Gypenosides Protect Orbital Fibroblasts in Graves Ophthalmopathy via Anti-Inflammation and Anti-Fibrosis Effects

Abstract

Purpose

To investigate the effect of Gypenosides (Gyps) on the inflammation and fibrosis in orbital fibroblasts (OFs) in Graves ophthalmopathy (GO).

Methods

Bioinformatics analyses were performed to identify the enriched genes and signaling pathways related to Gyps function. For ex vivo experiments, OFs were cultured from orbital connective tissues from patients with GO. OF proliferation was estimated by Cell Counting Kit-8 assay. Effects of Gyps treatment on interleukin (IL)-1β-induced inflammation and transforming growth factor-β1 (TGF-β1)-induced fibrosis were evaluated by real-time quantitative PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and Western blotting. OFs were treated with IL-1β or TGF-β1 in the absence or presence of Gyps pretreatment, and the levels of related mRNA or proteins were evaluated by RT-qPCR or ELISA.

Results

Eight inflammation-related target genes and nine fibrosis-related target genes were screened out. These genes were mainly enriched in pathways corresponding to inflammation and fibrosis, respectively. IL-1β-induced upregulation of inflammatory cytokines, and TGF-β-induced upregulation of fibrotic mediators in OFs were downregulated by Gyps. Moreover, Gyps reduced the activation of Toll like receptors 4/nuclear factor-κ B signaling and TGF-β1/SMAD2/SMAD4 signaling in GO OFs.

Conclusions

Gyps could protect GO-derived OFs against IL-1β-induced inflammation and TGF-β1-induced fibrosis. Thus Gyps might have therapeutic potential on inflammation and fibrosis in GO.

Graves ophthalmopathy (GO) is the most common orbital disease in adults.¹ Ocular lesions are caused by the enlargement of extraocular muscles and periorbital soft tissues because of the activation of connective tissues.² The symptoms of GO include upper eyelid retraction, edema, periorbital erythema, eyeball protrusion, and other manifestations. Some patients have a self-limiting course of disease, whereas approximately 5% to 15% of patients cannot recover.³ These patients may develop to exposed keratitis, corneal ulcer, or optic neuropathy, thus affecting the patients’ appearance and vision even leading to blindness.⁴

However, there are still many shortcomings in current treatment methods. Glucocorticoid therapy has anti-inflammatory and immunosuppressive effects, but requires a large dosage for long periods that may lead to several hormonal complications, such as hyperglycemia, elevated blood pressure, and liver failure.⁵ In addition, a small number of patients with severe GO are insensitive to hormonal therapy. The orbital decompression surgery is invasive and needs high technical equipment with a long learning time. These disadvantages lead to different surgical methods and effects. Besides, orbital radiotherapy has been less carried out in many countries, including China. Hence it is urgent to develop new effective treatment methods to improve the prognosis of patients with severe GO.

According to the pathological changes of GO, the development of corresponding targeted therapies is an important research topic. Previous studies have shown that orbital fibroblasts (OFs) are affected by inflammatory mediators secreted by inflammatory cells, such as T cells, B cells, macrophages, and mast cells.^6,7 Additionally, OFs can express surface receptors, such as thyroid stimulating hormone receptor (TSHR) and insulin-like growth factor 1 receptor (IGF-1R), which mediate pathological processes of GO by regulating cell proliferation, inflammatory factor secretion, extracellular matrix synthesis, or fibrosis.⁸ OFs participate in immune modulating, fibrosis, and oxidation, which are important factors for the initiation and development of GO, and are also major targets for the development of GO treatment strategies.

Many studies regarding GO have shown that IL-1β can stimulate OFs to secrete cytokines, such as interleukin (IL)-6, IL-8, tumor necrosis factor-α (TNF-α), monocyte chemoattractant protein-1 (MCP-1), prostaglandin E2, and other factors via activating nuclear factor-κ B (NF-κB) signaling pathway.^9,10 Moreover, Toll-like receptors (TLRs) activate the translocation of NF-κB through the intracellular signal transduction of the downstream signaling molecule, thus leading to the production of TNF-α and other inflammatory cytokines.¹¹ These cytokines then recruit and activate T cells, B cells, monocytes, and mast cells to aggravate inflammatory response in the orbital tissue. In addition, fibrosis is one of the ultimate results of chronic inflammation. A previous study indicated that transforming growth factor-β1 (TGF-β1) can induce the transformation of OFs into myofibroblasts, promote the synthesis of extracellular matrix, and aggravate the fibrosis of extraocular muscles.¹² Some evidence has also proved that TGF-β/SMAD pathway is involved in the process of fibrosis in liver, lung, and kidney.^13,14

Gypenosides (Gyps), which are saponins extracted from the Gynostemma pentaphyllum, represent the most pharmacologically active components in G. pentaphyllum and have several bioactivities. For example, Gyps can regulate the activation of immune cells and the expression of cytokines.¹⁵ Gyps have been reported to regulate NF-κB signaling pathway and inhibit IL-1β-induced inflammatory response in human osteoarthritic chondrocytes.¹⁶ Additionally, Gyps can decrease inflammatory response in inflammatory bowel disease by inhibiting NF-κB and signal transducer and activator of transcription 3 (STAT3) signal pathways.¹⁷ Moreover, Gyps can reduce hepatic fibrosis by inhibiting the expression of TGF-β1, TGF-β1 receptor 1, SMAD family member 2 (SMAD2), and SMAD family member 3 (SMAD3); thus reducing the differentiation of hepatic progenitor cells into myofibroblasts.^18,19 Thus Gyps may serve as potential therapeutic targets in GOs orbit inflammatory infiltration and fibrotic proliferation. In this study, we studied the effects of Gyps on OFs derived from GO patients.

Methods

Target Collecting and Bioinformatics Analysis

Literature regarding the therapeutic mechanisms of Gyps were screened. Gene targets working on inflammation and fibrosis were identified according to the previous studies. Gene ontology, Kyoto encyclopedia of genes and genomes (KEGG), and Reactome pathway analyses could provide gene expression data for identified genes. Based on these earlier mentioned hub target genes, gene ontology and KEGG analyses were performed to clarify the mechanisms employed by Gyps for treating inflammation and fibrosis using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8 (https://david.ncifcrf.gov/)^20,21 and STRING v11.0 (https://string-db.org/).

Cell Culture

Orbital connective tissues were collected from GO patients with dysthyroid optic neuropathy during orbital decompression surgery (clinical activity scores at the time of surgery were <4). Normal control tissues were harvested during evisceration or upper lid blepharoplasty from patients without history or clinical evidence of any thyroid disease. The characteristics of patients included in this study are shown in Table 1. Because of the limited number of donors, it was difficult to achieve perfect matching of the clinical characteristics of GO and non-GO patients. The institutional review board of the First Affiliated Hospital of Guangxi Medical University, Nanning, China, approved the study, and informed consent was obtained from all participants. This study followed the tenets of the Declaration of Helsinki. Tissues were used for the primary culture of human OFs. Each tissue was minced into pieces approximately 1×1 mm in size, placed in 35-mm plastic culture plates in Dulbecco's Modified Eagle Medium (DMEM) with antibiotics, and 20% fetal bovine serum (FBS), and incubated at 37°C in a humidified incubator under 5% CO₂ and 95% air at one atmosphere. Medium was changed three times per week. On reaching confluence, the medium was removed, and the cells were washed twice with phosphate buffered saline (PBS). Then cells were trypsinized with 0.25% trypsin/ethylenediaminetetraacetic acid solution and subcultured in 25 cm² plastic cell culture flasks in DMEM with antibiotics and 10% FBS. Gyps and IL-1β/TGF-β1 for cell culture were purchased from Jiatian Biotechnology (Xi'an, China) and Pepro Technology (NJ, USA), respectively. Cells between the second and eighth passages were used for the following experiments.

Table 1.

Clinical Information of the Patients Included in this Study

Age (y)	Sex	Smoker	BMI	Duration of GO (years)	CAS	Proptosis R/L (mm)	Surgical treatment
Patients with GO
61	Female	N	22.8	0.5	0/7	21/20	Decompression
48	Female	N	22.9	0.5	1/7	20/22	Decompression
52	Female	N	25.8	1	1/7	19/21	Decompression
49	Male	Y	20.3	1	3/7	20/18	Decompression
57	Male	N	19.5	20	1/7	23/23	Decompression
63	Male	N	22.8	0.6	1/7	21/19	Decompression
Non-GO control subjects
35	Female	N	22.6	n/a	n/a	n/a	Eye evisceration
21	Male	N	23.6	n/a	n/a	n/a	Eye evisceration
50	Male	Y	23.9	n/a	n/a	n/a	Eye evisceration
33	Female	N	21.3	n/a	n/a	n/a	Upper lid blepharoplasty

BMI, body mass index; CAS, clinical activity score; n/a, not applicable; N, no; R, right eye; L, left eye; Y, yes.

Immunohistology

To identify different cell types, immunohistology was performed. Cells on the slides were fixed with 4% paraformaldehyde for 20 minutes at room temperature, followed by permeabilization with 0.05% Triton X-100 for 15 minutes at 4°C, and then blocked with PBS containing 4% BSA (Dalian Meilun Biotechnology, Dalian, China) for 30 minutes at 37°C. Primary antibodies were incubated overnight at 4°C with rabbit anti-S100 calcium binding protein B (S100B), rabbit anti-myoglobin (MB), rabbit anti-desmin (DES), rabbit anti-keratin 17 (KRT17), or rabbit anti-vimentin (VIM) antibodies (Sangon Biotech, Shanghai, China), and then incubated with biotin goat-antirabbit IgG (Histostain-Plus Kits; Bioss, Beijing, China) for 1 hour at room temperature. Endogenous peroxidase activity was inhibited with 3% H₂O₂. The immunostained cells were imaged using an Olympus IX71 microscope (Olympus, Tokyo, Japan).

Cytotoxicity Assay

Cell Counting Kit-8 (CCK-8) assay (Beyotime Biotechnology, Shanghai, China) followed by measuring the spectrophotometric absorbance at 450 nm was used to estimate cell proliferation. OFs were cultured at a density of 4 × 10³ cells/well in 96-well plates in 0.1 mL DMEM supplemented with 10% FBS. All experiments were according to the manufacturer's instructions.

RNA Isolation and Reverse Transcription

Cells were cultured in 6-cm plastic culture plates until they reached confluence. Cells for RNA isolation were harvested into TRIzol (TaKaRa Biotechnology, Dalian, China) reagent. Briefly, after the addition of 10% chloroform (Macklin Reagent, Beijing, China), cells were vortex mixed for 15 seconds and incubated for 10 minutes at room temperature. After centrifuging at 10000 × g for 10 minutes at 4°C, the top non-pink layer was transferred to a new microcentrifuge tube, and equal volume of isopropanol was added. The sample was incubated for 10 minutes at 4°C. After centrifuging the sample at 15000 × g for 10 minutes at 4°C, 1 mL 75% ethanol (prepared with diethyl pyrocarbonate water) was added, and washed the pellet by centrifugation at 10000 × g for 10 minutes at 4°C. Total RNA was eluted with 20 µL of sterile, RNase-free water. RNA quality was assessed for size and purity by using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA). For reverse transcription of isolated RNA into cDNA, 1 µg of the extracted total RNA was subjected to reverse transcription using reverse-transcription kit (TaKaRa Biotechnology) according to the manufacturers’ instructions, and the cDNA was stored at −80°C until use.

Real-Time Quantitative PCR

The cDNA from the cells was used as the template for real-time quantitative PCR (RT-qPCR) amplification on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex TaqII (TaKaRa Biotechnology). In separate experiments, RT-qPCR was performed to quantitatively assess the transcript levels of IL-6, IL-8, TNF-α, CCL2, α-SMA, COL1A2, HAS2, FN1, and GAPDH in cell samples using the gene-specific primers shown in Table 2. Initially, cDNA was denatured at 95°C for 30 seconds. Afterward, 40 PCR cycles (95°C 5 seconds and 60°C 34 seconds for each cycle) were run. Target gene expression levels were normalized to that of GAPDH, and the results are expressed as the fold change in cycle threshold (Ct) value relative to the control group as determined with the 2^−ΔΔCt method. Data were included in the analysis only if Ct value was <35.

Table 2.

Primer Sequences of RT-qPCR

Genes	Sequences (5′-3′)
IL-6	F: AAGCCAGAGCTGTGCAGATGAGTA
	R: TGTCCTGCAGCCACTGGTTC
IL-8	F: AACTGAGAGTGATTGAGAGTGG
	R: ATGAATTCTCAGCCCTCTTCAA
TNF-α	F: CTGCCTGCTGCACTTTGGAG
	R: ACATGGGCTACAGGCTTGTCACT
CCL2	F: CATAGCAGCCACCTTCATTCC
	R: TCTCCTTGGCCACAATGGTC
α-SMA	F: CTCTGGACGCACAACTGGCATC
	R: CACGCTCAGCAGTAGTAACGAAGG
COL1A2	F: CTGGACCTCCAGGTGTAAGC
	R: TGGCTGAGTCTCAAGTCACG
HAS2	F: CACGTAACGCAATTGGTCTTGTC
	R: CCAGTGCTCTGAAGGCTGTGTAC
FN1	F: ACAAGCATGTCTCTCTGCCA
	R: TTTGCATCTTGGTTGGCTGC
GAPDH	F: GACAGTCAGCCGCATCTTCT
	R: GCGCCCAATACGACCAAATC

Enzyme-Linked Immunosorbent Assays (ELISA)

Cell-free supernatants were collected and centrifuged at 300 × g for 10 minutes at room temperature and stored at –80°C until analysis. The expression levels of IL-6, TNF-α, C-C motif chemokine ligand 2 (CCL2), alpha-smooth muscle actin (α-SMA), collagen type 1 (Col 1), hyaluronic acid (HA), and fibronectin (FN) in the culture supernatant of confluent OFs were determined using commercially available ELISA kits (IL-6, TNF-α, and CCL2 purchased from Multisciences, Hangzhou, China; α-SMA and FN purchased from Lianshuo Biological Technology, Shanghai, China; Col 1 and HA purchased from Enzyme-linked Biotechnology, Shanghai, China) according to the manufacturers’ instructions. Each sample was tested three times. All samples were tested in the same assay.

Western Blotting Analysis

As primary antibodies, a rabbit anti-nuclear factor-κ B (NF-κB) (diluted 1:1000, Cell Signaling Technology, Danvers, MA, USA), a rabbit anti-TLR4 (diluted 1:1000, Cell Signaling Technology), a rabbit anti-SMAD2 (diluted 1:1000, Cell Signaling Technology), a rabbit anti-p-SMAD2 (diluted 1:1000, Cell Signaling Technology), a rabbit anti-SMAD3 (diluted 1:1000, Sangon Biotech), a rabbit anti-p-SMAD3 (diluted 1:1000, Sangon Biotech), and a rabbit anti-SMAD4 (diluted 1:1000, Wanleibio, Shenyang, China) were used. Protein extracts were stored at –80°C until use. Equal amounts of denatured protein were subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and the separated proteins were transferred to polyvinylidene difluoride membranes (Solarbio Life Sciences, Beijing, China). Nonspecific binding was blocked with BSA (Dalian Meilun Biotechnology) for 1 hour at room temperature. The membranes were then incubated overnight at 4°C with antibodies against NF-κB, SMAD2, p-SMAD2, SMAD3, p-SMAD3, SMAD4, and β-actin at the dilutions specified by the manufacturers. The membranes were then incubated with anti-rabbit IgG (DyLight 680 Conjugate; Cell Signaling Technology) forx 2 hours at room temperature. The protein bands were imaged with a LI-COR automatic chemiluminescence image analysis system (LI-COR, Nebraska USA). Quantification of Western blotting signals was achieved with Odyssey Fc Imaging System (LI-COR, Nebraska USA).

Statistics

Statistical analyses were performed using GraphPad Prism (v8.2.0 for macOS) software (GraphPad Software, San Diego, CA, USA). Significance tests of different culture conditions were conducted using 1-way ANOVA, and 2-way ANOVA was used to examine the significance between GO and non-GO in different culture conditions. Bar charts were generated using means and the standard deviation (SD). P values less than 0.05 were considered as statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

Results

Bioinformatics Analysis

Based on the literature screening,^18,22–34 eight inflammatory cytokine-encoding genes and nine fibrotic mediator-encoding genes were identified as being related to Gyps’ function. Inflammation-related targets were TNF, IL-1β, IL-5, mitogen-activated protein kinase 14, NF-κB subunit 1, signal transducer and activator of transcription 1, peroxisome proliferator activated receptor gamma and vascular cell adhesion molecule 1, and fibrosis-related targets were matrix metallopeptidase 2, matrix metallopeptidase 9, TIMP metallopeptidase inhibitor 1, TIMP metallopeptidase inhibitor 2, TGF-β1, SMAD family member 7, cellular communication network factor 2, aldehyde dehydrogenase 1 family member B1, and peroxisome proliferator activated receptor α.

The significantly enriched (cut-of criterion with statistic difference was P < 0.05) gene ontology categories are shown in Figure 1. Through molecular functions and cellular components analyses, the inflammation-related genes were mainly associated with cytokine activity (GO:0005125), TNF receptor binding (GO:0005164), extracellular space (GO:0005615), and cytosol (GO:0005829). The fibrosis-related genes were principally involved in type 1 TGF-β receptor binding (GO:0034713), collagen binding (GO:0005518), proteinaceous extracellular matrix (GO:0005578), and extracellular space (GO:0005615). The results for biological processes–related gene ontologies are shown in Supplementary Tables S1 and S2.

Figure 1.

Gene ontology analysis results. The inflammation-related gene targets were mainly associated with cytokine activity, TNF receptor binding, extracellular space, and cytosol. The fibrosis-related targets were principally involving type 1 TGF-β receptor binding, collagen binding, proteinaceous extracellular matrix, and extracellular space. MF, molecular function; CC, cellular component.

The most significant Reactome pathways of the selected genes were mainly enriched in IL-1 processing (R-HSA-448706), activation of matrix metalloproteinases (R-HSA-1592389), downregulation of TGF-β receptor signaling (R-HSA-2173788), and collagen degradation (R-HSA-1442490) (Fig. 2). The KEGG analysis a re shown in Supplementary Tables S3 and S4.

Figure 2.

Reactome pathway analysis results. The inflammation-related gene targets were mainly enriched at transcriptional regulation of white adipocyte differentiation, CLEC7A/inflammasome pathway, and IL-1 processing (A). The fibrosis-related targets were mainly enriched at activation of matrix metalloproteinases, downregulation of TGF-β receptor signaling, EPH-ephrin mediated repulsion of cells, and collagen degradation (B).

Cell Identification

Primary cells were cultured from GO and non-GO patient-derived retrobulbar orbital connective tissues. VIM is present in cells of mesoderm origin, such as fibroblasts. The positive expression of VIM observed in our study demonstrated that the cells were fibroblasts (Fig. 3A). Additionally, the negative expressions of DES, KRT17, MB, S100B excluded smooth muscle cells and cardiomyocytes, skin cells, muscle and striated muscle, nerve cells and skin melanocytes, respectively (Figs. 3B–E), with negative control slides shown in Figures 3F–J. Consequently, the cells we obtained from orbit were identified as OFs. Bright field image (magnification × 100) is shown in Figure 3K. Cells with negative VIM expression were considered as non-OFs.

Figure 3.

Immunohistology analysis showed positive expression of VIM (A), negative expression of S100B (B), MB (C), DES (D), and KRT17 (E), and corresponding negative controls (F–J). Cell morphology was shown in bright field images (magnification × 100, K), the identity of OFs was verified by immunohistology analysis.

Figure 4.

Cytotoxicity study using CCK-8 assay. GO (n = 6) and non-GO (n = 4) OFs were treated with Gyps at desired concentrations for 24 and 48 hours. The cell proliferation was significantly increased under the stimulation of 100 µg/mL Gyps, and this effect did not persist over 48 hours.

Gyps Promote OF Proliferation

The effect of Gyps on the proliferation of OFs was investigated by CCK-8 assay in vitro. OFs were treated with Gyps at indicated concentrations for 24 and 48 hours (Fig. 4). The results showed that Gyps significantly enhanced OF proliferation at 24 hours at 25, 50, 100, 250, 500, and 1000 µg/mL, with 100 µg/mL having the most obvious effect (1-way ANOVA, P < 0.01). However, this effect did not persist over 48 hours (Fig. 4). Additionally, no significant differences were observed between GO and non-GO at the same concentration of Gyps at both 24 and 48 hours (2-way ANOVA, all P > 0.05).

Gyps Inhibit IL-1β-Induced Inflammation in OFs

RT-qPCR and ELISA assays were performed to investigate the effect of Gyps on IL-1β-induced inflammation. IL-1β (10 ng/mL, 24 hours) elicited a marked (∼2.5- to 40-fold) and significant increase in the mRNA levels of IL-6, IL-8, TNF-α, and CCL2 in ex vivo–cultured primary OFs (Fig. 5). In addition to mRNA expressions, the protein levels of IL-6, CCL2, and TNF-α in cell culture supernatant were also increased significantly (Fig. 6). Pretreating OFs with Gyps (100 µg/mL, 24 hours), however, prevented IL-1β-induced increase in IL-6, IL-8, TNF-α, and CCL2 mRNA expression (Fig. 5), as well as the increased protein secretion of IL-6, TNF-α, and CCL2 (Fig. 6). For mRNA levels, IL-6, TNF-α, and CCL2, mRNA expressed significantly higher in non-GO IL-1β-treated groups (2-way ANOVA, all P < 0.0001). The protein levels of IL-6, CCL2, and TNF-α in GO IL-1β-treated groups were significantly higher than non-GO groups (2-way ANOVA, all P < 0.001). In addition, the protein level of IL-6 and CCL2 in GO Gyps-treated groups were higher (2-way ANOVA, all P < 0.0001).

Figure 5.

The mRNA levels of inflammation-related cytokines (IL-6, IL-8, TNF-α, and CCL2) in OFs. Go (n = 6) and non-GO (n = 4) OFs were treated with 10 ng/mL IL-1β for 24 hours in the absence or presence of pretreating with 100 µg/mL Gyps for 24 hours. The expression of IL-6 (A), IL-8 (B), TNF-α (C), and CCL2 (D) mRNA in each cell group was evaluated by RT-qPCR. ***P < 0.001 and ****P < 0.0001 versus IL-1β-stimulated cells, 1-way ANOVA.

Figure 6.

The protein levels of inflammation-related cytokines in OF culture supernatant. Go (n = 6) and non-GO (n = 4) OFs were treated with 10 ng/mL IL-1β for 24 hours in the absence or presence of pretreating with 100 µg/mL Gyps for 24 hours. The production of IL-6 (A), TNF-α (B), and CCL2 (C) in each cell group was evaluated by ELISA assay. **P < 0.01, ***P < 0.001, and ****P < 0.0001 versus IL-1β-stimulated cells, 1-way ANOVA.

Gyps Inhibit TGF-β1-Induced Fibrosis in OFs

RT-qPCR and ELISA assays were performed to investigate the effect of Gyps on TGF-β1-induced fibrosis. Stimulation of OFs with TGF-β1 (10 ng/mL, 24 hours) elicited a marked (∼2.5- to 25-fold) and significant increase in the mRNA expression of HAS2, COL1A2, α-SMA, and FN1 (Fig. 7). Similarly, the protein levels of HA, Col 1, α-SMA, and FN expression in cell culture supernatant were increased significantly as well (Fig. 8). Pretreatment with Gyps (100 µg/mL, 24 hours) prevented TGF-β1-induced increases of HAS2, COL1A2, α-SMA, and FN1 mRNA expression (Fig. 7), and HA, Col 1, α-SMA, and FN (Fig. 8) protein levels in OF culture media. The mRNA levels of HAS2 and COL1A2 were significantly higher in non-GO TGF-β1-treated group (2-way ANOVA, all P < 0.0001), in contrast to FN1 (2-way ANOVA, P < 0.01). However, no difference was observed between α-SMA of GO and non-GO in TGF-β1-treated group (2-way ANOVA, P > 0.05). The mRNA levels of COL1A2 and FN1 in GO Gyps-treated groups were higher than that in non-GO (2-way ANOVA, all P < 0.01). The protein levels of HA, Col 1, α-SMA, and FN in GO TGF-β1-treated groups were significantly higher than non-GO groups (2-way ANOVA, all P < 0.01). Additionally, the protein levels of HA and FN in GO Gyps-treated groups were higher (2-way ANOVA, all P < 0.001).

Figure 7.

The mRNA levels of fibrotic mediators in OFs. Go (n = 6) and non-GO (n = 4) OFs were treated with 10 ng/mL TGF-β1 for 24 hours in the absence or presence of pretreating with 100 µg/mL Gyps for 24 hours. The expression of HAS2 (A), COL1A2 (B), α-SMA (C), and FN1 (D) mRNA in each cell group was evaluated by RT-qPCR. **P < 0.01, ***P < 0.001, and ****P < 0.0001 versus TGF-β1-stimulated cells, 1-way ANOVA.

Figure 8.

The protein levels of fibrotic mediators in OF culture supernatant. Go (n = 6) and non-GO (n = 4) OFs were treated with 10 ng/mL IL-1β for 24 hours in the absence or presence of pretreating with 100 µg/mL Gyps for 24 hours. The production of HA (A), Col 1 (B), α-SMA (C), and FN (D) protein in each cell group was evaluated by ELISA assay. **P < 0.01 and ****P < 0.0001 versus TGF-β1-stimulated cells, 1-way ANOVA.

Gyps Anti-Inflammatory Effect is Mediated Through TLR4/NF-κB Signaling

To clarify the role of Gyps in TLR4/NF-κB signaling, Western blotting assay was conducted. Consistent with the observed increases in inflammation-related mRNA expression, TLR4 and NF-κB were significantly increased in IL-1β (10 ng/mL, 24 hours) group (Fig. 9A for GO and Fig. 10A for non-GO). Gyps (100 µg/mL, 24 hours) treatment obviously decreased the IL-1β-induced activation of TLR4/NF-κB signaling pathway (Fig. 9A for GO and Fig. 10A for non-GO).

Figure 9.

Effects of Gyps on inflammation- and fibrosis-related signaling pathways in GO OFs. Expression levels of TLR4 (A) and NF-κB (A) in GO (n = 6) OFs were evaluated after treatment with IL-1β (10 ng/mL, 24 hours) in the absence or presence of pretreating with Gyps (100 µg/mL, 24 hours). Expression levels of SMAD2 (B), p-SMAD2 (C), and SMAD4 (D) in GO (n = 6) OFs were evaluated after treatment with TGF-β1 (10 ng/mL, 24 hours) in the absence or presence of pretreating with Gyps (100 µg/mL, 24 hours). *P < 0.05, ***P < 0.001, and ****P < 0.0001, 1-way ANOVA.

Figure 10.

Effects of Gyps on inflammation- and fibrosis-related signaling pathways in non-GO OFs. Expression levels of TLR4 (A) and NF-κB (A) in non-GO (n = 4) OFs were evaluated after treatment with IL-1β (10 ng/mL, 24 hours) in the absence or presence of pretreating with Gyps (100 µg/mL, 24 hours). Expression levels of SMAD2 (B), p-SMAD2 (C), and SMAD4 (D) in non-GO (n = 4) OFs were evaluated after treatment with TGF-β1 (10 ng/mL, 24 hours) in the absence or presence of pretreating with Gyps (100 µg/mL, 24 hours). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001, 1-way ANOVA.

Gyps Anti-Fibrosis Effect is Mediated Through SMADs Signaling

Previous research indicated that the TGF-β1-induced α-SMA upregulation was mainly mediated by SMAD signaling pathway. To quantify the expression and activation of SMAD2/4 in OFs, Western blotting assay was conducted. Consistent with our previous findings that fibrosis-related mRNAs were increased by TGF-β1 (10 ng/mL) treatment, the levels of SMAD2, p-SMAD2, and SMAD4 were significantly increased in OFs challenged with TGF-β1 (Figs. 9B–D for GO and Figs. 10B–D for non-GO). Gyps (100 µg/mL, 24 hours) treatment obviously decreased the TGF-β1-induced activation of SMAD2/4 signaling pathway (Figs. 9B–D for GO and Figs. 10B–D for non-GO).

Discussion

GO seriously affects the appearance and visual function of patients. It has been shown that the functions of OFs are regulated not only by inflammatory factors secreted by T cells, B cells, macrophages, and mast cells, but also by surface receptors, such as TSHR and IGF-1R. These cytokines and receptors mediate the pathological processes of GO by modulating cell proliferation, inflammatory factor secretion, extracellular matrix synthesis, and fibrosis.⁸ The immune inflammatory reaction, fibrosis, and oxidation of OFs are important factors for the occurrence and development of GO and are important targets in GO treatment. At present, there are still many limitations in the treatment of GO, finding new drugs with better therapeutic effects and fewer side effects are particularly urgent for the treatment of orbital inflammation and fibrosis. In this study, we found that IL-1β stimulated OFs to produce inflammatory factors, such as IL-6, IL-8, TNF-α, and MCP-1, via regulating NF-κB signaling pathway. Although TGF-β1 promoted the secretion of α-SMA, FN, HA, and Col 1 via regulating SMAD signaling pathway. In addition, Gyps prevented inflammation and fibrosis-related changes induced by IL-1β and TGF-β1 in OFs, and then reduced the apoptosis of OFs. Moreover, we found that Gyps displayed its biological effects on OFs even at a low concentration. The discrepancies between GO and non-GO OFs in control, stimulated, and Gyps-treated groups were not completely consistent, however, most of the indicators’ mRNA expression and protein secretion levels were statistically lower in non-GO group after treatment of Gyps. Potential underlying mechanism remains to be determined. This study is helpful to explain the action mechanisms of Gyps in the treatment of orbital inflammation and fibrosis in GO.

It has been extensively characterized that IL-1β played a primary role in a variety of cell activities, including immune response and cell apoptosis.³⁵ Furthermore, inflammation plays a dominant role in the early histopathology of GO. IL-1β is a member of the IL-1 cytokine family and serves as an important mediator of inflammation.³⁶ It has been found that IL-1β increased the autophagy activity of GO cells, and inhibited the adipogenic differentiation of preadipocytes by blocking autophagy induced by bafilomycin A1 treatment or ATG-5 knockout, which is reported to contribute to GO pathogenesis.³⁷ In this study, IL-1β was used to establish the inflammatory model of OFs to further study the anti-inflammatory effect of Gyps. Additionally, orbital fibrosis is mediated by a variety of inflammatory factors and mechanical stimulation, including TGF-β family (TGF-β1, TGF-β2, and TGF-β3). TGF-βs are regarded as an essential factor associated with many eye tissue fibrosis, including corneal opacification, pterygium, proliferative vitreoretinopathy, and conjunctival fibrosis after glaucoma surgery.³⁸ Among them, TGF-β1 has been shown to stimulate myofibroblasts differentiation, extracellular matrix synthesis or fibroblasts of corneal fibroblasts, conjunctival fibroblasts, and OFs.^39–42 Thus TGF-β1 was used to establish the fibrosis model of OFs to study the anti-fibrosis effect of Gyps. Because of the shorter effects of IL-1β/TGF-β1 in vitro, IL-1β and TGF-β1 were given after Gyps treatment to achieve the best drug stimulation effect and determine the effect of Gyps. NF-κB is a central transcription factor activated by many inflammatory cytokines, including IL-1β, and widely participates in the regulation of immune responses and inflammation.⁴³ SMADs are crucial transcription factors in TGF-β1 signaling and participate in animal embryonic development and tissue regeneration.⁴⁴ Previous reports have shown that the differentiation of myofibroblasts was regulated by TGF-β/SMAD signaling pathway.^45,46 Hence NF-κB and SMAD pathways are important signaling pathways related to GO-related inflammation and fibrosis, respectively.

Gyps are the main components in the extract of Gynostemma pentaphyllum. They are popular Chinese herbal extracts in China, serving as characteristic drugs of the Zhuang nationality in Guangxi Province.⁴⁷ Studies have previously shown that Gyps were widely used because of its anti-inflammatory, anti-tumor, immune enhancement, anti-ulcer, antioxidant, and anti-aging effects.^48–50 In this present study, we first studied the anti-inflammatory and anti-fibrosis functions of Gyps in GO-related inflammation and fibrosis in vitro. We found that the expression and secretion of inflammatory cytokines (IL-6, IL-8, TNF-α, and MCP-1) were increased after IL-1β stimulation. Additionally, the expression and secretion of fibrotic factors (HA, α-SMA, FN, and Col-1, and extracellular matrix⁵¹) were increased after TGF-β1 stimulation in OFs. Although all of these mediators were decreased after treatment with Gyps. Besides, Gyps could also inhibit NF-κB signaling pathway and SMAD signaling pathway in OFs. These data suggested that Gyps can not only reduce orbital inflammation, but also inhibit the fibrosis in OFs.

Conclusions

Although Gyps could be considered as a complementary treatment for GO, however, this study only investigated the ex vivo effects of Gyps on ex vivo cultured OFs, further studies and clinical trials are needed to verify its effects on GO patients. In summary, our study identified the roles of Gyps in suppressing the inflammation and fibrosis of OFs from GO patients by inhibiting NF-κB and SMAD signaling pathways. These findings suggest that Gyps are promising complementary anti-inflammatory and anti-fibrosis drugs for GO.