Skip to main content
PLOS One logoLink to PLOS One
. 2020 Aug 6;15(8):e0236657. doi: 10.1371/journal.pone.0236657

Translational research into the effects of cigarette smoke on inflammatory mediators and epithelial TRPV1 in Crohn’s disease

Liesbeth Allais 1,2,*, Stephanie Verschuere 3, Tania Maes 4, Rebecca De Smet 2, Sarah Devriese 5, Gerard Bryan Gonzales 5, Harald Peeters 6, Koen Van Crombruggen 7, Claus Bachert 7, Martine De Vos 5, Guy G Brusselle 4, Ken R Bracke 4, Claude A Cuvelier 2,#, Debby Laukens 5,#
Editor: Mathilde Body-Malapel8
PMCID: PMC7410291  PMID: 32760089

Abstract

Crohn’s disease is a pathological condition of the gastro-intestinal tract, causing severe transmural inflammation in the ileum and/or colon. Cigarette smoking is one of the best known environmental risk factors for the development of Crohn’s disease. Nevertheless, very little is known about the effect of prolonged cigarette smoke exposure on inflammatory modulators in the gut. We examined the effect of cigarette smoke on cytokine profiles in the healthy and inflamed gut of human subjects and in the trinitrobenzene sulphonic acid mouse model, which mimics distal Crohn-like colitis. In addition, the effect of cigarette smoke on epithelial expression of transient receptor potential channels and their concurrent increase with cigarette smoke-augmented cytokine production was investigated. Active smoking was associated with increased IL-8 transcription in ileum of controls (p < 0,001; n = 18-20/group). In the ileum, TRPV1 mRNA levels were decreased in never smoking Crohn’s disease patients compared to healthy subjects (p <0,001; n = 20/group). In the colon, TRPV1 mRNA levels were decreased (p = 0,046) in smoking healthy controls (n = 20/group). Likewise, healthy mice chronically exposed to cigarette smoke (n = 10/group) showed elevated ileal Cxcl2 (p = 0,0075) and colonic Kc mRNA levels (p = 0,0186), whereas TRPV1 mRNA and protein levels were elevated in the ileum (p = 0,0315). Although cigarette smoke exposure prior to trinitrobenzene sulphonic acid administration did not alter disease activity, increased pro-inflammatory cytokine production was observed in the distal colon (Kc: p = 0,0273; Cxcl2: p = 0,104; Il1-β: p = 0,0796), in parallel with the increase of Trpv1 mRNA (p < 0,001). We infer that CS affects pro-inflammatory cytokine expression in healthy and inflamed gut, and that the simultaneous modulation of TRPV1 may point to a potential involvement of TRPV1 in cigarette smoke-induced production of inflammatory mediators.

Introduction

Crohn’s disease (CD) is characterized by severe gastro-intestinal inflammation and results from a complex interplay between genetic and environmental factors. In CD patients, a transmural and discontinuous inflammation affects mainly the ileum and colon, however, inflammatory lesions can extend to any part of the gastrointestinal tract [1, 2]. CD is mediated by a Th1 inflammatory response at the level of the gut mucosa [3]. Increased numbers of Th17 cells and the production of Th17-related cytokines are also reported to be associated with active inflammation in CD patients [4]. Emerging evidence suggests that the development of CD in susceptible individuals is a consequence of a dysregulated dialogue between the intestinal microbiota and the immune system of the gut [5, 6]. In addition, environmental factors affect the incidence and disease course of CD. Active smoking in particular is a very prominent risk factor [7].

Cigarette smoking (CS) doubles the risk of developing CD, and has detrimental effects on its clinical course, necessitating increased need for steroids, immunosuppressive drugs, and surgery [8, 9]. The effect of CS exposure on the intestine is complex and depends on the location of inflammation. In addition, a wide range of substances are involved including nicotine, acrolein, oxygen-free radicals and carbon monoxide. CS affects the mucus layer composition, cytokine and eicosanoid production, immune cell functions, gastrointestinal motility, microvasculature and even the composition and activity of the microbiome in the gastro-intestinal tract [10–12]. We have previously shown that chronic CS exposure triggers the gut immune system through the recruitment of immune cells to the Peyer’s patches, with an increase of CCL9 and a decrease of CCR6 in the ileum [13, 14]. Experimental data investigating the effects of CS in animal models of CD, e.g. the trinitrobenzene sulphonic acid (TNBS)-induced Crohn-like colitis, are inconsistent [15]. CS exposure during four days or nicotine administration has been shown to aggravate TNBS-induced colonic inflammation, whereas also an attenuating effect or no effect at all has been reported [16–21].

To date, the mechanism underlying the modulation of cytokine production by CS remains to be revealed. Transient receptor potential (TRP) channels, which act as sensors of various intra- and extracellular stimuli, including CS components, are associated with CD-related abdominal pain and could be implicated in inflammatory processes in the gut [22]. Previous work indicated the involvement of TRP channels on sensory neurons in pro-inflammatory responses of the colon, however, no consensus on the actual role of each channel has been reached [23, 24]. Only TRPV4 has been shown to be implicated in gut inflammation [25, 26]. Until today, the importance of epithelial TRP channels in gut inflammation and the potential modulation by CS has not yet been elucidated. The importance of TRP channels and CS in intestinal inflammation has been reviewed recently [27].

In this manuscript, we investigated the effect of CS exposure on CD using gut tissue of patients and a murine colitis model. We demonstrated that CS modulates pro-inflammatory mediator production and TRPV1 expression and suggest that epithelial TRPV1 activation may precede pro-inflammatory mediator release in the gut. We observed changes in IL-8 and TRPV1 in the ileum of CD patients, which prompted us to investigate whether CS-induced TRPV1 expression might be linked to a simultaneous cytokine/chemokine induction in experimental mouse models and human gut cell lines.

Materials and methods

Patients

In total, 155 human subjects were examined. All patients were recruited at the Ghent University Hospital between 2010 and 2015. Patients and controls with a Pack Year of at least 10 were included as actively smoking. Ileal biopsies of 19 current smokers and 18 never smokers with CD, and 18 current smokers and 20 never smokers without CD were collected. No selection was made based on gender. In five controls and five patients, ileal and colonic biopsies were taken from the same patient. The characteristics of the ileal biopsy donors are listed in Table 1. Colonic biopsies of 20 never smokers and 20 current smokers with colonic CD, and 20 healthy current smokers and 20 healthy never smokers were sampled. The characteristics of the colonic biopsy donors are listed in Table 2. A current smoker was defined as a subject consuming at least 10 cigarettes daily. A never smoker has never smoked in his/her entire life. The CD patients were diagnosed based on the clinical, endoscopic and histological features of the Lennard-Jones’ criteria [28]. Control biopsies were obtained from patients who underwent colonoscopy for follow-up of polyp detection or colon carcinoma screening. The controls do not suffer from any inflammatory diseases. The samples were stored in RNAlater at -80°C for qPCR analysis or formalin-fixed, paraffin-embedded and evaluated for histologic inflammation. TRPV1 and IL-8 expression was investigated by immunohistochemistry and qPCR. This study was approved by the local Ethical Committee of University Hospital Ghent (EC UZG 2010/116) and involved Caucasian participants. The above described methods were carried out in accordance with the approved guidelines. Written informed consent was obtained from all participating subjects.

Table 1. Characteristics of ileal biopsy donors.

Control Ileum Ileal CD
Never smokers Current smokers Never smokers Current smokers
Number of subjects 20 18 18 19
Pack Year (mean, IQR) - 15,9 (4–50) - 15,9 (7,5–37)
Age (median, IQR) in years 53 (28–74) 51 (39–72) 34 (28–76) 43 (30–63)
Age at diagnosis (median, IQR) in years - - 28 (22–57) 31 (23–60)
Gender (Female/Male) 13/7 11/7 10/8 11/8
C-reactive protein (mean ± SD, IQR) in mg/dl 1,1 ± 2,3 (0,1–9,3) 2,4 ± 4,2 (0,1–14,8) 6,6 ± 13,7 (0,5–52,5) 9,9 ± 12,0 (0,9–37,1)
Medication
No Medication 20 18 1 3
Immunosuppressives 0 0 1 9
Corticosteroids 0 0 1 1
Biologicals 0 0 6 2
5-aminosalicylates 0 0 1 3
Combination 0 0 8 2

PY: Pack year. CD: Crohn’s disease. SD: standard deviation. IQR: interquartile range. *: p < 0,05.

Table 2. Characteristics of colonic biopsy donors.

Control Colon Colonic CD
Never smokers Current smokers Never smokers Current smokers
Number of subjects 20 20 20 20
Pack Year (mean, IQR) - 17,1 (10–40) - 13 (7,75–34)
Age (median, IQR) in years 55,5 (31–74) 50 (42,5–76) 34,5 (28–60) 39 (30–51)
Age at diagnosis (median, IQR) in years - - 26,5 (20–56) 31 (22–46)
Gender (Female/Male) 11/9 12/8 11/9 7/13
C-reactive protein (mean ± SD, IQR) in mg/dl 1,07 ± 2,24 (0,1–9,3) 2,3 ± 4,41 (0,1–14,8) 4,49 ± 12,55 (0,5–52,5) 11,77 ± 12,01 (1,35–37,1)
Medication
No Medication 20 20 3 5
Immunosuppressives 0 0 2 7
Corticosteroids 0 0 1 1
Biologicals 0 0 4 3
5-aminosalicylates 0 0 3 2
Combination 0 0 6 2

PY: Pack year. CD: Crohn’s disease. SD: standard deviation. IQR: interquartile range. *: p < 0,05.

Animals

Male C57BL/6 mice were purchased from Charles River Laboratories (Beerse, Belgium). All mice were 6–8 weeks old at the start of the cigarette smoke exposure. The mice were housed in groups of 5 mice per cage, containing untreated wood shavings and a plastic house for environmental enrichment. The animal room was controlled and maintained at a temperature of 22°C, humidity of 50% and a 12h/12h light/dark cycle. All mice had free access to water and were offered a standard chow diet ad libitum (Carfil Quality, Turnhout, Belgium). Each group consists of 10 mice. Two groups of 10 mice were used in the six-month cigarette smoking experiment and four groups of 10 mice were used in the TNBS experiment. In total, 60 mice were sacrificed. The Ethical Committee for animal experimentation of the faculty of Medicine and Health Sciences (Ghent, Belgium) approved all experiments (ECD 25/11). The above described methods were carried out in accordance with the approved guidelines of the Ethical Committee.

Cigarette smoke exposure

Mice were exposed whole body to mainstream cigarette smoke, as described previously [29]. Briefly, groups of 10 mice were exposed to the tobacco smoke of five cigarettes (Reference Cigarette 3R4F without filter; University of Kentucky, Lexington, KY, USA) four times a day with 30 min. smoke-free intervals, five days per week for 4 or 24 weeks. An optimal smoke:air ratio of 1:6 was obtained. The control groups were exposed to air. Carboxyhaemoglobin in serum of CS-exposed mice reached a non-toxic level of 8.7 ± 0,31% (compared with 0.65 ±0,25% in air-exposed mice), which is similar to carboxyhaemoglobin blood concentrations of human smokers [30].

Experimental colitis

After four weeks of smoke exposure, colitis was induced one day after cessation of exposure by intrarectal administration of 100 μl of 2.5% (w/v) TNBS (5% picrylsulfonic acid solution; Sigma Aldrich, Zwijndrecht, the Netherlands) diluted 1:1 in absolute ethanol, as described previously [21]. Mice were fasted one day before TNBS administration. Anesthetized mice were given either a 100 μl TNBS or sham (PBS diluted 1:1 in absolute ethanol) enema. To minimize excretion of TNBS solution, animals were inverted for 60 seconds following completion of the enema. Body weight was monitored throughout the study. At day two post-colitis induction, mice were sacrificed. The mice were euthanized with an overdose of pentobarbital (Sanofi-Ceva, Paris, France). The distal colon was excised and its length was measured, after which colonic samples were fixed in 4% (w/v) paraformaldehyde, stored in RNAlater (Qiagen, Hilden, Germany) or snap-frozen.

Cell culture

The human colorectal adenocarcinoma cell lines HT-29 (HTB-38™) [31], Caco-2 (HTB-37™) [31] and T-84 (CCL-248™) [32] were purchased from the American Type Culture Collection (ATCC, Rockville, MD). Caco-2 was maintained in Dulbecco’s Modified Eagle Medium (DMEM) with 10% foetal calf serum (FCS). T84 was maintained in Dulbecco’s Modified Eagle Medium/Nutrient mixture F-12 with 5% FCS. HT-29 was maintained in DMEM containing 10% FCS, 100 U/mL penicillin, 100 μg/mL streptomycin, 2 mM L-glutamine, and 0.1 mM non-essential amino acids. All cell cultures were grown at 37°C and a humidified atmosphere of air/CO2 (95:5, v/v), with three medium changes per week. All media and supplements were purchased from Life Technologies (Merelbeke, Belgium). To induce differentiation, T-84 cells were seeded on 24-well, 0.4 μm pore diameter, semipermeable inserts (Greiner Bio-One, Vilvoorde, Belgium) at a density of 105 cells per well and cultured for 3 weeks. Medium was changed three times per week. After this period, the integrity of the monolayer was evaluated by measuring the TEER using a Millicell ERS-2 Volt-Ohm Meter (Merck Millipore, Billerica, MA, USA) to ensure monolayers with TEER values of 700 Ω.cm2 or higher were obtained [33]. For TRPV1 staining, HT-29 and T-84 cells were plated on glass chamber slides (Fisher Scientific, Merelbeke, Belgium) at a cell density of 5 × 104/well and cultured for 24 hours, after which the cells were harvested and washed with ice-cold PBS and fixed with 4% paraformaldehyde, while being kept in the chamber slides.

H&E staining and scoring

Paraffin-embedded 4 μm tissue sections were taken from ileal and colonic tissue samples, dewaxed and rehydrated. The sections of human and mouse were both stained with H&E. The H&E staining was performed using the Tissue-Tek Prisma/Film automated slide stainer (Sakura, Torrance, US). Only in TNBS-treated mice, the degree of colon inflammation was scored in a blinded manner and independently by two pathologists according to a scoring scheme (Table 3) adapted from Van der Sluis et al., 2006 [34]. The histologic scoring was performed on the two most distal colonic sections, 5 mm apart from each other, and on a proximal section at approximately 5 cm from the rectum.

Table 3. Histologic score to quantify the degree of gastrointestinal inflammation.

Score
0 1 2 3 4
Goblet cells -
Mucosa thickening -
Inflammatory cells -
Submucosa cell infiltration - -
Destruction of architecture - -
Ulcers (epithelial cell surface) 0% 0–25% 25%-50% 50%-75% 75%-100%
Crypt abscesses 0 1–3 4–6 7–9 >10

Scoring scheme adapted from Van der Sluis et al., 2006.

Immunohistochemistry/fluorescence for TRPV1

Paraffin-embedded sections of human and mouse ileum and colon were dewaxed, after which treatment with Tris/EDTA (pH = 9) was performed for antigen retrieval. Endogenous peroxidase activity was blocked with 0.3% H2O2, followed by blocking of non-specific binding sites with 1% BSA in PBS. Subsequently, slides were incubated with the primary antibody (polyclonal rabbit anti-TRPV1, ab31895 for mouse and ab63083 for human, Abcam) or rabbit IgG isotype control at room temperature for one hour and with the biotinylated goat anti-rabbit secondary antibody (DAKO Agilent, Santa Clara, US) for 30 min at room temperature. Thereafter, HRP-conjugated streptavidin (DAKO Agilent, Santa Clara, US) was applied for 30 min. DAB was used as an enzyme substrate before counterstaining with haematoxilin. The trigeminal ganglia of a wild-type mouse were used as a positive control. TRPV1 protein expression was quantified in an area containing 10 aligning longitudinal villi using the AxioVision software (Carl Zeiss, Zaventem, Belgium). For normalization, the measured area staining positive for TRPV1 was divided by the total area containing the 10 longitudinal villi.

TRPV1 staining of HT-29 and T-84 cells was performed by blocking paraformaldehyde-fixed cells with 1% BSA/PBS and incubating with anti-human TRPV1 (ab63083, Abcam, Cambridge, UK; 1:100) overnight at 4°C. Detection was performed with an AlexaFluor594-conjugated secondary antibody (Life Technologies) and DAPI (1:5000) as a nuclear stain. Stained cells were viewed with a fluorescence microscope (Carl Zeiss, Zaventem, Belgium).

Quantitative real-time PCR

RNA from ileum, proximal and distal colon of mice and human ileal and colonic biopsies was extracted using the Qiagen miRNeasy Mini Kit (Qiagen, Hilden, Germany). Subsequently, cDNA was synthesized by reverse transcription using the iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Nazareth, Belgium) following the manufacturer’s instructions. Expression of mouse target genes Kc, Cxcl2, Il-1β, Trpv1 and human target genes TRPV1 and IL-8, and reference genes high mobility group 20a (Hmg20a), hydroxymethylbilane synthase (Hmbs) and glyceraldehyde-3-phosphate (Gapdh) (sequences are provided in Table 4), was analyzed by qRT-PCR using the SensiMix™ SYBR No-ROX Kit (Bioline, London, UK). qRT-PCR was performed on a LightCycler480 detection system (Roche, Vilvoorde, Belgium) with the following cycling conditions: 10 min incubation at 95°C, 45 cycles of 95°C for 10 seconds and 60°C for 1 min. Melting curve analysis confirmed primer specificity. The PCR efficiency of each primer pair was calculated using a standard curve from reference cDNA. The amplification efficiency was determined using the formula 10−1/SLOPE—1.

Table 4. Primer sequences qRT-PCR.

Gene Symbol Accession Number Forward Primer (5’-3’) Reverse primer (3’-5’) Effic R2
Mouse
Hmbs NM_001110251 AAGGGCTTTTCTGAGGCACC AGTTGCCCATCTTTCATCACTG 99 0,99
Hmg20a NM_025812 AGTGGAGAAATACCAACAGTGGA AAGTTTTCGTTGTCTTGGGGAT 98 0,9979
Cxcl1/Kc NM_008176 ACCGAAGTCATAGCCACACTC TCTCCGTTACTTGGGGACAC 95 0,9995
Cxcl2 NM_009140 GCGCCCAGACAGAAGTCATAG AGCCTTGCCTTTGTTCAGTATC 89,2 0,99
Il-1β NM_000576 CACGATGCACCTGTACGATCA GTTGCTCCATATCCTGTCCCT 97 0,9987
Trpv1 NM_001001445 CCGGCTTTTTGGGAAGGGT GAGACAGGTAGGTCCATCCAC 103 0,9596
Human
Gapdh NM_002046 TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG 91 0,9936
Hmbs NM_000190 GGCAATGCGGCTGCAA GGGTACCCACGCGAATCAC 101 0,998
Trpv1 NM_080706 CTGCCCGACCATCACAGTC CTGCGATCATAGAGCCTGAGG 93 0,9177
Il-8 NM_000584 TGTTCCACTGTGCCTTGGTTTC TGTGAGGTAAGATGGTGGCTAATAC 98 0,9925

Protein extraction, Luminex assay and ELISA

25–30 μg of snap-frozen mouse distal colon samples were suspended in a 10 times volume of 0.9% NaCl solution with protease inhibitor Complete Roche (Roche, Vilvoorde, Belgium) and pulverized by means of a mechanical TissueLyser LT (Qiagen, Hilden, Germany) at 50 oscillations per second for 2 minutes in pre-chilled eppendorfs. The tissue homogenates were centrifuged at 12000 g for 5 minutes at 4°C and the supernatants were stored at –20°C until further analysis.

Protein levels of mouse CXCL1/KC, CXCL2 and IL-1β were measured by means of the Luminex xMAP Technology Reader using the Magnetic Luminex Screening Assay (R&D Systems, Abingdon, UK) on a Bio-PlexTM 200 Array Reader (BioRad, Nazareth, Belgium) according to the manufacturer’s instructions.

The IL-8 protein content of human cell culture supernatant was measured by ELISA according to the manufacturer’s instructions (human CXCL8/IL-8 Duoset ELISA, R&D Systems, Abingdon, UK).

The CRP level in human patient blood was determined by ELISA in the Clinical Biology Lab of the Ghent University Hospital.

Statistical analysis

Gene expression levels depicted in bar graphs were expressed as mean ± standard error of the mean (= SEM) and error bars depict the SEM. Statistical analysis was performed using ANOVA following post-hoc Tukey tests or Student’s t-test. Gene expression levels depicted in boxplots were expressed as median ± error. Statistical analysis was performed using a general linear model with smoking, IBD status and their interaction as independent variables, and either protein or gene expression level as dependent variable using R version 3.60. Multiple comparison to determine statistically significant pairs was performed using the multicomp package (S1 File). A p-value of less than 0.05 was considered significant. We applied the Intraclass Correlation Coefficient in order to determine correlation between histologic scores assessed by two independent pathologists.

Results

Smoking affects IL-8 and TRPV1 expression in the human gut

To address the effect of smoking on IL-8 and TRPV1 expression in the human healthy and inflamed gut, we analyzed ileal and colonic biopsies of 155 subjects (Tables 1 and 2). Pack years were comparable among current smokers and age of diagnosis was equal among CD patients. The mean age of the subjects was comparable within the CD and control groups, with a lower median age for CD patients compared to the healthy controls. As each group contains a wide range of ages (shown by IQR in Tables 1 and 2), age was taken into account as a confounding factor in the statistical analysis.

C-reactive protein (CRP) levels were not significantly different among ileal CD patients and their controls. In the ileal CD patient groups, never smokers mostly receive biological or combination therapy, while current smokers mostly receive immunosuppressives. In agreement with literature, IL-8 mRNA was strongly induced in ileal biopsies of CD patients compared to healthy controls (both never and active smokers) (Fig 1A). IL-8 mRNA is marginally induced in ileal biopsies of healthy active smokers compared to healthy never smokers. In CD, IL-8 levels are similar in ileal biopsies of never and active smokers (Fig 1A). In the ileum, TRPV1 mRNA is elevated in never smoking healthy controls compared to never smoking CD patients (Fig 1C). Expression of TRPV1 mRNA and protein remained unchanged in the ileum (Fig 1C and 1E). A TRPV1-stained ileal biopsy of a currently smoking CD patient is shown in Fig 1G.

Fig 1. mRNA expression of Il-8 and mRNA and protein expression of TRPV1 in the ileum and colon of never and currently smoking healthy subjects and Crohn’s Disease (CD) patients.

Fig 1

mRNA values are relative to the expression of two reference genes (glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)). TRPV1 protein values were measured via immunohistochemical staining. (A) Expression of Il-8 mRNA in the ileum significantly increases in currently smoking controls (p = 0.0143) and in both never and currently smoking CD patients compared to their respective controls (both p < 0.0001). (B) Expression of Il-8 mRNA in the colon significantly increases in currently and never smoking CD patients compared to their respective controls. (C) Expression of Trpv1 mRNA in the ileum increased in never smoking CD patients compared to their controls (p = 0.052) and decreased in never smoking CD patients compared to never smoking healthy controls (p < 0.001). (D) Expression of Trpv1 mRNA in the colon decreased in active smoking healthy subjects compared to never smoking healthy subjects. (E) Expression of TRPV1 protein remained unchanged in the ileum. (F) Expression of TRPV1 protein in the colon remained unchanged. (G) Ileal biopsy of a never smoking control (1), a currently smoking control (2), a never smoking CD patient (3) and a currently smoking CD patient (4) stained for TRPV1. (H) Colonic biopsy of a never smoking control (1), a currently smoking control (2), a never smoking CD patient (3) and a currently smoking CD patient (4) stained for TRPV1. Data are represented as median±error. *: p < 0.05; **: p < 0.01; ***: p < 0.001. Potential confounding factors (age, gender) were taken into account for statistical analysis.

In currently smoking colonic CD patients, CRP levels were significantly increased compared to never smoking CD patients. In agreement with literature, IL-8 mRNA was strongly induced in colonic biopsies of CD patients compared to healthy controls (Fig 1B). In CD, smoking does not show a significant increase of IL-8 mRNA levels in colonic biopsies of active smoking CD patients compared to never smoking CD patients (Fig 1B). Expression of TRPV1 mRNA and protein remained unchanged in the colon (Fig 1D and 1F). A TRPV1-stained colonic biopsy of a currently smoking CD patient is shown in Fig 1H (S2 File).

Chronic cigarette smoke exposure induces cytokine/chemokine expression and TRPV1 in the murine gut

To further investigate the influence of cigarette smoke (CS) on intestinal cytokines/chemokines and TRPV1 expression in the gut, we exposed C57/Bl6 mice to CS during 24 weeks as described previously [35]. The expression of the mouse IL-8 homologues chemokine (C-X-C motif) ligand 2 (CXCL2) and keratinocyte chemoattractant (KC) was evaluated. In the CS-exposed mice, Cxcl2 mRNA was increased only in the ileum and Kc mRNA was elevated only in the distal colon (Fig 2A and 2B). Considering the increased interest in TRP channels and their potential role in pro-inflammatory responses in the gut [36], we assessed the expression of TRPV1 in the gut. Real-time qPCR on total mRNA isolated from mouse whole intestinal tissue from three specific gut regions (ileum, proximal and distal colon) demonstrated detectable levels of mouse Trpv1 transcripts in all regions. In ileum, Trpv1 mRNA expression was significantly elevated by CS exposure (Fig 2C). Assessing protein expression of TRPV1 by immunohistochemistry in ileal and colonic sections revealed that TRPV1 expression increased in gut epithelial cells after chronic CS exposure and was present on the surface of the gut epithelium (Fig 2F–2I), as quantified by image analysis (Fig 2D–2I) (S3 File).

Fig 2. Expression of cytokines/chemokines and TRP channels in non-inflamed C57/Bl6 mice chronically exposed to air or Cigarette Smoke (CS).

Fig 2

Relative to the expression of two reference genes (hydroxybilane synthase (HMBS) and high mobility group 20a (HMG20A)). (A) mRNA expression of Cxcl2 significantly increases in the ileum after 24 weeks of CS exposure (p = 0.0075). (B) mRNA expression of Kc significantly increases in the distal colon after 24 weeks of CS exposure (p = 0.0186). (C) mRNA expression of Trpv1 significantly increases in the ileum after 24 weeks of CS exposure (p = 0.0315). (D) Protein expression of TRPV1 significantly increases in the ileum after 24 weeks of CS exposure (p = 0.0317). (E) Protein expression of TRPV1 remains unchanged in the colon. (F) TRPV1 protein in ileum section of an air-exposed mouse. (G) TRPV1 protein in ileum section of a mouse exposed to CS during 24 weeks. (H) TRPV1 protein in colon section of an air-exposed mouse. (I) TRPV1 protein in colon section of a mouse exposed to CS during 24 weeks. ANOVA was performed. P-values lower than 0.05 were considered significant. Data are represented as mean±SEM. *: p < 0.05; **: p < 0.01; ***: p < 0.001.

Prior cigarette smoke exposure does not affect the development of TNBS-induced colitis in mice

We evaluated the development of TNBS-induced colitis in C57BL/6 mice that were previously exposed to CS or air during 4 weeks (Fig 3A). Two days after TNBS challenge, mice developed colitis as assessed by a significant body weight loss of 20% (Fig 3B) and colon length shortening (Fig 3C) compared to sham treatment. No significant differences in weight loss were observed in TNBS-treated mice that were either air- or CS-exposed (Fig 3B). At two days post-TNBS-enema, histological inflammation and epithelial destruction was apparent in the TNBS-treated, but not in the sham-treated group, which was not significantly affected by CS exposure (Fig 3D–3F). Also, no changes in colon length due to CS exposure were observed (Fig 3C) (S4 File).

Fig 3. Effect of CS exposure on histology and clinical parameters of TNBS-induced colitis.

Fig 3

(A) The applied protocol for CS exposure and TNBS-induced colitis. Mice were exposed to CS four times a day during four weeks. The day after the last CS exposure, TNBS was administered intrarectally. Mice were sacrificed at day two (D2). (B) Body weight displayed as percentage of the weight at the day of the last CS exposure (D-1). (C) Colon length (in cm) at two days post-TNBS treatment. Colons were excised from anus to caecum. Before measuring the length, the rectum (5 mm starting from the anus) was removed. (D) Distal colon of the PBS-challenged control group. (E) Distal colon of an air-exposed mouse two days post-TNBS enema. (F) Histological score of inflammation in the distal colon at two days post-TNBS treatment. The independent investigators show a kappa of 0,287. ANOVA was performed. Data are represented as mean±SEM. *: p < 0.05; **: p < 0.01; ***: p < 0.001.

Prior cigarette smoke exposure aggravates TNBS-induced pro-inflammatory mediator production and TRPV1 expression in the gut

In mice exposed to air, TNBS treatment induced the expression of KC, CXCL2 and IL-1β in the distal colon, both at the mRNA and protein level two days post-TNBS (Fig 4A–4F). Exposure to CS significantly aggravated the expression of TNBS-induced Kc, Cxcl2 and Il-1β mRNA in the distal colon after two days (Fig 4A, 4C and 4E). Also at protein level, CS exposure tended to induce the expression of KC and CXCL2, and significantly increased IL-1β in distal colonic tissue of TNBS-challenged mice (Fig 4B, 4D and 4F). A significant increase could not be shown for KC and CXCL2 protein, probably due to the small sample size of 10 mice/group. Notably, CS exposure during 4 weeks also modulated pro-inflammatory mediator expression in sham-treated animals, with nominal increases in KC, CXCL2 and IL-1β either at mRNA and protein level. Furthermore, we demonstrated that Trpv1 mRNA expression is induced in the distal colon of TNBS-challenged CS-exposed mice compared to the air-exposed mice two days post-TNBS (Fig 4G), which is in line with the CS-induced aggravation of TNBS-induced CXCL2, KC and IL-1β (Fig 4A–4F). No changes in TRPV1 protein were observed in CS-exposed mice two days post-TNBS compared to sham-treated mice (Fig 4H) (S4 File).

Fig 4. Inflammatory gene expression levels in TNBS-challenged mice.

Fig 4

mRNA expression of cytokines in the distal colon of 10 mice/group was analyzed using real-time qPCR at two days post-TNBS-treatment. Expression levels were normalized to the reference genes high mobility group 20a (HMG20a) and hydroxymethylbilane synthase (HMBS). Protein expression of cytokines (CXCL2, KC and IL-1β) in the distal colon of 10 mice/group was analyzed using the Luminex technology and values are expressed in pg/ml tissue homogenate. Protein expression of TRPV1 in the distal colon of 10 mice/group was analyzed by microscopy and values are expressed in pixels/μm2. (A) mRNA expression of Cxcl1/Kc increases in response to TNBS administration and after smoke exposure in both PBS- and TNBS-treated mice. (B) Protein expression of CXCL1/KC tends to increase in response to TNBS administration in CS-exposed mice and after smoke exposure in TNBS-treated mice. (C) mRNA expression of Cxcl2 increases in response to TNBS administration and after smoke exposure in both PBS- and TNBS-treated mice. (D) Protein expression of CXCL2 tends to increase in response to TNBS administration and after smoke exposure in both PBS- and TNBS-treated mice. Data were log-transformed. (E) mRNA expression of Il-1β increases in response to TNBS administration and tends to increase after smoke exposure only in TNBS-treated mice. (F) Protein expression of IL-1β increases in TNBS-challenged smoke-exposed mice and after smoke exposure in both PBS- and TNBS-treated mice. Data were log-transformed. (G) mRNA expression of Trpv1 increases in CS-exposed TNBS-challenged mice. (H) Protein expression of TRPV1 remained unchanged in TNBS-challenged smoke-exposed mice compared to smoke-exposed controls. Linear regression analysis was performed. Data are represented as median±error. *: p < 0.05; **: p < 0.01; ***: p < 0.001.

The TRPV1 channel is expressed by gut epithelial cells

To assess whether TRPV1 is specifically expressed by epithelial cells in the gut, as we observed in mouse ileum (Fig 2F–2I), we performed real-time qPCR on total mRNA isolated from whole intestinal tissue from three specific gut regions (ileum, proximal and distal colon) and the human gut epithelial cell lines HT-29, Caco-2 and T-84. We found detectable levels of TRPV1 transcripts in both human and mouse gut tissue (Figs 1, 2 and 4). In vitro, HT-29, Caco-2 and T-84 cells show the expression of Trpv1 mRNA (Fig 5A). Trpv1 mRNA expression was highest in T-84 cells, especially upon differentiation. We observed the expression of TRPV1 protein in HT-29 as well as undifferentiated and differentiated T-84 (Fig 5B–5D) (S5 File).

Fig 5. mRNA and protein expression of TRPV1 in gut epithelial cell lines.

Fig 5

mRNA values are relative to the expression of two reference genes (glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and hydroxymethylbilane synthase (HMBS)). TRPV1 protein was assessed via fluorescent staining. (A) mRNA expression level of TRPV1 in HT-29, Caco-2 and T-84. (B) Fluorescent image of HT-29 cells stained for TRPV1. (C) Fluorescent image of undifferentiated T-84 cells stained for TRPV1. (D) Fluorescent image of differentiated T-84 cells stained for TRPV1. Red: TRPV1. Blue: nuclei.

Discussion

In this study, we demonstrate that CS exposure affects cytokine/chemokine profiles, in line with epithelial TRPV1 expression, in the healthy and inflamed gut. We first showed that active smoking of human subjects induces IL-8 expression in the gut. In addition, a decrease in TRPV1 mRNA was found in never smoking patients suffering from Crohn’s ileitis and in the colon of healthy active smokers. Second, we found that CXCL2, a mouse IL-8 homologue, and epithelial TRPV1 are simultaneously induced in the ileum of mice chronically exposed to CS. Furthermore, using a TNBS-induced gut inflammation model, we showed that, although that CS did not affect disease phenotype at a macroscopic level, it did increase CXCL2, KC and IL-1β, and TRPV1 levels in the inflamed distal colon of mice. Therefore, we suggest that CS exposure affects cytokine/chemokine profiles in healthy and inflamed gut, and concurrent CS-augmented TRPV1 may point to a correlation between IL-8 and TRPV1 increase.

A first striking finding was the induction of IL-8 in the gut of human active smokers. IL-8, and its murine homologues CXCL2 and KC, are key inflammatory mediators in acute mucosal inflammation, being involved in chemoattraction of neutrophils to the site of inflammation [12, 37]. In our study, IL-8 was increased in human active smokers depending on the gut location. In the ileum, IL-8 was augmented in actively smoking controls, while in the colon, IL-8 was elevated in actively smoking CD patients. This shows that CS boosts IL-8 expression in the human gut, which might promote neutrophil recruitment. It has previously been reported that IL-8 is increased in gut mucosal biopsies of smokers [38], which we now confirmed on a dataset of 155 patients. A study by Mortaz et al. states that cigarette smoke extract elicits an induction of IL-8 in plasmacytoid dendritic cells, resulting in IL-8-induced neutrophil recruitment [39]. However, also the epithelium can be a source of IL-8 production [40]. Using a murine model of chronic CS exposure (24 weeks), we are the first to demonstrate that both the functional IL-8 homologues CXCL2 and KC were increased in the ileum and colon respectively of mice chronically exposed to CS. Similar increases in CXCL2 and KC were observed in the distal colon in the 4-week-model of CS exposure. Taken together, these data indicate that CS could promote the attraction of neutrophils towards the ileal and colonic mucosa via the production of chemoattractants.

Another important finding was that CS aggravates the TNBS-induced cytokine and chemokine profile in the distal colon two days after initiation of inflammation. The cytokines and chemokines KC, CXCL2 and IL-1β were already increased due to TNBS administration. When combined with CS exposure, mRNA and protein levels of KC, CXCL2 and IL-1β were further augmented in the distal colon of TNBS-challenged mice. This suggests that CS is an additive factor for cytokine/chemokine production and boosts neutrophil and macrophage activity, resulting in increased cytokine/chemokine production. IL-1β, produced by macrophages through activation of the inflammasome and thereby promoting inflammation, is also known to be raised in a TNBS-challenged colon [41, 42]. Also, it is known that neutrophils are involved in the potentiating effects of acute CS exposure on TNBS colitis in rats [43–45].

Despite the increases in cytokine/chemokine production by CS exposure, we could not show any further aggravation of histological inflammation or clinical signs such as weight loss. Hitherto, the effect of CS exposure or its components has been studied in several animal models for inflammatory bowel disease, among which TNBS-induced colitis, yielding ambiguous results [15]. Previous studies have shown a potentiating effect of CS on TNBS-induced colitis, at three days post-enema, demonstrating a promotion of neutrophil infiltration and free radical production, an upregulated expression of the α-7-nicotinic acetylcholine receptor, depletion of glutathione and overproduction of leukotriene B4 [12, 16, 18, 43]. However, in contrast to our smoke exposure model, these studies did not investigate the effect of four weeks prolonged CS exposure prior to the administration of TNBS.

In addition, we show that the TRP channel TRPV1 is expressed by the ileal and colonic epithelium, confirming the study by Kun et al. describing the presence of the channels TRPA1 and TRPV1 on colonic epithelial cells, macrophages and enteric ganglia [46]. We detected their expression in both ileum and colon of mice, human ileal and colonic biopsies and HT-29, Caco-2 and T-84 epithelial cells in vitro. To date, TRP channels are known as nociceptive receptors expressed by sensory neurons, for instance being involved in neurogenic inflammatory processes in the distal colon [27, 47].

Interestingly, TRPV1 expression appeared to be modulated in conditions of inflammation and CS exposure in the intestine of both humans and mice. In CD patients who have never smoked, we found a decrease in ileal and colonic TRPV1 mRNA compared to their controls, probably due to the destruction of epithelium in the inflamed intestinal regions. It has been shown previously that TRPV1 is naturally activated in response to damage and repair [48], however mRNA levels are not sufficient to support a functional role for TRPV1. In the colon, a decrease in TRPV1 mRNA was denoted in actively smoking human subjects compared to never smokers. These interesting human data prompted us to further analyze the effect of CS on Trpv1 expression using experimental mouse models. We showed that chronic smoke exposure of non-inflamed mice induced ileal Trpv1 expression. In the distal colon of TNBS-challenged mice, Trpv1 is solely increased by four weeks prior CS exposure, suggesting a synergistic effect of CS and TNBS in inducing Trpv1 expression.

Furthermore, a concurrent modulation of IL-8 and TRPV1 occurs in the ileum of active smokers. Although CS-induced expression of IL-8 and TRPV1 was not strictly co-regulated in the ileum and colon of human subjects, CS-induced TRPV1 expression paralleled cytokine/chemokine induction in the ileum of mouse. TRPV1 and CXCL2 were simultaneously induced in the ileum of mice chronically exposed to CS. Also, the CS-mediated aggravation of TNBS-induced CXCL2 in the distal colon of inflamed mice parallels CS-induced Trpv1 mRNA in the distal colon of TNBS-inflamed mice. The discordance between human and mouse data may be due to the nature of human and mouse studies: mouse experiments are performed in a controlled environment, while the human population, even within one study, is very heterogeneous. Also, protein data did not fully confirm the mRNA data, which might indicate that the power of the study is a limitation. In addition, mRNA presence does not always correlate to protein expression and may depend on the half-life of the particular proteins and mechanisms such as mRNA degradation and stability, post-transcriptional modification, RNA transport and processing.

Duration of CS exposure, presence of inflammation and gut location determine whether TRPV1 is simultaneously increased with cytokine/chemokine production. It might be that CS-induced increase of IL-8 and TRPV1 is linked. However, upregulation of TRPV1 could also be a consequence of inflammation, e.g. in TNBS-induced colitis, although CS on its own only boosts cytokine production without any histological damage. Future research is needed, exposing TRPV1-/- mice and wild-type mice treated with TRPV1 inhibitors and agonists to CS, to investigate the potential link between TRPV1 and inflammatory mediator production.

Next to local cytokine induction in the human gut, the effect of smoking on the immune system is also reflected in CRP levels in the serum. Moreover, in currently smoking colonic CD patients, higher CRP levels were found. In ileal CD patients, the increase was not significant, probably due to high inter-patient variation. A larger cohort would be needed. Furthermore, our data might show a smoking-dependent shift in the treatment strategy of CD patients with ileal involvement: never smokers mostly receive biological or combination therapy, while current smokers mostly receive immunosuppressives. However, a multi-center study with a larger cohort would be needed to present significant conclusions. The current data show that CS exposure seemingly acts as a trigger of the gut immune system, serving as a predisposing environmental factor for potential development of inflammation, which corresponds with our previous findings that chronic CS exposure in mice triggers the recruitment of immune cells to the ileal Peyer’s patches [14].

In conclusion, we demonstrated, using human gut samples as well as murine models, that CS modulates pro-inflammatory cytokines/chemokines and suggest a link between inflammation and TRPV1 expression in the gut. CS-augmented expression of cytokines/chemokines and TRPV1 often occurs simultaneously, suggesting a link between both. Future research is needed to investigate whether TRPV1 might be involved in CS-increased production of cytokines and chemokines.

Supporting information

S1 File. Regression analysis.

(PDF)

S2 File. Human study.

(XLSX)

S3 File. Mouse study–long-term smoking.

(XLSX)

S4 File. Mouse study–TNBS experiment.

(XLSX)

S5 File. Cell line experiments.

(XLSX)

S1 Fig. Weight loss in healthy CS-exposed mice.

(TIF)

Acknowledgments

We thank Ran Rumes and Lynn Supply for the support with the animal experiments and the processing of the samples, and Eliane Castrique, Katleen de Saedeleer, Anouk Goethals, Ann Neesen, Indra de Borle, Evelyn Spruyt, Greet Barbier and Lien Coulembier for the excellent technical support with the animal experiments. We are very grateful to Gabrielle Holtappels for the technical assistance with the Luminex assays. We thank Elien Glorieus, Pieter Hindryckx and Koen Gorleer for contributing to the collection of the human samples.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

RDS was supported by Concerted Research Action of Ghent University (BOF10/GOA/021, BOF12/GOA/008), TM and KB were supported by FWO Flanders and Interuniversitary Attraction Poles Programme/Belgian Federal Science Policy P7/30. LA was supported by a doctoral grant from the Special Research Fund of Ghent University (01D41012). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Khan WI, Collins SM. Gut motor function: immunological control in enteric infection and inflammation. Clin Exp Immunol. 2006;143(3):389–97. Epub 2006/02/21. CEI2979 [pii] 10.1111/j.1365-2249.2005.02979.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Jin Y, Lin Y, Lin L, Zheng C. IL-17/IFN-gamma Interactions Regulate Intestinal Inflammation in TNBS-Induced Acute Colitis. J Interferon Cytokine Res. 2012. Epub 2012/10/04. 10.1089/jir.2012.0030 . [DOI] [PubMed] [Google Scholar]
  • 3.Kaser A, Zeissig S, Blumberg RS. Inflammatory bowel disease. Annu Rev Immunol. 2010;28:573–621. Epub 2010/03/03. 10.1146/annurev-immunol-030409-101225 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Jiang W, Su J, Zhang X, Cheng X, Zhou J, Shi R, et al. Elevated levels of Th17 cells and Th17-related cytokines are associated with disease activity in patients with inflammatory bowel disease. Inflamm Res. 2014. Epub 2014/08/19. 10.1007/s00011-014-0768-7 . [DOI] [PubMed] [Google Scholar]
  • 5.Strober W, Fuss I, Mannon P. The fundamental basis of inflammatory bowel disease. J Clin Invest. 2007;117(3):514–21. Epub 2007/03/03. 10.1172/JCI30587 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Xavier RJ, Podolsky DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 2007;448(7152):427–34. Epub 2007/07/27. nature06005 [pii] 10.1038/nature06005 . [DOI] [PubMed] [Google Scholar]
  • 7.Cosnes J. Tobacco and IBD: relevance in the understanding of disease mechanisms and clinical practice. Best Pract Res Clin Gastroenterol. 2004;18(3):481–96. Epub 2004/05/26. 10.1016/j.bpg.2003.12.003 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 8.Persson PG, Ahlbom A, Hellers G. Inflammatory bowel disease and tobacco smoke—a case-control study. Gut. 1990;31(12):1377–81. Epub 1990/12/01. 10.1136/gut.31.12.1377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ananthakrishnan AN. Environmental risk factors for inflammatory bowel disease. Gastroenterol Hepatol (N Y). 2013;9(6):367–74. Epub 2013/08/13. [PMC free article] [PubMed] [Google Scholar]
  • 10.Karban A, Eliakim R. Effect of smoking on inflammatory bowel disease: Is it disease or organ specific? World J Gastroenterol. 2007;13(15):2150–2. Epub 2007/05/01. 10.3748/wjg.v13.i15.2150 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Allais L, Kerckhof FM, Verschuere S, Bracke KR, De Smet R, Laukens D, et al. Chronic cigarette smoke exposure induces microbial and inflammatory shifts and mucin changes in the murine gut. Environmental microbiology. 2015. 10.1111/1462-2920.12934 . [DOI] [PubMed] [Google Scholar]
  • 12.Berkowitz L, Schultz BM, Salazar GA, Pardo-Roa C, Sebastian VP, Alvarez-Lobos MM, et al. Impact of Cigarette Smoking on the Gastrointestinal Tract Inflammation: Opposing Effects in Crohn's Disease and Ulcerative Colitis. Frontiers in immunology. 2018;9:74 10.3389/fimmu.2018.00074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Verschuere S, Allais L, Bracke KR, Lippens S, De Smet R, Vandenabeele P, et al. Cigarette smoke and the terminal ileum: increased autophagy in murine follicle-associated epithelium and Peyer's patches. Histochem Cell Biol. 2012;137(3):293–301. 10.1007/s00418-011-0902-3 . [DOI] [PubMed] [Google Scholar]
  • 14.Verschuere S, Bracke KR, Demoor T, Plantinga M, Verbrugghe P, Ferdinande L, et al. Cigarette smoking alters epithelial apoptosis and immune composition in murine GALT. Lab Invest. 2011;91(7):1056–67. Epub 2011/05/04. 10.1038/labinvest.2011.74 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 15.Verschuere S, De Smet R, Allais L, Cuvelier CA. The effect of smoking on intestinal inflammation: what can be learned from animal models? Journal of Crohn's & colitis. 2012;6(1):1–12. 10.1016/j.crohns.2011.09.006 . [DOI] [PubMed] [Google Scholar]
  • 16.Guo X, Ko JK, Mei QB, Cho CH. Aggravating effect of cigarette smoke exposure on experimental colitis is associated with leukotriene B(4) and reactive oxygen metabolites. Digestion. 2001;63(3):180–7. Epub 2001/05/15. 51887 [pii] 51887. 10.1159/000051887 . [DOI] [PubMed] [Google Scholar]
  • 17.Galitovskiy V, Qian J, Chernyavsky AI, Marchenko S, Gindi V, Edwards RA, et al. Cytokine-induced alterations of alpha7 nicotinic receptor in colonic CD4 T cells mediate dichotomous response to nicotine in murine models of Th1/Th17- versus Th2-mediated colitis. J Immunol. 2011;187(5):2677–87. Epub 2011/07/26. 10.4049/jimmunol.1002711 [pii]. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sun YP, Wang HH, He Q, Cho CH. Effect of passive cigarette smoking on colonic alpha7-nicotinic acetylcholine receptors in TNBS-induced colitis in rats. Digestion. 2007;76(3–4):181–7. Epub 2008/01/05. 10.1159/000112643 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 19.Eliakim R, Karmeli F, Rachmilewitz D, Cohen P, Fich A. Effect of chronic nicotine administration on trinitrobenzene sulphonic acid-induced colitis. Eur J Gastroenterol Hepatol. 1998;10(12):1013–9. Epub 1999/01/23. . [PubMed] [Google Scholar]
  • 20.Sykes AP, Brampton C, Klee S, Chander CL, Whelan C, Parsons ME. An investigation into the effect and mechanisms of action of nicotine in inflammatory bowel disease. Inflamm Res. 2000;49(7):311–9. Epub 2000/08/26. 10.1007/s000110050597 . [DOI] [PubMed] [Google Scholar]
  • 21.Wirtz S, Neufert C, Weigmann B, Neurath MF. Chemically induced mouse models of intestinal inflammation. Nat Protoc. 2007;2(3):541–6. Epub 2007/04/05. nprot.2007.41 [pii] 10.1038/nprot.2007.41 . [DOI] [PubMed] [Google Scholar]
  • 22.Akbar A, Yiangou Y, Facer P, Brydon WG, Walters JR, Anand P, et al. Expression of the TRPV1 receptor differs in quiescent inflammatory bowel disease with or without abdominal pain. Gut. 2010;59(6):767–74. Epub 2010/06/17. 10.1136/gut.2009.194449 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 23.Herbert MK, Holzer P. [Neurogenic inflammation. II. pathophysiology and clinical implications]. Anasthesiol Intensivmed Notfallmed Schmerzther. 2002;37(7):386–94. Epub 2002/07/09. 10.1055/s-2002-32701 . [DOI] [PubMed] [Google Scholar]
  • 24.Peters EM, Ericson ME, Hosoi J, Seiffert K, Hordinsky MK, Ansel JC, et al. Neuropeptide control mechanisms in cutaneous biology: physiological and clinical significance. J Invest Dermatol. 2006;126(9):1937–47. Epub 2006/08/17. 5700429 [pii] 10.1038/sj.jid.5700429 . [DOI] [PubMed] [Google Scholar]
  • 25.D'Aldebert E, Cenac N, Rousset P, Martin L, Rolland C, Chapman K, et al. Transient receptor potential vanilloid 4 activated inflammatory signals by intestinal epithelial cells and colitis in mice. Gastroenterology. 2011;140(1):275–85. Epub 2010/10/05. 10.1053/j.gastro.2010.09.045 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 26.Fichna J, Mokrowiecka A, Cygankiewicz AI, Zakrzewski PK, Malecka-Panas E, Janecka A, et al. Transient receptor potential vanilloid 4 blockade protects against experimental colitis in mice: a new strategy for inflammatory bowel diseases treatment? Neurogastroenterol Motil. 2012;24(11):e557–60. Epub 2012/08/14. 10.1111/j.1365-2982.2012.01999.x . [DOI] [PubMed] [Google Scholar]
  • 27.Allais L, De Smet R, Verschuere S, Talavera K, Cuvelier CA, Maes T. Transient Receptor Potential Channels in Intestinal Inflammation: What Is the Impact of Cigarette Smoking? Pathobiology: journal of immunopathology, molecular and cellular biology. 2016;84(1):1–15. 10.1159/000446568 . [DOI] [PubMed] [Google Scholar]
  • 28.Lennard-Jones JE. Classification of inflammatory bowel disease. Scand J Gastroenterol Suppl. 1989;170:2–6; discussion 16–9. Epub 1989/01/01. 10.3109/00365528909091339 . [DOI] [PubMed] [Google Scholar]
  • 29.D'Hulst A I, Vermaelen KY, Brusselle GG, Joos GF, Pauwels RA. Time course of cigarette smoke-induced pulmonary inflammation in mice. Eur Respir J. 2005;26(2):204–13. Epub 2005/08/02. 26/2/204 [pii] 10.1183/09031936.05.00095204 . [DOI] [PubMed] [Google Scholar]
  • 30.Macdonald G, Kondor N, Yousefi V, Green A, Wong F, Aquino-Parsons C. Reduction of carboxyhaemoglobin levels in the venous blood of cigarette smokers following the administration of carbogen. Radiother Oncol. 2004;73(3):367–71. Epub 2004/12/14. S0167-8140(04)00392-5 [pii] 10.1016/j.radonc.2004.09.002 . [DOI] [PubMed] [Google Scholar]
  • 31.Fogh J, Fogh JM, Orfeo T. One hundred and twenty-seven cultured human tumor cell lines producing tumors in nude mice. Journal of the National Cancer Institute. 1977;59(1):221–6. 10.1093/jnci/59.1.221 . [DOI] [PubMed] [Google Scholar]
  • 32.Murakami H, Masui H. Hormonal control of human colon carcinoma cell growth in serum-free medium. Proceedings of the National Academy of Sciences of the United States of America. 1980;77(6):3464–8. 10.1073/pnas.77.6.3464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Devriese S, Van den Bossche L, Van Welden S, Holvoet T, Pinheiro I, Hindryckx P, et al. T84 monolayers are superior to Caco-2 as a model system of colonocytes. Histochem Cell Biol. 2017;148(1):85–93. 10.1007/s00418-017-1539-7 . [DOI] [PubMed] [Google Scholar]
  • 34.Van der Sluis M, De Koning BA, De Bruijn AC, Velcich A, Meijerink JP, Van Goudoever JB, et al. Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology. 2006;131(1):117–29. Epub 2006/07/13. S0016-5085(06)00762-1 [pii] 10.1053/j.gastro.2006.04.020 . [DOI] [PubMed] [Google Scholar]
  • 35.Bracke KR, D'Hulst A I, Maes T, Moerloose KB, Demedts IK, Lebecque S, et al. Cigarette smoke-induced pulmonary inflammation and emphysema are attenuated in CCR6-deficient mice. J Immunol. 2006;177(7):4350–9. Epub 2006/09/20. 177/7/4350 [pii]. 10.4049/jimmunol.177.7.4350 . [DOI] [PubMed] [Google Scholar]
  • 36.Holzer P. Transient receptor potential (TRP) channels as drug targets for diseases of the digestive system. Pharmacol Ther. 2011;131(1):142–70. Epub 2011/03/23. 10.1016/j.pharmthera.2011.03.006 S0163-7258(11)00060-X [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Grimm MC, Elsbury SK, Pavli P, Doe WF. Interleukin 8: cells of origin in inflammatory bowel disease. Gut. 1996;38(1):90–8. Epub 1996/01/01. 10.1136/gut.38.1.90 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Sher ME, Bank S, Greenberg R, Sardinha TC, Weissman S, Bailey B, et al. The influence of cigarette smoking on cytokine levels in patients with inflammatory bowel disease. Inflammatory bowel diseases. 1999;5(2):73–8. 10.1097/00054725-199905000-00001 . [DOI] [PubMed] [Google Scholar]
  • 39.Mortaz E, Lazar Z, Koenderman L, Kraneveld AD, Nijkamp FP, Folkerts G. Cigarette smoke attenuates the production of cytokines by human plasmacytoid dendritic cells and enhances the release of IL-8 in response to TLR-9 stimulation. Respir Res. 2009;10:47 Epub 2009/06/12. 10.1186/1465-9921-10-47 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Gibson P, Rosella O. Interleukin 8 secretion by colonic crypt cells in vitro: response to injury suppressed by butyrate and enhanced in inflammatory bowel disease. Gut. 1995;37(4):536–43. Epub 1995/10/01. 10.1136/gut.37.4.536 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Dutra RC, Claudino RF, Bento AF, Marcon R, Schmidt EC, Bouzon ZL, et al. Preventive and therapeutic euphol treatment attenuates experimental colitis in mice. PLoS One. 2011;6(11):e27122 10.1371/journal.pone.0027122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bauer C, Duewell P, Mayer C, Lehr HA, Fitzgerald KA, Dauer M, et al. Colitis induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut. 2010;59(9):1192–9. 10.1136/gut.2009.197822 . [DOI] [PubMed] [Google Scholar]
  • 43.Guo X, Wang WP, Ko JK, Cho CH. Involvement of neutrophils and free radicals in the potentiating effects of passive cigarette smoking on inflammatory bowel disease in rats. Gastroenterology. 1999;117(4):884–92. 10.1016/s0016-5085(99)70347-1 . [DOI] [PubMed] [Google Scholar]
  • 44.van Lierop PP, de Haar C, Lindenbergh-Kortleve DJ, Simons-Oosterhuis Y, van Rijt LS, Lambrecht BN, et al. T-cell regulation of neutrophil infiltrate at the early stages of a murine colitis model. Inflamm Bowel Dis. 2010;16(3):442–51. 10.1002/ibd.21073 . [DOI] [PubMed] [Google Scholar]
  • 45.Oral H, Kanzler I, Tuchscheerer N, Curaj A, Simsekyilmaz S, Sonmez TT, et al. CXC chemokine KC fails to induce neutrophil infiltration and neoangiogenesis in a mouse model of myocardial infarction. J Mol Cell Cardiol. 2013;60:1–7. Epub 2013/04/20. 10.1016/j.yjmcc.2013.04.006S0022-2828(13)00137-5 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 46.Kun J, Szitter I, Kemeny A, Perkecz A, Kereskai L, Pohoczky K, et al. Upregulation of the transient receptor potential ankyrin 1 ion channel in the inflamed human and mouse colon and its protective roles. PloS one. 2014;9(9):e108164 10.1371/journal.pone.0108164 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Engel MA, Becker C, Reeh PW, Neurath MF. Role of sensory neurons in colitis: increasing evidence for a neuroimmune link in the gut. Inflamm Bowel Dis. 2011;17(4):1030–3. Epub 2010/08/20. 10.1002/ibd.21422 . [DOI] [PubMed] [Google Scholar]
  • 48.de Jong PR, Takahashi N, Harris AR, Lee J, Bertin S, Jeffries J, et al. Ion channel TRPV1-dependent activation of PTP1B suppresses EGFR-associated intestinal tumorigenesis. The Journal of clinical investigation. 2014;124(9):3793–806. 10.1172/JCI72340 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Mathilde Body-Malapel

28 May 2020

PONE-D-20-04633

Translational research into the effects of cigarette smoke on inflammatory mediators and epithelial TRPV1 in Crohn’s disease

PLOS ONE

Dear Dr. Allais,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jul 12 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Mathilde Body-Malapel

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements:

1.    Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this work, Allais et. al analyzed the expression of TRPV1 and cytokines/chemokines in intestinal mucosa after exposure to cigarette smoke, in subjects (patients and mice) with or without IBD. The intention to integrate results obtained in humans and IBD mice model is highlighted. However, the manuscript is unclear and various details are missing to validate the results and to integrate both models. Indeed, more analyzes are needed to validate the conclusions.

Major comments:

Increased TRPV1 does not necessarily imply increased cytokine expression. TRPV1 is naturally activated in response to damage and repair (PMID: 25083990), so it may be just parallel processes. An experiment in vivo with TRPV1 inhibitor is required (or at least in vitro or ex vivo - e.g. explants with CSC) to delve into this association.

How would the effects of CS on TRPV1 expression be explained? Agonists such as leukotriene B4 need to be evaluated. There is evidence that nicotine reduces LTB4, and therefore shows beneficial effects in similar models (PMID: 26881175). Authors should discuss these differences.

TNBS-induced Colitis model does not recapitulate Crohn’s disease in terms of aetiopathogenesis. Indeed, it represents a model for acute Th1 colonic inflammation, but cigarette smoking is mostly associated with ileal inflammation. As shown in figure 1, CS was only associated with IL-8 in ileal biopsies. Considering that, authors should have used a murine model of ileal or ileo-colonic CD. Even though authors demonstrated a colonic effect of CS in TNBS-mice, this must be discussed (see PMID: 29441064).

The manuscript is unclear:

1) In most parts of the results description (Abstract and Results) it is not clear which groups were compared. E.g. L52-53 “In the ileum, TRPV1 mRNA levels were decreased in never smoking CD patients” in comparison with?. Authors should compare patients over healthy subjects, or treated over controls. It is confusing to say that not smoking reduces TRPV1 mRNA. E.g. L 289-291: “In CD, IL-8 levels are similar in ileal biopsies (Fig 1A)” (among active and never smokers?). In the ileum, TRPV1 mRNA is elevated in never-smoking healthy controls compared to never-smoking CD patients (Fig. 1C). Remember, treated group over control; or in this case: patients over healthy subjects.

2) Statistical analyzes are not well described. In the methodology authors mentioned linear models and multicomp package, but in the figures means + SEM are indicated (those boxplots must show Median + error). Authors should specify control variables (gender, age), not only in methodology, but also in figure legends (none specify the method). On the other hand, the variables and the statistical methods used to analyze the results of mice are not specified. It is suggested to use Pfaffl quantification to correct gene expression by qPCR efficiency.

3) The authors should try to better integrate the description and the results of both models (human and mice). Since the most conclusive results occurred in mice, it would be preferable to start by describing them: CS increases chemokines and TRPV1 in mice. Then, describe whether this effect alters the development of colitis: inflammation and TRPV1 expression (authors should confirm the TRPV1-inflammation relationship as mentioned above). And then continue to assess whether this association is also observed in patients. This would allow to discuss the difference between the effect of CS in ileum and colon (see PMID: 29441064) and in mice vs human: authors must discuss differences between whole body CS exposure vs cigarette smoking (e.g. absence of direct swallowing of particulate matter in murine model).

Minor comments

1. Biopsies histological damage is not indicated in results. This should be a cofactor for the analyzes to give an idea of the importance of tissue damage on the results.

2. Fig 1G: All biopsies should have the same orientation. Number 4 is almost longitudinal, so naturally the mucus will retain more secondary antibody. In addition, the description in the text must be corrected.

3. GAPDH is mentioned in results as reference gene, but not in Methods. Please clarify. On the other hand, where are the results of the other cytokines mentioned in methods?

4. In Fig 2B, CS-treatment reduced Kc mRNA in ileum, more than the increase in colon, however it was not significant. Please clarify statistical analysis.

5. IHC photos with anti-TRPV1 are not convincing. Fig 2G binding is present in the mucus suggesting some not specific binding. The control (Fig 2F) es not completely useful, because it seems to represent another portion of small intestine than 2G. The authors should include also a colonic photo of the air-control. Scale bars should be added. Analyzes should be done from at least three different sections per mouse.

6. Were clinical signs of colitis evaluated? Tenesmus, blood or mucus in stools, etc..

7. Authors should include the weight curves of mice during CS-treatment in supplementary material. CS-treatment is quite stressful, and together with the anorectic effects of tobacco, the resultant reduced ingestion could affect the basal state of the intestine. In fact, weight could be included as a covariate in case of using a linear model.

8. The results observed in cell lines are a good control but do not contribute to the conclusion. They should be included in supplementary material.

Reviewer #2: In this study, Allais et al. investigated the effect of CS exposure in CD patients and mouse model. They showed the CS induced the chemokines for neutrophil and TRPV1 in gut from CD patients and TNBS-colitis model. However, the implication and function of TRPV1 upregulation by CS exposure is not well presented. In addition, several concerns were raised.

Major comments;

Authors showed chemokines for neutrophil migration were upregulated by CS in patients and CD mice model. As pointed out by reviewer 1, assessment of neutrophils infiltration and activity were important for understanding the effect of CS. Therefore, authors should evaluate the neutrophil number in ileum and colon tissues from CD patients and TNBS-induced colitis model.

In figure 2C and 2D, TRPV1 protein level, measured by microscopic data in ileum from control mice was far apart form mRNA level. It seems measurement by pixels in microscopy was not enough to evaluate the expression level. Therefore, authors should confirm the increase of TRPV1 protein in ileum and colon in mice (Fig 2, 4)as well as patient (Fig 1) by ELISA or western blotting.

In figure 5, authors measured the TRPV1 expression in gut epithelial cell lines. Dose stimulation with CS extract induce the TRPV1 expression in these cell line?

Minor comments;

P9, line 165, the detail information of mice exposed whole body to mainstream CS is necessary.

How about gene expressions of other TRPVs, TRPV 2-6? It should be mentioned.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Loni Berkowitz

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 6;15(8):e0236657. doi: 10.1371/journal.pone.0236657.r003

Author response to Decision Letter 0


7 Jul 2020

Dear Dr. Body-Malapel,

We are grateful for the opportunity to submit a revised version of our research article entitled “Translational research into the effects of cigarette smoke on inflammatory mediators and epithelial TRPV1 in Crohn’s disease”. We thank the reviewers for their valuable time and useful contribution in the peer review of our work and hereby provide you with a detailed response to the comments raised.

The current manuscript has been approved by all authors and all prevailing local, national and international regulations and conventions, and normal scientific ethical practices have been respected. No author has an ethical or financial conflict of interest. We affirm that this manuscript is original and has not been published previously nor that it is under consideration for publication in another journal. None of the manuscript’s contents has been previously published except in abstract form. We give consent for publication in PloS One, if the manuscript is accepted.

Sincerely yours,

Dr. Liesbeth Allais, on behalf of the authors.

Journal requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

We have adjusted the manuscript to PLOS ONE's style requirements.

2. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.

The data referred to as ‘data not shown’ do not contribute to the overall conclusions of this objective, therefore, we have removed the phrase that refers to these data.

3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly.

We have included captions and in-text citations for the supporting information files at the end of the manuscript.

Reviewers' comments:

Reviewer 1:

In this work, Allais et. al analyzed the expression of TRPV1 and cytokines/chemokines in intestinal mucosa after exposure to cigarette smoke, in subjects (patients and mice) with or without IBD. The intention to integrate results obtained in humans and IBD mice model is highlighted. However, the manuscript is unclear and various details are missing to validate the results and to integrate both models. Indeed, more analyses are needed to validate the conclusions.

Major Comments:

1. Increased TRPV1 does not necessarily imply increased cytokine expression. TRPV1 is naturally activated in response to damage and repair (PMID: 25083990), so it may be just parallel processes. An experiment in vivo with TRPV1 inhibitor is required (or at least in vitro or ex vivo - e.g. explants with CSC) to delve into this association.

We agree with the reviewer’s comment that increased TRPV1 does not necessarily imply an increased cytokine expression. The use of TRPV1 inhibitors in vivo or TRPV1 knock-out mice to substantiate this link is required, but is not the scope of this study. We have clarified this in the Discussion section.

Line 465 – 468 now reads as: “It has been shown previously that TRPV1 is naturally activated in response to damage and repair, however mRNA levels are not sufficient to support a functional role for TRPV1 and requires further study”.

2. How would the effects of CS on TRPV1 expression be explained? Agonists such as leukotriene B4 need to be evaluated. There is evidence that nicotine reduces LTB4, and therefore shows beneficial effects in similar models (PMID: 26881175). Authors should discuss these differences.

To explain a potential link between CS exposure and TRPV1 expression, further experiments using both TRPV1 inhibitors and agonists, as well as TRPV1 knock-out mice would be needed. We clarify this in the Discussion section. Also, it would be interesting to study the effect of full cigarette smoke exposure instead of solely nicotine on LTB4 expression. In case of the current human dataset, available material was limited. LTB4 will be considered for future studies.

3. TNBS-induced colitis model does not recapitulate Crohn’s disease in terms of aetiopathogenesis. Indeed, it represents a model for acute Th1 colonic inflammation, but cigarette smoking is mostly associated with ileal inflammation. As shown in figure 1, CS was only associated with IL-8 in ileal biopsies. Considering that, authors should have used a murine model of ileal or ileo-colonic CD. Even though authors demonstrated a colonic effect of CS in TNBS-mice, this must be discussed (see PMID: 29441064).

It is indeed correct that cigarette smoking is mostly associated with ileal inflammation. We have investigated the effect of cigarette smoke exposure in both ileal and colonic inflammation models. We previously elaborated on the effects of cigarette smoke in the ileum: Verschuere et al., 2012 (PMID: 22198215), Allais et al., 2016 (PMID: 26033517), Allais et al., 2017 (PMID: 27388890), which were indeed cited in the review PMID: 29441064. We also published our findings using the Crohn-like ileitis TNFΔARE mouse model: Allais et al., 2015 (PMID: 26523550). In the current paper under review, we chose to highlight the effect of cigarette smoke exposure on Crohn’s colitis. Therefore, we chose the Crohn-like colitis mouse model based on TNBS instead of e.g. the UC-like colitis mouse model based on DSS. Moreover, a true ileo-colonic CD-like mouse model is not well-described to date. Perhaps a combined T cell transfer model would be useful.

4. The manuscript is unclear:

1) In most parts of the results description (Abstract and Results) it is not clear which groups were compared. E.g. L52-53 “In the ileum, TRPV1 mRNA levels were decreased in never smoking CD patients” in comparison with?. Authors should compare patients over healthy subjects, or treated over controls. It is confusing to say that not smoking reduces TRPV1 mRNA. E.g. L 289-291: “In CD, IL-8 levels are similar in ileal biopsies (Fig 1A)” (among active and never smokers?). In the ileum, TRPV1 mRNA is elevated in never-smoking healthy controls compared to never-smoking CD patients (Fig. 1C). Remember, treated group over control; or in this case: patients over healthy subjects.

We confirm that each statement in the Results section is based on comparisons between treated and control groups or between patients and healthy subjects. We have clarified this in the text.

Line 33-35: “In the ileum, TRPV1 mRNA levels were decreased in never smoking Crohn’s disease patients compared to healthy subjects (p <0,001; n = 20/group).” and line 273-274: “In CD, IL-8 levels are similar in ileal biopsies of never and active smokers (Fig 1A).”

2) Statistical analyses are not well described. In the methodology authors mentioned linear models and multicomp package, but in the figures means + SEM are indicated (those boxplots must show Median + error). Authors should specify control variables (gender, age), not only in methodology, but also in figure legends (none specify the method). On the other hand, the variables and the statistical methods used to analyze the results of mice are not specified. It is suggested to use Pfaffl quantification to correct gene expression by qPCR efficiency.

Indeed, in the figures showing boxplots, Fig 1 and 4, the legend should mention that the ‘Median±error’ is indicated instead of ‘Means±SEM’. Figure 1 and 4 have been adapted accordingly. Also, the control variables (gender, age) in het human dataset were added in the legend of Figure 1. Variables and statistical methods were specified in the Methods section ‘Statistical Analysis’ and in the legends of figures depicting mouse data (Fig 2, 3, 4). Line 251-256: “Gene expression levels depicted in bar graphs were expressed as mean ± standard error of the mean and error bars depict the standard error of the mean. Statistical analysis was performed using ANOVA following post-hoc Tukey tests or Student’s t-test. Gene expression levels depicted in boxplots were expressed as median ± error. Statistical analysis was performed using a general linear model with smoking, IBD status and their interaction as independent variables, and either protein or gene expression level as dependent variable using R version 3.60.”

We agree that the Pfaffl quantification to correct gene expression by qPCR efficiency is recommended for analysis. We have performed relative quantification using two stably expressed reference genes. Six reference genes were evaluated previously and those that were most stable in all treatment groups were selected. The relative expression values were calculated using a static efficiency of 2. Each primer set is evaluated for qPCR efficiency (95% - 110%) using a standard curve of reference genomic DNA.

3) The authors should try to better integrate the description and the results of both models (human and mice). Since the most conclusive results occurred in mice, it would be preferable to start by describing them: CS increases chemokines and TRPV1 in mice. Then, describe whether this effect alters the development of colitis: inflammation and TRPV1 expression (authors should confirm the TRPV1-inflammation relationship as mentioned above). And then continue to assess whether this association is also observed in patients. This would allow to discuss the difference between the effect of CS in ileum and colon (see PMID: 29441064) and in mice vs human: authors must discuss differences between whole body CS exposure vs cigarette smoking (e.g. absence of direct swallowing of particulate matter in murine model).

By describing the human data first, we aimed to clarify from which view point we started this study. Starting with the human data, we shift to the findings in healthy long-term smoking mice over to a Crohn-like colitis model, to end with beginning findings in human cell lines. Indeed, further experiments elaborating on TRPV1 and inflammation are required to ascribe any functional relevance. Also, the patient studies should be expanded to multi-center studies using a larger patient cohort. We are aware of the limitations of the current study, which we address in the Discussion section, line 479-486: “The discordance between human and mouse data may be due to the nature of human and mouse studies: mouse experiments are performed in a controlled environment, while the human population, even within one study, is very heterogeneous. Also, protein data did not fully confirm the mRNA data, which might indicate that the power of the study is a limitation. In addition, mRNA presence does not always correlate to protein expression and may depend on the half-life of the particular proteins and mechanisms such as mRNA degradation and stability, post-transcriptional modification, RNA transport and processing.”

We have previously discussed the potential link between smoking, inflammation and TPRV1 (Allais et al., 2017, PMID: 27388890). The mentioned study (PMID: 29441064) indeed cites our work: Verschuere et al., 2012 (PMID: 22198215), Allais et al., 2016 (PMID: 26033517), Allais et al., 2017 (PMID: 27388890).

It is indeed correct that mice do not directly swallow the particulate matter of cigarette smoke. To align smoking regiments with human habits, the cigarette smoking model was optimized to have a similar level of carboxyhaemoglobin in the serum of cigarette smoke-exposed mice as compared to smoking humans. This is mentioned in the Methods section ‘Cigarette smoke exposure’, line 152-155: “Carboxyhaemoglobin in serum of CS-exposed mice reached a non-toxic level of 8.7 ± 0,31% (compared with 0.65 ±0,25% in air-exposed mice), which is similar to carboxyhaemoglobin blood concentrations of human smokers.”

Minor comments

1. Biopsies histological damage is not indicated in results. This should be a cofactor for the analyses to give an idea of the importance of tissue damage on the results.

We observed typical histological lesions in the intestinal biopsies of CD patients, however, these lesions were not worsened due to smoking. In the healthy controls, no lesions were observed. We have previously shown that cigarette smoke does not cause macroscopical or microscopical damage to the gut (Verschuere et al., 2011 and Allais et al., 2015). Cigarette smoking as such does not cause any tissue damage. As we know this from previous studies, we did not mention this in the Results sections on the human data and the six-months smoking experiment with healthy mice. However, we did mention histological damage in the Results section ‘Prior cigarette smoke exposure does not affect the development of TNBS-induced colitis in mice’ (Figure 3). Line 336-344: “We evaluated the development of TNBS-induced colitis in C57BL/6 mice that were previously exposed to CS or air during 4 weeks (Fig 3A). Two days after TNBS challenge, mice developed colitis as assessed by a significant body weight loss of 20% (Fig 3B) and colon length shortening (Fig 3C) compared to sham treatment. No significant differences in weight loss were observed in TNBS-treated mice that were either air- or CS-exposed (Fig 3B). At two days post-TNBS-enema, histological inflammation and epithelial destruction was apparent in the TNBS-treated, but not in the sham-treated group, which was not significantly affected by CS exposure (Fig 3D-F). Also, no changes in colon length due to CS exposure were observed (Fig 3C) (S4 Supporting Information).”

2. Fig 1G: All biopsies should have the same orientation. Number 4 is almost longitudinal, so naturally the mucus will retain more secondary antibody. In addition, the description in the text must be corrected.

Since biopsy material from human subjects is limited and difficult to position, the orientation of the biopsies may differ. However, in case of the mouse experiments, the mice were sacrificed and the complete gut was preserved. Therefore, we were able to make tissue sections in exactly the same orientation. This should however not interfere with scoring of the sections.

3. GAPDH is mentioned in results as reference gene, but not in Methods. Please clarify. On the other hand, where are the results of the other cytokines mentioned in methods?

We agree with the reviewer’s comment. The primer sequences for the human reference genes GAPDH and HMBS are now added to Table 4. We mentioned the primers of all genes studied, however, for the cytokines TNF-α, CCR6, CCL19, CCL20 and TRP channel TRPA1, we couldn’t observe any differences in mRNA expression.

Figure. mRNA expression of TNF-α in ileum, proximal and distal colon of wild-type C57/Bl6 mice after 24 weeks of CS exposure. No significant differences in expression were detected. IL: ileum. PC: proximal colon. DC: distal colon. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 24 weeks.

Figure. mRNA expression of TNF-α in the colon of TNBS-challenged wild-type C57/Bl6 mice after 4 weeks of CS exposure. No significant differences in expression were detected. PBS: phosphate buffered saline. TNBS: trinitrobenzene sulphonic acid. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 4 weeks.

As we found in our previously published studies (Verschuere et al., 2011; PMID: 21537330) that cigarette smoke exposure modulates the CCL20-CCR6 pathway, we thought it would be interesting to test whether cigarette smoke exposure would modulate expression of CCR6, CCL19 and CCL20 in the TNBS colitis model. However, no significant differences could be detected.

Figure. mRNA expression of CCR6 in the colon of TNBS-challenged wild-type C57/Bl6 mice after 4 weeks of CS exposure. No significant differences in expression were detected. PBS: phosphate buffered saline. TNBS: trinitrobenzene sulphonic acid. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 4 weeks.

Figure. mRNA expression of CCL19 in the colon of TNBS-challenged wild-type C57/Bl6 mice after 4 weeks of CS exposure. No significant differences in expression were detected. PBS: phosphate buffered saline. TNBS: trinitrobenzene sulphonic acid. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 4 weeks.

Figure. mRNA expression of CCL20 in the colon of TNBS-challenged wild-type C57/Bl6 mice after 4 weeks of CS exposure. No significant differences in expression were detected. PBS: phosphate buffered saline. TNBS: trinitrobenzene sulphonic acid. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 4 weeks.

In literature, more studies discuss TRPA1 rather than TPRV1 in the gut. Therefore, we initially investigated TRPA1, but no significant differences were detected.

Figure. mRNA expression of TRPA1 in ileum, proximal and distal colon of wild-type C57/Bl6 mice after 24 weeks of CS exposure. No significant differences in expression were detected. IL: ileum. PC: proximal colon. DC: distal colon. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 24 weeks.

As these negative data do not contribute to the paper, these results were not discussed in the results and discussion. We have omitted these primer sequences from Table 4.

4. In Fig 2B, CS-treatment reduced Kc mRNA in ileum, more than the increase in colon, however it was not significant. Please clarify statistical analysis.

Indeed, figure 2B shows a reduction in Kc mRNA due to CS treatment. However, variation within the groups (ileum of air-exposed mice compared to ileum of CS-exposed mice) was too large so we could only detect a trend with a p-value > 0,05 (7,111±0,7166 in air-exposed ileum compared to 4,126±0,9066 in CS-exposed ileum; p = 0,07). For Kc mRNA in colonic tissue, we observed much less variation between treatment groups. For statistical analysis, ANOVA (F-test) was performed as a multiple group comparison test, in order to find significant differences between two or more population means. This was followed by post-hoc Tukey for pair-wise multiple comparison testing.

5. IHC photos with anti-TRPV1 are not convincing. Fig 2G binding is present in the mucus suggesting some not specific binding. The control (Fig 2F) is not completely useful, because it seems to represent another portion of small intestine than 2G. The authors should include also a colonic photo of the air-control. Scale bars should be added. Analyses should be done from at least three different sections per mouse.

We agree that it looks like the TPRV1-specific antibody is binding to the mucus. However, we know that TRPV1 is present on the epithelial cell membrane, so it can be expected in that location. Moreover, the statistical difference between air- and CS-exposed mice is large enough that it cannot be attributed to non-specific binding, taking into account that the air-exposed mice also produce mucus. We included an image of the air-exposed mouse colon in Figure 2. Figure 2E, F, G and I show scale bars at the bottom of the picture. We examined 10 mice per treatment group and 1 section of ileum and colon for each mouse. Indeed, additional experiments need to be performed investigating TRPV1 protein expression.

6. Were clinical signs of colitis evaluated? Tenesmus, blood or mucus in stools, etc..

We only monitored body weight during the experiment, since this is most reflective of disease activity in this model. Histological damage and colon length were assessed as an end-point.

7. Authors should include the weight curves of mice during CS-treatment in supplementary material. CS-treatment is quite stressful, and together with the anorectic effects of tobacco, the resultant reduced ingestion could affect the basal state of the intestine. In fact, weight could be included as a covariate in case of using a linear model.

We have indeed monitored weight during CS exposure. We weighed at different time points. After two weeks, we already observed significant weight loss in CS-exposed mice, compared to air-exposed mice. We have included the weight follow-up in supplementary data: S3 Supporting information + S6 Figure. In addition, the weight follow-up during the TNBS exposure in Figure 3B is depicted as percentages.

8. The results observed in cell lines are a good control but do not contribute to the conclusion. They should be included in supplementary material.

We are aware that the cell line data do not support the final conclusion. However, as few studies have described the presence of TPRV1 on the cell membrane of gut epithelial cell lines, we absolutely wanted to share this interesting finding.

Reviewer 2:

In this study, Allais et al. investigated the effect of CS exposure in CD patients and mouse model. They showed that CS induced the chemokines for neutrophil and TRPV1 in gut from CD patients and TNBS-colitis model. However, the implication and function of TRPV1 upregulation by CS exposure is not well presented. In addition, several concerns were raised.

Major Comments:

1. Authors showed chemokines for neutrophil migration were upregulated by CS in patients and CD mice model. As pointed out by reviewer 1, assessment of neutrophil infiltration and activity is important for understanding the effect of CS. Therefore, authors should evaluate the neutrophil number in ileum and colon tissues from CD patients and TNBS-induced colitis model.

We agree that it would be interesting and important for understanding the effect of CS to evaluate the presence of neutrophils and their activation, e.g. by measurement of MPO, and we will take this into account for future experiments. We previously elaborated on the effects of cigarette smoke on immune cell populations in the Peyer’s patches in the ileum: Verschuere et al., 2012 (PMID: 221537330). It was shown that total dendritic cell count, CD4+ and CD8+ T cells and the CD11b+ dendritic cell subset was increased in response to 24 weeks of cigarette smoke exposure in wild-type mice. No difference in neutrophil count was observed.

2. In figure 2C and 2D, TRPV1 protein level measured by microscopic data in ileum from control mice was far apart from mRNA level. It seems measurement by pixels in microscopy was not enough to evaluate the expression level. Therefore, authors should confirm the increase of TRPV1 protein in ileum and colon in mice (Fig 2, 4)as well as patients (Fig 1) by ELISA or western blotting.

We agree that ELISA or western blotting is necessary to confirm measurement by pixels in microscopy. In this study, we chose for immunohistochemistry to obtain particular information on the location of the TRPV1 protein. Many studies describe TRPV1 in the neuronal system, however, few studies have elaborated on its epithelial expression. In addition, biopsy material in the human study was limited.

3. In figure 5, authors measured the TRPV1 expression in gut epithelial cell lines. Does stimulation with CS extract induce the TRPV1 expression in these cell line?

Indeed, it would be interesting to investigate TRPV1 expression in response to stimulation with CS extract. We have started human cell line experiments (Caco2, T84, HT29) and intestinal mouse organoid culture experiments with CS extract and important CS components (nicotine, acrolein, 4-hydroxy-2-nonenal, H2O2) in different concentrations. We selected components already described in literature and practically feasible to test in cell culture experiments. We also tested the combination with the TPRV1 agonist capsaicin and the TRPV1 antagonist capsazepin. To date, we found an induction of TPRV1 mRNA by acrolein.

Figure. mRNA expression of TRPV1 in the human epithelial cell line HT29. Cigarette smoke extract and cigarette smoke components were tested in combination with the TRPV1 antagonist CPZ. Ethanol was included as a control (CPZ is dissolved in ethanol). CSE: cigarette smoke extract. CPZ: capsazepine. Acro: acrolein.

Also, we found that, in the context of an inflammatory environment, IL-8 protein is induced by CS extract, however, we couldn’t unravel yet the role of TRPV1 in this observation.

Figure. Protein expression of IL-8 in the human epithelial cell line HT29. An inflammatory environment was created by adding LPS and IFN-γ in the cell culture medium. Different concentrations of CSE were tested with and without addition of LPS and IFN-γ. IL-8 is induced by CSE in inflammatory conditions. hIL-8 was measured by ELISA. CSE: cigarette smoke extract. L/I: LPS/IFN-γ.

These results were not mentioned in this paper, as in our opinion, these date wouldn’t contribute.

Minor comments

P9, line 165, the detail information of mice exposed whole body to mainstream CS is necessary.

The cigarette smoking procedure is described in the Materials & Methods section ‘Cigarette smoke exposure’ and was published by D’hulst et al., 2005 (PMID: 16055867). The same procedure was applied to all mouse cigarette smoke exposure experiments. Line 148-155 reads as: “Mice were exposed whole body to mainstream cigarette smoke, as described previously [28]. Briefly, groups of 10 mice were exposed to the tobacco smoke of five cigarettes (Reference Cigarette 3R4F without filter; University of Kentucky, Lexington, KY, USA) four times a day with 30 min. smoke-free intervals, five days per week for 4 or 24 weeks. An optimal smoke:air ratio of 1:6 was obtained. The control groups were exposed to air. Carboxyhaemoglobin in serum of CS-exposed mice reached a non-toxic level of 8.7 ± 0,31% (compared with 0.65 ±0,25% in air-exposed mice), which is similar to carboxyhaemoglobin blood concentrations of human smokers[29].”

How about gene expressions of other TRPVs, TRPV 2-6? It should be mentioned.

We agree with the reviewer’s suggestion. Next to TRPV1, we also investigated TRPA1. However, no significant results were obtained for TRPA1 in response to cigarette smoke exposure.

Figure. mRNA expression of TRPA1 in ileum, proximal and distal colon of wild-type C57/Bl6 mice after 24 weeks of CS exposure. No significant differences in expression were detected. IL: ileum. PC: proximal colon. DC: distal colon. Air: no cigarette smoke exposure. CS: cigarette smoke exposure of 24 weeks.

Attachment

Submitted filename: Response to reviewers.docx

Decision Letter 1

Mathilde Body-Malapel

13 Jul 2020

Translational research into the effects of cigarette smoke on inflammatory mediators and epithelial TRPV1 in Crohn’s disease

PONE-D-20-04633R1

Dear Dr. Allais,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Mathilde Body-Malapel

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Mathilde Body-Malapel

17 Jul 2020

PONE-D-20-04633R1

Translational research into the effects of cigarette smoke on inflammatory mediators and epithelial TRPV1 in Crohn’s disease

Dear Dr. Allais:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Mathilde Body-Malapel

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 File. Regression analysis.

    (PDF)

    S2 File. Human study.

    (XLSX)

    S3 File. Mouse study–long-term smoking.

    (XLSX)

    S4 File. Mouse study–TNBS experiment.

    (XLSX)

    S5 File. Cell line experiments.

    (XLSX)

    S1 Fig. Weight loss in healthy CS-exposed mice.

    (TIF)

    Attachment

    Submitted filename: Response to reviewers.docx

    Attachment

    Submitted filename: Response to reviewers.docx

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES