other low abundance bacteria other than L. reuteri should have been used in the measures to support the claims.

5. Figure 3 and 4 show the gene copy numbers of each of the measured bacteria but these graphs are hard to see and analyze. In my opinion, the y-axis should not start at 0, but should rather zoom into the top part of the graph so that we can more precisely see the variations between the bars.

6. At lines 249 and 313, it is mentioned that only 5 samples were used in the SCFA analysis instead of all 10. Why were only 5 samples used and how were they selected?

7. In most of the analysis, the 24h and 48h samples are separated. Why is there no distinction made between the 24h and 48h samples in figures 1 and 5?

Minor comments :

1. Line 75, missing word between “subjects” and “may”, I suggest “which”.

2. Line 83, either “Although” or “but” should be removed.

3. Line 118, the “and” should be replaced by a “,”.

4. Line 128, “cannot” should be “can”.

5. Line 149-150, the condition in which only a duplicate was purified should be noted.

6. Line 345, “Calculation and numbers” could be replaced with “Calculations and values”.

7. Line 348, replace “or” with “for”.

8. In S1_Appendix “difference” is written as “differenz” in the header of sheet “SCFA_Difference to frozen in %”.

9. When opening S1_Appendix, there is a request to obtain updated values for files on the authors computer.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 3;15(8):e0236944. doi: 10.1371/journal.pone.0236944.r002

Author response to Decision Letter 0


12 Jun 2020

Dear Editor.

Please find below the response to the reviewer`s comments. We also improved the quality of some figures by loading them up separately as e.g. Figure_1_A and Figure_1_B (before Figure_1).

Additional changes not motivated by the reviewer:

Line 318: Table 1: “Mean average deviation” changed to “Average deviation”

Line 155: abbreviation of room temperature =RT has been introduced

Response to the reviewer comments

Major comments:

1. The discussion and results talk about small variations and changes in the levels of various measures but no statistical analysis is presented to support those variations. Why no statistical tests were realized at any point in the analysis to verify if the observed differences were significant or not?

In case of overall changes of the microbial community, statistical measures have been applied to produce the PCoA plot in figure 2 as indicated by the arrows representing impact of time and temperature. Furthermore, we added analysis using Friedman’s test for related samples to test if there was a significant difference between the qPCR data of methanogens, total bacteria and Lactobacillus reuteri as well as the SCFA ratios. The following changes in the method part under a new header “Statistics” and in the results part have been added:

Line 274-276: “Friedman’s test for related samples was performed. A p-value of less than 0.05 was considered significant.”

Line 287: “..considering the scaling..”

Line: 334-336: “A small significant difference (p=0.024) in total bacteria (0.8%) was found between immediately frozen and RT_48h samples (S1_Appendix, Figure 3B, Table 1).”

Line 367: “significantly lower” has been changed to “..to a lesser extent.”

Line 433-434: “..,even if a significant decrease was found after 48 h at RT. However, the effect of this decrease was considered very small and less than 1 %.”

2. I understand that samples were obtained from two different groups of subjects with different types of consent forms and that those “patients” are relevant to your ongoing large-scale study. However, why use two groups of participant (patient and control) in this study when these are never discussed in the paper and that the selected patients have affective disorders whose effect on the microbiome is not discussed?

We thank the reviewer for this note, and agree that for the actual question of the project it was irrelevant whether it was a patient or a volunteer. Since the distinction between control and patient is actually misleading and also irrelevant for the key message of the study presented. We have rewritten the method section (line 118-130) accordingly. The word "controls" has been removed and only the recruitment process has been described.

3. In the sample management section (lines 131 to 139), it is mentioned that there are 5 different storage conditions used on all the samples but for some of the samples or some of the analysis, some of the sample/condition pairs are missing. The absence of 24h treatment data for both temperature for sample I and J is explained in the methods (line 150) but sample H had no results for 4°C in figure 2 and supplementary figure 1 but has results in the rest of the analysis?

In three cases the material was not enough to perform DNA triplicates or to expose the stool samples to all storage conditions, as mentioned in the method section and in the results part.

We have modified the sentence and indicated which samples are affected:

Line 168: “Out of these three, one was purified in duplicates for all conditions (sample B), and two were purified in triplicates but covering only storage condition 1, 4 and 5 (sample I, and J). “

Although Illumina sequencing was performed in triplicates, there were a few samples which we sorted out due to poor read quality and which we mentioned in the results part. This includes sample H at 4°C, 24h and 48h. However, we see that this was not stated clearly. We added the following sentence in the method section: Line 222: “Due to poor read quality the samples H, 4°C 24h and H, 4°C 48h have not been considered for further analysis.”

4. L. reuteri is a bacterium with many potential positive effects on health due to its antimicrobial activities and its effect on the reduction of pro-inflammatory cytokines production. However, since it is detected in less than half of the samples, other low abundance bacteria other than L. reuteri should have been used in the measures to support the claims.

We agree with the reviewer on this point. In this case, however, we were particularly interested in the effect of temperature and time on the absolute abundance of L. reuteri, since this bacterium has been described as important for depression and mood disorders and is also considered in many other studies due to the positive effects on health as mentioned by the reviewer. We expected that not all samples would have sufficiently high L. reuteri levels to be detected using qPCR. This was also one reason why we decided to recruit a more heterogeneous group of subjects including both patients and healthy volunteers. Even if the number of samples is statistically very small, the result can still be regarded as significant for L. reuteri, since we observed only very slight deviations at 24 ° C or 4 ° C over time in all four stool samples.

5. Figure 3 and 4 show the gene copy numbers of each of the measured bacteria but these graphs are hard to see and analyze. In my opinion, the y-axis should not start at 0, but should rather zoom into the top part of the graph so that we can more precisely see the variations between the bars.

We see the point. The Figures 3 and 4 have been adjusted as recommended by the reviewer.

6. At lines 249 and 313, it is mentioned that only 5 samples were used in the SCFA analysis instead of all 10. Why were only 5 samples used and how were they selected?

This was due to a lack of stool samples, and represents a situation that should not be neglected when planning larger studies, as it can easily reduce the number of controls and patients. We added to the section “Results, Effect of storage condition on the SCFA acetate, propionate and butyrate” the following sentence:

Line 344-346: “Although all participants contributing to this study received detailed instructions on the amount/volume of sample to be delivered, only five stool samples contained sufficient material to examine both the microbial community and the SCFA composition.”

In three cases the material was not enough to perform DNA triplicates or to expose the stool samples to all storage conditions “See also comment 3”.

6. In most of the analysis, the 24h and 48h samples are separated. Why is there no distinction made between the 24h and 48h samples in figures 1 and 5?

Figure 1: We found it more convenient for the reader to capture changes over time at one glimpse, and only separated the temperature by colors. However, the reviewer is right, that distinguishing the different time points might be of interest for the reader. In Figure S1 we distinguish between 24h and 48.

Figure 5: As we separated between 24h and 48h in Table 2, we found it more visible to catch the overall changes in SCFA ratios up to 48 h at either 4°C or 20°C at one glimpse. However, we have added an additional figure in the supplementary for the convenience of the reader:

Figure S3: Deviation of SCFA ratios in % from those ratios obtained from the immediately frozen samples after 24 h and 48h displayed as box plots. Blue: samples stored at 4 °C, red: samples stored at 20 °C. Extended lines indicate variability outside the upper and lower quantity of the box, whereas outliers are plotted as individual point.

Minor comments:

1. Line 77, missing word between “subjects” and “may”, I suggest “which”.

Now line 76: Added “which”

2. Line 83, either “Although” or “but” should be removed.

Now line 84: Removed “but”

3. Line 118, the “and” should be replaced by a “,”.

Now line 120-121: “and” has been replaced by “,”

4. Line 128, “cannot” should be “can”.

Changed to “can”, now in line 127

5. Line 149-150, the condition in which only a duplicate was purified should be noted.

Information has been added (now line 169-170), see also comment 3,

6. Line 345, “Calculation and numbers” could be replaced with “Calculations and values”.

“Numbers” has been replaced by “values”.

7. Line 348, replace “or” with “for”.

“or “ is right here

8. In S1_Appendix “difference” is written as “differenz” in the header of sheet “SCFA_Difference to frozen in %”.

The spelling error has been corrected, wherever it appeared in the appendix file.

9. When opening S1_Appendix, there is a request to obtain updated values for files on the authors computer.

This has been changed: The file can be opened with “only read” options. No updated values will be requested when opening.

Attachment

Submitted filename: Response to the reviewer comments_FINAL.pdf

Decision Letter 1

Juan J Loor

17 Jul 2020

Impact of time  and temperature  on gut microbiota and SCFA composition in stool samples

PONE-D-20-07045R1

Dear Dr. Müller,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Juan J Loor

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: All our comments were addressed properly by the authors. We are satisfied with the new version of the manuscript Thanks.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Acceptance letter

Juan J Loor

23 Jul 2020

PONE-D-20-07045R1

Impact of time and temperature on gut microbiota and SCFA composition in stool samples 

Dear Dr. Müller:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Juan J Loor

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Alpha diversity (Simpson and Shannon) of the replicates displayed as box plot at the different time points and temperatures analyzed.

    Individuals are indicated by different colors and capitals A-J. Extended lines indicate variability outside the upper and lower limits of the box, whereas outliers are plotted as individual points.

    (JPEG)

    S2 Fig. Effect of time and temperature on SCFA concentrations and SCFA ratios displayed as average deviation from the initial values obtained from immediately frozen samples.

    (PDF)

    S3 Fig. Deviation of SCFA ratios in % from those ratios obtained from the immediately frozen samples after 24 h and 48h displayed as box plots.

    Blue: samples stored at 4°C, red: samples stored at 20°C. Extended lines indicate variability outside the upper and lower quantity of the box, whereas outliers are plotted as individual points.

    (TIFF)

    S1 Appendix. Data obtained from short chain fatty acid and qPCR analyses can be found in the supplementary file “S1_Appendix”.

    (XLSX)

    Attachment

    Submitted filename: Response to the reviewer comments_FINAL.pdf

    Data Availability Statement

    The sequencing raw data has been submitted to NCBI sequence read archive (SRA) under the BioProject accession number PRJNA609715.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES