Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2020 Aug 3;10(8):371. doi: 10.1007/s13205-020-02357-4

Induction of Ced9 mediated anti-apoptosis in commercial banana cultivar Rasthali for stable resistance against Fusarium wilt

C Sunisha 1,2, H D Sowmya 1, T R Usharani 1,✉, M Umesha 1, H R Gopalkrishna 1, S Sriram 1
PMCID: PMC7399012  PMID: 32832331

Abstract

Anti-apoptotic gene Ced-9 enhanced resistance against Fusarium oxysporum f. sp. cubense (Foc) in the susceptible banana cultivar Rasthali by arresting tissue necrosis. The embryogenic cell suspension of banana cultivar Rasthali was stably transformed with Ced-9 gene and transformed lines were regenerated independently. The putative transgenic lines were analyzed with PCR using gene primers and further subjected to Southern blot to estimate copy number. The root-challenge bioassay with Foc showed 17–51% Vascular Discoloration Index in independent transformants compared to untransformed banana cv Rasthali (98% VDI). Four transgenic events showed a higher level of resistance over a period of 6 months. Overcoming tissue necrosis is the most ideal method to avoid Fusarium multiplication and spread in banana. Oxidative stress-induced cell necrosis is prevented by the activation of antiapoptotic pathways by Ced-9 and is proving to be an effective method to control this dreaded disease. This is the first report from India on the generation of transgenic banana cultivar Rasthali expressing antiapoptotic Ced-9 gene for resistance to Fusarium wilt.

Keywords: Fusarium oxysporum f. sp. cubense, Ced-9, Fusarium wilt, Rasthali

Introduction

Banana cv Rasthali (AAB ‘Silk’ group) is a popular dessert cultivar of India and is valued for its unique fruity scent and texture. However, the cultivar is facing a major threat by Fusarium oxysporum f. sp. cubense (Foc) as it causes total yield loss. Genetic engineering is the best approach for developing elite dessert banana, resistant to this dreadful and devastating disease causing huge economic loss to banana-growing farmers in various countries. The vascular wilt disease is known as the Panama disease as the earliest recorded epidemic was from Panama (Moore et al. 2001). The pathogen has co-evolved with the banana host in Asia and has widely spread to new regions through an infested planting material (Ploetz and Pegg 1997). The Foc pathogen has been distinguished into different races namely, race 1, race 2, race 3, subtropical and tropical race 4. Among these, race1, 2 and 4 affect dessert bananas (Ploetz 2015). The pathogen enters the host through natural injuries to the root tissues, and the rapidly growing fungal mass obstructing xylem vessels disrupts nutrient and water supply to the plant causing the yellowing of the leaf margin, wilting of the leaves, pseudostem cracking, finally leading to its collapse. F. oxysporum has a brief biotrophic process within the host- plant and induces complete necrotrophy in the infected plant (Ploetz 2015). Foc multiplies in the vascular tissues and causes oxidative stress induced cell necrosis by modulating the negative regulators of genes involved in the cell death pathway of the infected hosts (Lam et al. 2001; Dickman and de Figueiredo 2013). During cell death, features associated with PCD, like nucleus and cytoplasmic condensation, protoplast shrinkage and genomic DNA degradation, are observed (Reape et al. 2008). PCD occurs during oxidative stress caused by abiotic or biotic stress and plays a crucial role in growth and evolution (Mittler and Blumwald 2010). Reactive oxygen species (ROS) are key signals in the activation of PCD in plants. The PCD regulatory mechanism of animals is well known and it depends on the caspase protease activity (Lam et al. 2001), but in the case of plant PCD mechanism, the apoptosis and signal transduction pathways are more or less speculative and unclear. In most fungi and plants, a group of caspase-like protein (CLP) sequence known as metacaspases is present (Uren et al. 2000). PCD is tightly regulated by Bcl 2 family consisting of pro-apoptotic and anti-apoptotic members of the cell death pathway. Ced-9 is an antiapoptotic Bcl-2 analog from Caenorhabditis elegans that inhibits the activation of Ced-3 caspase and promotes cell survival (Lutz 2000). Heterologous expression of Ced-9 gene in plant system inhibited cell death (Mitsuhara et al. 1999) and has proven to resist a multitude of pathogens. Transgenic tobacco plants overexpressing human Bcl-xL gene, nematode Ced-9 gene and baculovirus Op-IAP gene showed enhanced resistance to TSWV (Dickman et al. 2001). Expression of antiapoptosis inhibiting genes Bcl-xL and Ced-9 in tomoto enhances tolerance to cucumber mosaic virus induced necrosis (Xu et al. 2004). A native banana cell death gene, MusaBAG1 and Ced9 gene were found to resist Foc race 1 in transgenic banana cultivar ‘Rasthali’ and ‘Lady Finger’, respectively (Paul et al. 2011; Ghag et al. 2014). Transgenic resistance of banana cv Sukali Ndiizi against Foc race 1 is conferred by mCed-9 gene under glass house condition (Magambo et al. 2016).

In the past, transgenic Rasthali have been developed by overexpression of anti-microbial proteins (Chakrabarti et al. 2003; Mohandas et al. 2013; Sunisha et al. 2019) and defensins (Ghag et al. 2012) that has led to Fusarium wilt tolerance at pot condition. However, the Ced-9 gene has imparted field tolerance to highly virulent Tropical Race 4 (TR4) in Cavendish by maintaining cell homeostasis and avoiding tissue necrosis of host plant (Dale et al. 2017). In the current study, a plant codon-optimized Ced-9 gene was overexpressed to confer Foc race 1 tolerance to banana cv Rasthali.

Material and methods

Agrobacterium transformation and banana plant regeneration

The anti-apoptotic synthetic plant codon-optimized version of Ced-9 (Ced-9) gene construct pAJF422 was obtained from Prof J L Dale’s Lab (Queensland University Technology, Australia). Agrobacterium strain AGL1 was transformed with pAJF422, a modified pCAMBIA binary vector harboring Ced-9 gene controlled by maize polyubiquitin (ubi) promoter and Nos terminator, along with a deregulated version of neomycin phosphotransferase II (nptII) as plant selection marker. A single colony of PCR confirmed AGL1/pAJF422 was inoculated in 5 ml LB broth medium containing kanamycin 100 mg/l and incubated in an orbital shaker (210 rpm at 28 ºC) for 16 h. One ml of Agrobacterium culture was inoculated in 50 ml of Yeast Mannitol Broth (YMB) added with kanamycin 100 mg/l and incubated in shaker with similar conditions. The AGL1/pAJF422 Agrobacterium culture was centrifuged at 5000 rpm for 10 min. The pellet was resuspended in bacterial resuspension medium (BRM) supplemented with 100 mM acetosyringone and incubated in shaker (90 rpm at 28 ºC) for 3–4 h. The bacterial culture was repelleted (5000 rpm for 10 min) and resuspended in BRM medium to obtain ~ 0. 5 OD.

The embryogenic cell suspension (ECS) of cv Rasthali (0.5 ml settled cell volume) was heat shocked at 45ºC for 5 min and transformed with pAJF422 construct using Agrobacterium mediated transformation (Khanna et al. 2004). The co-cultivated ECS was aspirated on a filter disc and inoculated on co-cultivation medium (CCM) supplemented with 100 mM acetosyringone. After 3 days of co-cultivation, the infected ECS was washed with liquid MA2 medium (Strosse et al. 2006) and added to 250 mg/l cefotaxime. The cells were placed on MA2 solid medium added with 250 mg/l cefotaxime. Two weeks later cells were shifted onto MA2 medium with 200 mg/l cefotaxime and 50 mg/l kanamycin and subsequently transferred to 200 mg/l cefotaxime and 100 mg/l kanamycin. The cells were shifted onto MA3 medium supplemented with 200 mg/l cefotaxime and 100 mg/l kanamycin. The matured embryos were shifted onto regeneration medium with 0.5 mg/l BAP with the same antibiotic selection. The developed shoots were shifted onto the rooting medium with 200 mg/l cefotaxime and 200 mg/l kanamycin. The well-rooted plants were acclimatized in a net house with temperature in the range 28–36 ºC and 65–72% of relative humidity.

Molecular analysis of transgenic plants

Young leaf samples were collected from 50 independent transformed and 10 untransformed control banana plants. Total genomic DNA was isolated by the SDS method (Sika et al. 2015). To confirm the transformation of Ced-9 gene into the banana genome, PCR was carried out with specific primers (Ubi lnt F 5′ GATTTTTTTAGCCCTGCCTTC 3′ and Ced-9 R 5′ GATATCAAGCCTTGGCTCTTCC 3′) using 100 ng of genomic DNA as a template and 50 ng of pAJF422 plasmid as positive control. Whereas, the PCR cycle condition: 95 ºC for 4 min, 35 cycles of 95 ºC for 1 min; 62 ºC for 45 s and 72 ºC for 1 min of extension and final extension for 72 ºC for 10 min. The untransformed control was used as negative control. The obtained PCR products were electrophoresed in 1.2% agarose gel with 1 kb ladder (Genei, Bangalore).

To confirm the transgene expression, Semi-quantitative Reverse Transcriptase (RT)-PCR was performed by isolation of total RNA from young transformed banana leaves as well as from untransformed control plants using plant RNA isolation kit (Sigma). The first strand cDNA was synthesized using two µg of DNase treated RNA with Oligo (dT)12–18 primer (Sigma) and RevertAid™ M-MuLV Reverse Transcriptase (Thermo Scientific) as per the manufacturer’s instructions. Gene Specific primers (Ced-9 F 5′ AGATGAAGGAGTTTCTGGGGAT 3′ and Ced-9 R 5′ TCCAACGATTCCAATGGCTCCA 3′) were used to amplify cDNA under similar cycling conditions as mentioned above with an annealing temperature of 60 °C for 1 min.

The T-DNA copy number was estimated by Southern blot hybridization (Sambrook et al. 1989). Ten µg of genomic DNA was restriction digested with EcoRI for 6 h at 37 ºC and resolved on 0.8% agarose gel (w/v). The DNA was depurinated, denatured and neutralized followed by blotting on positively charged nylon membrane (Roche). Hybridization was performed using nptII gene (795 bp) as the probe and signals were detected following manufacturer’s instructions of DIG high Prime DNA labeling and Detection Starter Kit II (Roche Applied Science, Germany).

Small plant bioassay and disease scoring

Foc race 1 was isolated from the infected banana corm and inoculated onto full strength potato dextrose agar (PDA). Uniformly grown fungal mycelia were inoculated in 250 g of sterile barnyard millet grain and and incubated at 28 °C. The concentration of the colonized fungal spores on millet was determined using haemocytometer and adjusted to 2 × 108 spores. Randomly selected putative transformants of cv Rasthali with untransformed control plants were root-challenged with Foc race 1 (Smith et al. 2008) with slight modification. The planting was carried out in pots filled with sand: soil: farmyard manure mixture in 1:1:1 ratio and inoculated with 2 × 108 spore load of Foc colonized millet grains.

External and internal symptoms were assessed four weeks post inoculation and scored (Paul et al. 2013). External symptoms were recorded by scoring each plant with three main symptoms. Yellowing and wilting were assessed using a 1–5 point scoring, where 1 represented -healthy, no symptoms; 2—slight symptoms (yellowing of the leaves); 3—advance symptoms (dropping of the leaves); 4—extensive symptoms (whole foliage got dried); 5—entire plant affected (complete dead plant). Stem splitting symptoms were assessed using a 1–3 point scoring scale where 1 represented—no splitting; 2 at the base of the plant with slight splitting and 3 deep splitting. For internal symptom assessment, the plants were removed from the pot and cut through longitudinally. Images were captured using Sony Cyber-shot (DSC-W290 12.1 MP Digital Camera with 5* Optical Zoom and Super Steady Shot Image Stabilization) and analyzed using ImageJ to estimate the percentage of discoloration of the corm.

Expression analysis using quantitative real-time PCR

qRT-PCR was carried out in 20 μl of reaction mixture containing 10 μl of TB II Green PCR mix SYBR Green kit (Takara), 1 μl of (0.5 ρM) Ced-9 primer set, 5 μl of (100 ng) DNA template, and Milli-Q water in a 7500 Real-Time PCR system (Applied Biosystems). The banana actin gene was used as endogenous control for qRT-PCR. Thermal cycling conditions for qRT-PCR amplification includes an initial enzyme activation at 95 °C for 5 min, followed by 40 cycles each of 95 °C for 1 min, 60 °C for 45 s, and 72 °C for 30 s. Finally, for the PCR melt curve 95 °C for 1 min and 60 °C for 15 s. 2-ΔΔCT method was used to analyze the quantitative variation.

Statistical analysis

A correlation matrix of all external and internal symptoms was used to create correlations between the results and the data were analyzed using a one-way variance analysis (ANOVA). This model simultaneously contained all the four symptoms (yellowing, wilting, stem-splitting, and vascular discolouration). The statistical significance of the post-hoc least significant difference (LSD) test comparing each line of plants against the control line Rasthali was the P < 0.05.

Results

Modified pCAMBIA binary vector containing Ced-9 gene driven by polyubiquitin promoter was used to co-cultivate the ECS of banana cv Rasthali using Agrobacterium strain AGL1 (Fig. 1). The transformed somatic embryos were developed in MA3 medium and were regenerated on MA4 medium supplemented with kanamycin (Fig. 2a, b). The regenerated shoots were rooted in the selection medium and acclimatized in the net house (Fig. 2c, d). Totally, 50 independent transformed lines were identified on the kanamycin selection medium that did not show any somoclonal variation with respect to untransformed banana control plants. All plants were analyzed using genomic DNA PCR to check the presence of the Ced-9 with primers to amplify Ubi promoter (100 bp) and Ced-9 (288 bp). An expected size of 388 bp amplified in 22 putatively transformed lines (Fig. 3).

Fig. 1.

Fig. 1

Open in a new tab

Schematic diagram of T-DNA region pAJF422-Ced-9 engineered to constitutively overexpress the gene in transgenic banana plants

Fig. 2.

Fig. 2

Open in a new tab

Development of transgenic banana cv Rasthali over expressing Ced-9 gene. a Co-cultivated embryogenic cells bearing somatic embryos on MA3 selection medium, b germinating somatic embryos on MA4 selection medium, c plantlets on rooting medium with antibiotic selection, d plantlets acclimatized in polybags

Fig. 3.

Fig. 3

Open in a new tab

Representative gel picture of PCR analysis of putative transformants of banana cv Rasthali over expressing Ced-9 gene. Lanes 13 to 50—banana transformants amplified with gene specific primers; lane C—untransformed control cv Rasthali; lane P—plasmid (pAJF422-Ced-9) as a positive control; lane NT—negative control for PCR; lane M—1 Kb ladder

Ten transformed lines (Q4–13, Q4–21, Q4–33, Q4–50, Q4–41, Q4–40, Q4–3, Q4–35, Q4–34 and Q4–30) that survived the root-challenge bioassay and confirmed by PCR were selected for for Southern hybridization to determine the transgene integration and T-DNA copy number in the transformed banana plants. The genomic DNA of the ten transformed plants as well as of the untransformed plants was digested with EcoRI enzyme to cut the T-DNA only once. Out of the ten plants analyzed by Southern hybridization, five transgenic lines (Q4–30, Q4–35, Q4–34 and Q4–35) showed the presence of a single copy while one line (Q4–38) showed three copy numbers. The chemiluminescent signal at different positions in Southern positive lanes confirmed that all plants were consequential from independent transformation event (Fig. 4).

Fig. 4.

Fig. 4

Open in a new tab

Southern blot analysis of transgenic banana cv Rasthali. lanes—33, 34, 41, 38, 40, 35, 50, 30, 21 and 13 are transgenic lines of Ced-9; lane P—positive control (plasmid pAJF422-Ced-9); lane E—empty; lane C—untransformed control plant

To detect the transgene expression of Ced-9 transgenic events, total RNA was isolated and semi-quantitative RT-PCR was performed. PCR fragment of cDNA from all the six plants and positive control template showed the expected size of Ced-9 gene (734 bp) using gene specific primers, while no amplification was detected in untransformed control plant (Fig. 5).

Fig. 5.

Fig. 5

Open in a new tab

Semi-quantitative RT—PCR analysis of selected transgenic Rasthali lines over expressing Ced-9 gene. Lanes 33 to 41—amplification of Ced-9 gene in transgenic lines; lane C—Untransformed control plant; lane P—plasmid (pAJF422-Ced-9) as a positive control; lane M—1 Kb ladder; lane NT—negative control for PCR

To precisely assess disease resistance among transgenic bananas, 22 putatively transformed banana lines were selected and root-challenged with Foc race1 in pot condition. The transgenic plants along with untransformed control banana plant and resistant cultivar Grand Naine showing naturally immune response against Foc race 1 were periodically scored for external and internal symptoms. It was found that the susceptible cv Rasthali control plants showed typical external symptoms after four weeks and succumbed after 6 weeks post inoculation (Fig. 6a). These plants showed yellowing, wilting and stem splitting scores of 3, 3.7 and 4.3, respectively (yellowing and wilting disease score scale 1–5; stem splitting disease score scale 1–3). While the internal symptoms were examined, 98% of corm discoloration was observed (Fig. 7a). Foc race 1, resistant cv Grand Naine did not show any symptoms like yellowing, wilting, stem splitting and corm discoloration (Fig. 6l). Ten transgenic lines (Q4–13, Q4–21, Q4–33, Q4–50, Q4–41, Q4–40, Q4–3, Q4–35, Q4–34 and Q4–30) showed significantly lower disease rating than the susceptible Rasthali control plants up to six months after the initial challenge (Fig. 6b, k). Transgenic line Q4–33 resulted in lower vascular discoloration index percentage (17%) owing to arrested tissue necrosis in comparison with other transgenic lines which exhibited 30–51% discoloration (Fig. 7b). The results of bioassay demonstrated that Ced-9 overexpressing transgenic line showed tolerance against Foc race1 (Table 1).

Fig. 6.

Fig. 6

Open in a new tab

Small plant bioassay for Foc resistance in Ced-9 transgenic banana cv. Rasthali plants along with untransformed control plants in net house. a External symptoms of Foc infected untransformed Rasthali control, b–k external symptoms of Foc infected Ced-9 gene expressing transgenic banana cv Rasthali (33, 34, 41, 38, 40, 35, 50, 30, 21 and 13), l resistant control cv. Grand Naine

Fig. 7.

Fig. 7

Open in a new tab

Vascular discoloration of Ced-9 expressing transgenic banana cv Rasthali. a Vascular discoloration of transgenic lines—33, 38, 40 and 41; RSC—untransformed banana cv Rasthali as a susceptible control; GN—resistant control cv Grand Naine. b Percentage of vascular discoloration analysed using One Way ANOVA

Table 1.

Small plantlet bioassay of Ced-9 transgenic lines of banana cv. Rasthali plants with Foc race 1

S. no. Transgenic lines External symptoms Internal symptoms %
Yellowing Wilting Stem splitting VDI %
1 Q4–38 1.3 2.0 1.0 49
2 Q4–21 1.7 2.7 2.0 30
3 Q4–13 1.0 1.0 1.0 43.33
4 Q4–33 1.7 2.3 1.0 17
5 Q4–34 1.3 2.3 1.0 32.33
6 Q4–41 2.0 2.3 1.7 30.67
7 Q4–40 1.3 1.3 1.3 31.67
8 Q4–50 1.0 1.0 1.0 48.33
9 Q4–35 2.0 2.7 2.0 41
10 Q4–30 2.0 2.0 1.0 50.33
11 RS control 3.0 3.7 4.3 98
12 GN control 1.0 1.0 1.0 0.3333
Open in a new tab

Transgenic lines expressing Ced-9 gene (Q4-38, 21, 13, 33, 34, 41, 40, 50, 35 and 30). GN—untransformed cv Grand Naine. RS—untransformed cv Rasthali. Results are presented as score—yellowing and wilting: 1–5 scale, stem splitting: 1–3 scale. Five to seven leaf stage (~ 30 cm) plants were taken for the Foc root-challenge bioassay

*Significantly dissimilar from susceptible RS control lines with P < 0.05 based on LSD post hoc test

Efficient overexpression and transcript levels of Ced-9 gene were assessed in different transgenic lines and in untransformed control. The results of the qRT-PCR showed that the expression levels of Ced-9 gene increased significantly in the Q4–33 line (twofold) with respect to wild-type control and the other three lines, i.e., Q4–38, Q4–40, and Q4–41 (0.73-fold, 0.5-fold and 0.7-fold, respectively) (Fig. 8). The differential expression in the transgenic and non-transformed plants were statistically significant (F = 29.29; P =  < 0.0001 for Ced-9). The Ced-9 gene overexpressing four transgenic events showed less vascular discoloration index compared to the control plant.

Fig. 8.

Fig. 8

Open in a new tab

Expression analysis of Ced-9 transgenic lines using real-time quantitative RT–PCR. The x-axis represents the transgenic lines with control. The y-axis represents fold-value expression of mRNA in Ced-9 transgenic and untransformed control banana cv Rasthali. Values are the mean ± SE

Discussion

Banana cv Rasthali is commercially valued crop in India, but yields are severely hampered by Fusarium wilt. The fungi are hemibiotroph and thrive in the host as a nectrotroph. The cell death caused by Foc is reported to be restricted by the expression of cell death inhibiting genes of heterologous origin. The transgenic modification of PCD pathway in plants is a hopeful approach for engineering resistance to both biotic and abiotic stresses in plants (Dickman et al. 2001; Lincoln et al. 2002; Chen et al. 2004). Overexpression of antiapoptotic Ced-9 gene interrupts Ced-3 (cell-killing caspase) and inhibits cell to induce PCD. An enhanced resistance to cell death was found in transgenic tobacco plants overexpressing the Ced-9 gene, indicating that Ced-9 can inhibit cell death in plants (Mitsuhara et al. 1999). Similarly, transgenic tobacco plant expressing Bcl-xL and Ced-9 showed broad spectrum resistance to various stress conditions by maintaining cell homeostasis (Khanna et al. 2007). Transgenic tobacco plants expressing Ced-9 gene conferred resistance to necrotrophic fungal pathogens like S. sclerotiorum, B. cinerea, C. nicotianae (Dickman et al. 2001).

In the present study, tissue necrosis was prevented by the introduction of antiapoptotic gene Ced-9 into susceptible Rasthali genome through genetic transformation for resistance to Fusarium wilt. Agrobacterium mediated transformation of ECS (0.5 ml SCV) of banana cultivar Rasthali with an antiapoptosis Ced-9 gene resulted in 22% regeneration frequency of the transformants. Similarly, Grand Naine ECS transformed with Ced-9 gene resulted in higher regeneration of 59% (Khanna et al. 2007). In contrast, 5% regeneration frequency was observed with the antimicrobial Ace AMP1 gene (Mohandas et al. 2013). The higher frequency of regeneration could be attributed to the nature of transgene used for transformation. Generally, exposure of ECS to the Agrobacterium during transformation leads to more than 90% of cell death, as evidenced by features like DNA laddering, fragmentation and formation of apoptotic-like bodies (Khanna et al. 2007). Such cellular response can be suppressed by transformation of anti-apoptotic gene like Ced-9. Five out of six transgenic lines confirmed the stable integration of single copy and one event showed multiple copy numbers of Ced-9 gene. This lower number of gene integration may be due to the Agrobacterium mediated transformation system, resulting in lower transgene insertion with a stable expression (Arinaitwe et al. 2004). However, the copy number of the transgene was not found to correlate with disease resistance against Foc race 1. Similarly, Ced-9 over expressing Sukali Ndiizi transgenic banana lines showing single to multiple copy numbers of gene integration did not correlate with Foc tolerance (Magambo et al. 2016). The transgenic line Q4–33 in the present study showed the maximum relative over expression of the transgene and less disease symptoms as compared to other transgenic lines Q4–38, Q4–40, and Q4–41. Similarly, native cell death genes, namely MusaDAD1, MusaBAG1 and MusaBI1 individually over-expressing transgenic lines resulted in a variable expression pattern. Among the three genes studied, MusaBAG1-over-expressing transformed banana plants demonstrated the strongest resistance to Foc infection (Ghag et al. 2014). The variation in the expression may be due to DNA modifications like methylation and post-transcriptional gene silencing (Marenkova et al. 2012).

In the present study, antiapoptotic Ced-9 gene expressing transgenic lines showed Foc 1 resistance exhibiting vascular discoloration, ranging from 17 to 51% under pot condition. In contrast, the Lady Finger (AAB) banana expressing Ced-9 was effective against Foc race 1 and showed 10–23% discoloration (Paul et al. 2011). The variation in response among the transgenic lines could be the effect of integration site within the genome (Magambo et al. 2016). The mechanism of anti-apoptotic gene is still unclear against necrotrophic fungi. However, it is suggested that animal-based anti-apoptotic genes would suppress or promote the removal of ROS in plants (Pennell and Lamb 1997; Xu et al. 2004). The Bcl-xL and Ced -9 proteins in tobacco transformants localized to organelles are likely to improve the overall function of organelles by assisting in the generation of ATP in mitochondria or by preventing ROS production in chloroplast and also prevent cell death by maintaining organelle homeostasis (Qiao et al. 2002; Chen and Dickman 2004; Li and Dickman 2004).

In conclusion, we have demonstrated the effectiveness of Ced-9 gene in imparting resistance to fusarium wilt race-1. This strategy can be employed in other banana cultivars susceptible to Foc race-1.

Acknowledgements

The authors are thankful to DBT-BIRAC for funding under the project Development and Transfer of Technology from Queensland University of Technology (QUT), Australia to India for Biofortification and Disease Resistance in Banana. This is the part of Ph.D. dissertation work of first author.

Author contributions

Conceived and designed the experiments: TRU, HDS and CS. Performed the experiments: CS and HDS Analyzed the data: CS, TRU, HDS, MU and SS. Paper: CS, TRU, HDS and HRG

Funding

This study was funded by the Department of Biotechnology—Biotechnology Industry Research Association Council.

Compliance with ethical standards

Conflict of interest

Authors Mrs. Sunisha. C, Dr. Sowmya H.D, Dr. Usharani T.R, Mr. Umesha M, Dr.Sriram.S and Gopalkrishna H.R have received research grants from the Department of Biotechnology—Biotechnology Industry Research Association Council.

Ethical approval

This article does not contain any studies with human participants or animals performed by any of the authors.

Contributor Information

T. R. Usharani, Email: usharani.tr@icar.gov.in

S. Sriram, Email: Subbaraman.Sriram@icar.gov.in

References

  1. Arinaitwe G, Remy S, Strosse H, Swennen R, Sági L. Agrobacterium-and particle bombardment-mediated transformation of a wide range of banana cultivars. In: Mohan Jain S, Swennen R, editors. Banana improvement: cellular, molecular biology, and induced mutations. Enfield: Science Publishers Inc; 2004. pp. 351–357. [Google Scholar]
  2. Chakrabarti A, Ganapathi TR, Mukherjee PK, Bapat VA. MSI-99, a magainin analogue, imparts enhanced disease resistance in transgenic tobacco and banana. Planta. 2003;216:587–596. doi: 10.1007/s00425-002-0918-y. [DOI] [PubMed] [Google Scholar]
  3. Chen S, Dickman MB. Bcl-2 family members localize to tobacco chloroplasts and inhibit programmed cell death induced by chloroplast targeted herbicides. J Exp Bot. 2004;55:2617–2623. doi: 10.1093/jxb/erh275. [DOI] [PubMed] [Google Scholar]
  4. Dale JL, James A, Paul JY, Khanna H, Smith M, Echeverria SP, Bastidas FG, Kema G, Waterhouse P, Mengersen K, Harding R. Transgenic Cavendish bananas with resistance to Fusarium wilt tropical race 4. Nat Commun. 2017;8:1496. doi: 10.1038/s41467-017-01670-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dickman MB, de Figueiredo P. Death be not proud-cell death control in plant fungal interactions. PLoS Pathog. 2013;9(9):e1003542. doi: 10.1371/journal.ppat.1003542. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dickman MB, Park YK, Oltersdorf T, Li W, Clemente T, French R. Abrogation of disease development in plants expressing animal antiapoptotic genes. PNAS. 2001;98:6957–6962. doi: 10.1073/pnas.091108998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ghag SB, Shekhawat UKS, Ganapathi TR. Petunia floral defensins with unique prodomains as novel candidates for development of Fusarium wilt resistance in transgenic banana plants. PLoS ONE. 2012 doi: 10.1371/journal.pone.0039557,e39557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ghag SB, Shekhawat UK, Ganapathi TR. Native cell-death genes as candidates for developing wilt resistance in transgenic banana plants. AoB Plants. 2014 doi: 10.1093/aobpla/plu037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Khanna H, Becker D, Kleidon J, Dale JL. Centrifugation assisted Agrobacterium-tumefaciens mediated transformation (CAAT) of embryogenic cell suspensions of banana (Musa spp. Cavendish AAA and Lady finger AAB) Mol Breed. 2004;14:239–252. doi: 10.1023/B:MOLB.0000047771.34186.e8. [DOI] [Google Scholar]
  10. Khanna HK, Paul JY, Harding RM, Dickman MB, Dale JL. Inhibition of Agrobacterium-induced cell death by antiapoptotic gene expression leads to very high transformation efficiency of banana. MPMI. 2007;20:1048–1054. doi: 10.1094/MPMI-20-9-1048. [DOI] [PubMed] [Google Scholar]
  11. Lam E, Kato N, Lawton M. Programmed cell death, mitochondria and the plant hypersensitive response. Nature. 2001;411:848–853. doi: 10.1038/35081184. [DOI] [PubMed] [Google Scholar]
  12. Li W, Dickman MB. Abiotic stress induces apoptotic-like features in tobacco that is inhibited by expression of human Bcl-2. Biotechnol Lett. 2004;26:8. doi: 10.1023/b:bile.0000012896.76432.ba. [DOI] [PubMed] [Google Scholar]
  13. Lincoln JE, Richael C, Overduin B, Smith K, Bostock R, Gilchrist DG. Expression of the anti-apoptotic baculovirus p35 gene in tomato blocks programmed cell death and provides broad-spectrum resistance to disease. Proc Natl Acad Sci USA. 2002;99:15217–15221. doi: 10.1073/pnas.232579799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lutz RJ. Role of the BH3 (Bcl-2 homology 3) domain in the regulation of apoptosis and Bcl-2-related proteins. Biochem Soc Trans. 2000;28:2. doi: 10.1042/bst0280386. [DOI] [PubMed] [Google Scholar]
  15. Magambo B, Khanna H, Arinaitwe G, Tendo S, Arinaitwe IK, Kubiriba J, Tushemereirwe W, Dale JL. Inhibition of cell death as an approach for development of transgenic resistance against Fusarium wilt disease. Afr J Biotechnol. 2016;15:786–797. doi: 10.5897/AJB2015.15104. [DOI] [Google Scholar]
  16. Marenkova TV, Loginova DB, Deineko EV. Mosaic patterns of transgene expression in plants. Russ J Genet. 2012;48:293–306. doi: 10.1134/S1022795412030088. [DOI] [PubMed] [Google Scholar]
  17. Mitsuhara MKA, Miura M, Ohashi Y. Animal cell-death suppressors Bcl-xL and Ced-9 inhibit cell death in tobacco plants. Curr Biol. 1999;9:775–778. doi: 10.1016/S0960-9822(99)80341-8. [DOI] [PubMed] [Google Scholar]
  18. Mittler R, Blumwald E. Genetic engineering for modern agriculture: challenges and perspectives. Annu Rev Plant Biol. 2010;61:443–462. doi: 10.1146/annurevarplant-042809-112116. [DOI] [PubMed] [Google Scholar]
  19. Mohandas S, Sowmya HD, Saxena AK, Meenakshia S, Rania RT, Mahmood R. Transgenic banana cv. Rasthali (AAB, Silk gp) harboring Ace-AMP1 gene imparts enhanced resistance to Fusarium oxysporum f. sp. cubense race 1. Sci Hortic. 2013;164:392–399. doi: 10.1016/j.scienta.2013.09.018. [DOI] [Google Scholar]
  20. Moore NY, Pegg KG, Buddenhagen IW, Bentley S (2001) Fusarium wilt of banana: a diverse clonal pathogen of a domesticated clonal host. In: Summerell BA, leslie JF, Backhouse D, Bryden WL, Burgess LW (eds) Fusarium, pp 212–224
  21. Paul JY, Becker DK, Dickman MB, Harding RM, Khanna HK, Dale JL. Apoptosis-related genes confer resistance to Fusarium wilt in transgenic ‘Lady Finger’ bananas. Plant Biotechnol J. 2011;9:1141–1149. doi: 10.1111/j.1467-7652.2011.00639.x. [DOI] [PubMed] [Google Scholar]
  22. Pennell R, Lamb C. Programmed cell death in plants. Plant Cell. 1997;9:1157–1168. doi: 10.1105/tpc.9.7.1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ploetz RC. Management of Fusarium wilt of banana: a review with special reference to tropical race 4. Crop Protect. 2015;73:7–15. doi: 10.1016/j.cropro.2015.01.007. [DOI] [Google Scholar]
  24. Ploetz RC, Pegg KG. Fusarium wilt of banana and Wallace's line: was the disease originally restricted to his Indo-Malayan region? Australas Plant Path. 1997;26:239–249. doi: 10.1071/AP97039. [DOI] [Google Scholar]
  25. Qiao J, Mitsuhara I, Yazaki Y, Sakano K, Gotoh Y, Miura M, Ohashi Y. Enhanced resistance to salt, cold and wound stresses by overproduction of animal cell death suppressors Bcl-xL and Ced-9 in tobacco cells—their possible contribution through improved function of organella. Plant Cell Physiol. 2002;43(9):992–1005. doi: 10.1093/pcp/pcf122. [DOI] [PubMed] [Google Scholar]
  26. Reape TJ, Molony EM, McCabe PF. Programmed cell death in plants: distinguishing between different modes. J Exp Bot. 2008;59:435–444. doi: 10.1093/jxb/erm258. [DOI] [PubMed] [Google Scholar]
  27. Sambrook J, Fritsch EF, Maniatis S. Molecular sloning: a laboratory manual. 2. Cold Spring Harbor: Cold Spring Harbor CSHL Press; 1989. [Google Scholar]
  28. Sika KC, Kefela T, Adoukonou-Sagbadja H, Ahoton L, Saidou A, Baba-Moussa L, Baptiste LJ, Kotconi SO, Gachomo EW. A simple and efficient genomic DNA extraction protocol for large scale genetic analyses of plant biological systems. Plant Gene. 2015;1:43–45. doi: 10.1016/j.plgene.2015.03.001. [DOI] [Google Scholar]
  29. Smith LJ, Smith MK, Tree D, O’Keefe D, Galea VJ. Development of a small-plant bioassay to assess banana grown from tissue culture for consistent infection by Fusarium oxysporum f. sp. cubense. Australas Plant Pathol. 2008;2:171–179. doi: 10.1071/AP08006. [DOI] [Google Scholar]
  30. Strosse H, Schoofs H, Panis B, Andre E, Reyniers K, Swennen R. Development of embryogenic cell suspension from shoot meristematic tissue in bananas and plantains (Musa spp.) Plant Sci. 2006;170:104–112. doi: 10.1016/j.plantsci.2005.08.007. [DOI] [Google Scholar]
  31. Sunisha C, Sowmya HD, Usharani TR, Umesha M, Gopalkrishna HR, Saxena A. Deployment of stacked antimicrobial genes in banana for stable tolerance against Fusarium oxysporum f.sp. cubense through genetic transformation. Mol Biotechnol. 2019 doi: 10.1007/s12033-019-00219-w. [DOI] [PubMed] [Google Scholar]
  32. Thaler JS, Owen B, Higgins VJ. The role of the jasmonate response in plant susceptibility to diverse pathogens with a range of lifestyles. Plant Physiol. 2004;135:530–538. doi: 10.1104/pp.104.041566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Uren AG, O’Rourke K, Aravind L, Pisabarro T, Seshagiri S, Koonin EV, Dixit VM. Identification of paracaspases and metacaspases. Two ancient families of caspase like proteins, one of which plays a key role in MALT lymphoma. Mol Cell. 2000;6:961–967. doi: 10.1016/s1097-2765(00)00094-0. [DOI] [PubMed] [Google Scholar]
  34. Xu P, Rogers SJ, Roossinck M. Expression of antiapoptotic genes Bcl-xL and Ced-9 in tomato enhances tolerance to viral-induced necrosis and abiotic stress. Proc Natl Acad Sci. 2004;101(44):15805–15810. doi: 10.1073/pnas.0407094101. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES