Skip to main content
Gates Foundation Open Access logoLink to Gates Foundation Open Access
. 2019 Mar 9;39:47. doi: 10.1007/s11032-019-0954-y

Enhanced rice salinity tolerance via CRISPR/Cas9-targeted mutagenesis of the OsRR22 gene

Anning Zhang 1,2, Yi Liu 1,2, Feiming Wang 2, Tianfei Li 2, Zhihao Chen 2, Deyan Kong 2, Junguo Bi 2, Fenyun Zhang 2, Xingxing Luo 2, Jiahong Wang 2, Jinjuan Tang 2, Xinqiao Yu 2, Guolan Liu 2,, Lijun Luo 1,2,
PMCID: PMC7413041  PMID: 32803201

Abstract

Salinity is one of the most important abiotic stress affecting the world rice production. The cultivation of salinity-tolerant cultivars is the most cost-effective and environmentally friendly approach for salinity control. In recent years, CRISPR/Cas9 systems have been widely used for target-site genome editing; however, their application for the improvement of elite rice cultivars has rarely been reported. Here, we report the improvement of the rice salinity tolerance by engineering a Cas9-OsRR22-gRNA expressing vector, targeting the OsRR22 gene in rice. Nine mutant plants were identified from 14 T0 transgenic plants. Sequencing showed that these plants had six mutation types at the target site, all of which were successfully transmitted to the next generations. Mutant plants without transferred DNA (T-DNA) were obtained via segregation in the T1 generations. Two T2 homozygous mutant lines were further examined for their salinity tolerance and agronomic traits. The results showed that, at the seedling stage, the salinity tolerance of T2 homozygous mutant lines was significantly enhanced compared to wild-type plants. Furthermore, no significantly different agronomic traits were found between T2 homozygous mutant lines and wild-type plants. Our results indicate CRISPR/ Cas9 as a useful approach to enhance the salinity tolerance of rice.

Keywords: CRISPR/Cas9, OsRR22, Salinity tolerance, Genetic engineering, Abiotic stress

Introduction

The global crop production needs to double by 2050 to match the demands of the rapidly increasing population, changing diet, and increasing biofuel consumption (Ray et al. 2013). However, abiotic stress, which includes drought, salinity, low temperature, heat, flooding, and oxidative stress, severely limits the feasible yield increase, or even reduces crop production in large areas (Mahajan and Tuteja 2005). Among these abiotic stress, salinity poses one of the major threats to crop production since most crop plants cannot grow under a high concentration of salt (Munns and Tester 2008). Furthermore, soil salinity is hard to remove, which will cause a continuous decrease in crop production for many years. Over 400 million hectares of land throughout the world have been affected by salinity (http://www.plantstress.com/Articles/index.asp). Moreover, land affected by salt stress is arising due to various factors such as climate change, sea-level increases, and tsunamis (Kumar et al. 2013). Consequently, salinity remains a severe threat to the food supply.

Rice (Oryza saliva L.) is one of the most important food crops and forms the main staple food for more than half of the world’s population. Since rice is a species originally grown in swamps and freshwater marshes, it is particularly sensitive to salt stress and rated as a particularly salt-sensitive crop (Dionisio-Sese and Tobita 1998; Kumar et al. 2013). Salinity is one of the major obstacles for rice production especially at the seedling stage (Lutts et al. 1995). Researching of rice salt tolerance is becoming increasingly urgent and improving the salt tolerance of rice has become an important breeding goal. Numerous salt tolerance quantitative trait loci were identified and few of them had been transferred into popular rice varieties via marker-assisted selection (MAS) (Lang et al. 2011; Bimpong et al. 2016; Jing and Zhang. 2017). During the past two decades, many salt-related genes (SKC1, DST, OsRR22, OsHAL3, P5CS, SNAC2, and OsNAP) have been successfully cloned (Ren et al. 2005; Hu et al. 2008; Huang et al. 2009; Sun et al. 2009; Karthikeyan et al. 2011; Chen et al. 2014; Takagi et al. 2015). Among them, the OsRR22 gene encodes a 696-amino acid B-type response regulator transcription factor that is involved in both cytokinin signal transduction and metabolism; its loss of function has been reported to significantly increase salt tolerance (Takagi et al. 2015).

The CRISPR/Cas9 system is an accurate, convenient, and efficient genome-editing method developed during recent years (Shan et al. 2013). At present, the CRISPR/Cas9 system has been widely used for genome editing in major crops such as wheat (Wang et al. 2014; Liang et al. 2017), maize (Svitashev et al. 2016; Zhu et al. 2016), and sorghum (Li et al. 2015; Cai et al. 2015). In rice, using CRISPR/Cas9 technology, many genes (OsPDS, OsERF922, OsHAK1, Badh2, and TMS5) have been knocked out and the expected phenotype was obtained (Zhang et al. 2014; Wang et al. 2016; Zhou et al. 2016; Nieves-Cordones et al. 2017; Shao et al. 2017). This system provides a new method for rice breeding. This study first reports the improvement of salinity tolerance via CRISPR/Cas9-targeted mutagenesis of the transcription factor OsRR22.

Materials and methods

Plant growth conditions

The elite japonica rice cultivar WPB106 was bred from ‘Huhan9/Huxiangjing//Huhan3/Huhan11’ in our laboratory. All transgenic plants and WPB106 (wild type, WT) were grown in the greenhouse at 28–35 °C, in Shanghai, or in fields at the station of the Shanghai Academy of Agricultural Sciences under normal growth conditions. For salinity stress at the seedling stage, seedlings of rice were cultivated in normal nutrient solution for 5 days after germination on a 96-well plate (Xia et al. 2017). They were placed in a growth chamber (14 h of daytime at 30 °C and 10 hat night at 20 °C with 70% relative humidity).

Vector construction

The Cas9 plant expression vector (pYLCRISPR/ Cas9Pubi-H) and the sgRNA expression vector (pYLgRNA) were provided by Prof. Yao-Guang Liu of the South China Agricultural University. The Cas9-OsRR22-gRNA expressing vector was constructed following previously described protocol (Ma et al. 2015a). Briefly, according to the design principles of the target sequences of the CRISPR/ Cas9 system, 19 to 20 bases upstream of the protospacer adjacent motif (PAM) were selected as candidate target sequence (Fig. 1 a). A BLAST search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the target sequences (including PAM) against the rice genome was conducted to confirm their targeting specificity in the genome. The target sequence has a difference of at least two bases compared with similar non-target sequences within the PAM or PAM-proximal region. The gRNA expression cassette was synthesized via overlapping PCR. The target-specific sequence of gRNA (target OsRR22) was put at the 5’-end of the primers RR22-gRT+/RR22-OsU6aT-. Two PCR reactions were performed, using the plasmid pYLgRNA-OsU6a/LacZ as template. The first PCR was performed using the primer set U-F/RR22-OsU6aT-, and the second one used the primer set RR22-gRT+/gR-R (Table 1). The products of PCR 1 and 2 were used as templates for the third PCR reaction with the primer set U-GAL/Pgs-GAR to generate the full-length gRNA fragment (Table 1). Subsequently, amplicons containing OsRR22-gRNA with different Bsal-cutting sites were cloned into the Cas9 plant expression vector pYLCRISPR/Cas9Pubi-H at the Bsal site, using the pEASY-Uni Seamless Cloning and Assembly Kit (TransGen Biotech, Beijing, China). The resultant construct Cas9-OsRR22-gRNA contained a Cas9p expression cassette (Pubi::NLS::Cas9 p::NLS::Tnos) and a hygromycin resistance cassette (2xP35S::HPT::T35STnos) (Fig. 1 b).

Fig. 1.

Fig. 1

CRISPR/Cas9-induced OsRR22 gene modification in rice. a Schematic of the OsRR22 gene structure and target site. Exons and introns are indicated with black rectangles and black lines, respectively. Both the translation initiation codon (ATG) and the termination codon (TGA) are shown. The target site nucleotides are shown in capital letters and the protospacer adjacent motif (PAM) site is underlined. b Schematic presentation of the T-DNA structure in the CRISPR/Cas9-mediated genome editing construct. The expression of Cas9 is driven by the maize ubiquitin promoter (Pubi); the expression of the sgRNA scaffold is driven by the rice U6a small nuclear RNA promoter (OsU6a); the expression of hygromycin (HPT) is driven by two CaMV35S promoters (2 × 35S). Abbreviations: NLS, nuclear localization signal; Tnos, gene terminator; LB and RB, left border and right border, respectively. c Nucleotide sequences at the target site in the nine T0 mutant rice plants. The recovered mutated alleles are shown below the wild-type sequence. The target site nucleotides are indicated with black capital letters. The PAM site is underlined. The red dashes indicate deleted nucleotides. The red capital letters indicate inserted or substituted nucleotides. The numbers on the right indicate the type ofmutation and the number of nucleotides involved. “i,” “d,” and “s” indicate insertion, deletion, and substitution of the indicated number of nucleotides, respectively; “WT” indicates wild-type

Table 1.

Primers used in this study

Primer name Primer sequence (5′-3′) Purpose
RR22-gRT+ AGAGGGATCAATTCCCCGTgttttagagctagaaat Vector construct
RR22-OsU6aT- ACGGGGAATTGATCCCTCTCggcagccaagccagca Vector construct
U-F CTCCGTTTTACCTGTGGAATCG Vector construct
gR-R CGGAGGAAAATTCCATCCAC Vector construct
U-GAL ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG Vector construct
Pgs-GAR TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGCTCTTG Vector construct
RR22-S-F CTTGGGATTGCTCTGTTTCT Target site sequencing
RR22-S-R GTAATAGCCTGGTTGGTTGAT Target site sequencing
HPT-F GCTCCATACAAGCCAACCACG Transgenic analysis
HPT-R CCTGCCTGAAACCGAACTGC Transgenic analysis
CAS9-F CGAGACGAACGGTGAGACTGGTG Transgenic analysis
CAS9-R GGTGCTTGTTGTAGGCGGAGAGG Transgenic analysis

Agrobaclerium-mediated rice transformation

The Cas9-OsRR22-gRNA expressing binary vector was introduced into the japonica rice WPB106 cultivar via the Agrobaclerium-mediated transformation method described by Nishimura et al. (2006). Hygromycin-containing medium was used to select hygromycin-resistant calli, and then, vigorously growing calli were transferred to regeneration media to generate green plants.

Identification of mutant transgenic plants

To determine the mutation at the target site, genomic DNA from the leaves of transgenic plants was extracted using a DNA Quick Plant System (TransGen Biotech, Beijing, China). Genomic DNA (50 ng) was used as template to perform PCR amplification using PCR Mastermix (TIANGEN, Beijing, China). PCR was performed to amplify the genomic region containing the CRISPR/Cas9 target site, using specific primer pairs that surround the designed target site (Table 1). The PCR products were directly sequenced or cloned into the pEASY-Blunt vector (TransGen Biotech, Beijing, China) and sequenced using the Sanger method. Mutations were identified by comparing the sequences of transgenic plants with those of WT plants. Mutations containing normal sequencing chromatograms were considered as homozygote mutations. Mutations containing superimposed sequencing chromatograms were considered heterozygous or bi-allelicmutations, which were decoded via degenerate sequence decoding (Ma et al. 2015b).

To identify T-DNA-free plants from T1, the plants were analyzed via PCR using HPT-specific and Cas9- specific primers (Table 1) in combination with agarose gel electrophoresis. The pYLCRISPR/Cas9Pubi-H plasmids and the T0 transgenic plants were selected as positive controls and WPB106 DNA and H2O were used as negative controls. HPT- and Cas9-negative plants were considered as T-DNA-free plants.

Greenhouse trials for salinity tolerance

To evaluate the salinity tolerance of plants at the seedling stage, a salt stress test was performed according to the method published by Takagi et al. (2015). We compared the salinity tolerance of 2-week-old WT and homozygous mutant plants in the greenhouse of the Shanghai Agrobiological Gene Center, Shanghai. Briefly, 2-week-old plants were treated with fresh groundwater and concentrations of 0.75% NaCl solution (pH = 7), respectively. After 2 weeks of treatment, the salinity tolerance was determined via plant height and shoot fresh and dry weights of 10 plants per line. Each line was replicated three times.

Evaluation of major agronomic traits under field conditions

To evaluate the agronomic traits under normal field conditions, both WT and mutant plants were planted in a four-row plot with seven plants per row, applying 20 x 15 cm spacing in Shanghai, China, during the summer of2017. In these field trials, 4-week-old plants (or older) were transplanted and field management was conducted according to local conventional methods. The agronomic traits were measured according to the SES (IRRI 2002). Five plants in the middle row of each line were sampled for the following agronomic traits: days to 50% flowering, plant height, no. of tillers, no. of grains per panicle, spikelet fertility, 1000-seed weight, and yield per plant.

Results

CRISPR/Cas9 design

To design a mutation specifically targeting the OsRR22 gene in rice, a 20-bp nucleotide sequence in the first exon of OsRR22 (GenBank Accession No BR000251.1) was chosen as the target site (Fig. 1 a). The binary plasmid Cas9-OsRR22-gRNA (Fig. 1 b) was constructed based on the CRISPR/Cas9 vector previously described by Ma et al. (2015a). The vector was used to transform the rice variety WPB106 via Agrobacterium-mediated transformation. Using site-specific PCR and Sanger sequencing, a total of nine WPB106 mutants were recovered from 14 T0 hygromycin-resistant transgenic WPB106 plants (64.3%). These nine mutants were detected and then subjected to zygosity analysis by cloning PCR products into the T vector for DNA sequencing. Sequence analyses detected two homozygous mutations, two heterozygous mutations, and five bi-allelic mutations. Based on allele mutation types, 44.4% of the mutations were nucleotide insertions, 11.1% of the mutations were nucleotide deletions, and 5.6% of the mutations were nucleotide substitutions; 11.1%, 5.6%, and 11.1% of the mutations were simultaneous nucleotide insertions and deletions, insertions and substitutions, and deletions and substitutions, respectively (Table 2).

Table 2.

Ratios of mutant genotype and mutation type at the target site in T0 mutant plants

Mutant genotype ratios (%) a Mutation type ratios (%) b
Bi-allele Homozygote Heterozygote Deletion Insertion Substitution Insertion and deletion Insertion and substitution Deletion and substitution
55.6 (5/9) 22.2 (2/9) 22.2 (2/9) 11.1 (2/18) 44.4 (8/18) 5.6 (1/18) 11.1 (2/18) 5.6 (1/18) 11.1 (2/18)
a

Based on the number of each mutant genotype out of the total number of all mutant genotypes at the target site

b

Based on the number of each allele mutation type out of the total number of all allele mutation types at the target site

Transmission of CRISPR/Cas9-induced mutations to the T1 generation

To further understand the inheritance of the mutation, two homozygous (rr-2, rr-7), one heterozygous (rr-10), and one bi-allelic (rr-1) T0 mutant plants (Fig. 1 c) were self-pollinated, and their progenies were genotyped at the target site. We randomly selected nine to 23 T1 progenies derived from each T0 plant for genotyping analysis (Table 3). As expected, all of these T0 putative homozygotes and their offspring had identical genotypes (rr-2 and rr-7), suggesting stable transmittance of the mutations in these homozygous mutant lines to the next generation. Bi-allelic mutations in T0 plants were apparently transmitted to the T1 generation following the Mendelian genetic law, indicating that the targeted mutations in T0 plants were inherited normally. For example, the bi-allelic T0 mutant plant rr-1 harbors two mutations (a 1-bp deletion (d1) and a 1-bp insertion (i1)); its T1 progenies segregated in a ratio of 5 (d1):8 (d1/i1):4 (i1), which is consistent with the predicted Mendelian segregation (χ2 = 0.176 < χ20.05,2 = 5.99) (Table 3). For the T1 generation of heterozygous (rr-10), several new mutations (6 (d1/i1)) were generated. In combination, these results clearly demonstrated that CRISPR/Cas9-induced gene mutations could be stably transmitted to subsequent generations.

Table 3.

CRISPR/Cas9-induced mutations in OsRR22 and their transmission to the T1 generation

T0 plant Genotype Mutation type Number of T1 plants tested Mutation transmission in the T1 generation No. of T-DNA-free plants
Targeted mutations χ2 (1:2:1)
rr-2 Homozygote i1 10 10 (i1) ND 2
rr-7 Homozygote i1 9 9 (i1) ND 3
rr-10 Heterozygote d3 23 5 (d3), 8 (d3/wt), 4 (wt), 6 (d1/i1) ND 0
rr-1 Bi-allelic d1/i1 17 5 (d1), 8 (d1/i1), 4 (i1) 0.176 (P > 0.05) 4

“i” and “Bd” indicate insertion and deletion of the indicated number of nucleotides, respectively; “d/i” indicates the simultaneous deletion and insertion of the indicated number of nucleotides. The numbers on the right indicate the type of mutation and the number of nucleotides involved WT, wild type; ND, not detected

Selection of T-DNA-free mutant rice lines

To obtain rice lines harboring the desired OsRR22 mutations without T-DNA of the construct Cas9-OsRR22, we conducted PCR amplification using the primer sets designed to amplify Cas9 and HPT sequences (Table 1). The absence of transgenes was determined via negative PCR results of both Cas9 and HPT. T-DNA-free plants were found among most T1 plants, with the proportion ranging from 20.0 to 33.3% (Table 3). These results indicated that T-DNA-free homozygous mutants could be acquired via segregation populations. We isolated two T-DNA-free homozygous mutant lines (rr-2-1 and rr7-4) in the T1 generation to produce the T2 population to identify the salinity-tolerant phenotypes, designated as WPB106-cas-1 and WPB106-cas-2.

Salinity tolerance was enhanced in OsRR22-induced mutations

To evaluate the salinity-tolerant phenotype of the obtained rice mutants, two homozygous mutant T2 lines (WPB106-cas-1 and WPB106-cas-2) with different allelic mutations and WT plants were treated with fresh groundwater and a concentration of 0.75% NaCl nutrition solution at the 2-week-old stage. Compared to WT, two mutant lines grew better than WT under this condition (Fig. 2 a). As measured after 2 weeks of treatment, the shoot fresh weight of WT was reduced by 50.3%, while WPB106-cas-1 and WPB106-cas-2 showed only 10.1% and 2.1% reduction in shoot fresh weight, compared to plants that were grown with fresh groundwater. Similarly, the shoot dry weight of WT had been reduced by 42.6%, whereas WPB106-cas-1 and WPB106-cas-2 showed only decreases of 12.9% and 12.3%. The 0.75% NaCl treatment also caused decreases of 31.8%, 20.3%, and 17.8% in plant height of WT, WPB106-cas-1, and WPB106-cas-2, respectively (Fig. 2 b and Table S1). The significant difference analysis of the shoot fresh weight, shoot dry weight, and plant height indicated that two mutant lines were significantly different from WT plants. These results implicitly indicate that CRISPR/ Cas9-induced mutations in the OsRR22 gene enhanced the tolerance to salinity.

Fig. 2.

Fig. 2

Identification of salinity tolerance in homozygous mutant rice lines. a Phenotypes of 4-week-old WT, WPB106-cas-1, and WPB106-cas-2 plants grown with underground fresh water and subjected to a concentration of 0.75% NaCl. Two-week-old plants were treated with concentrations of 0.75% NaCl. Then, phenotypic evaluation was conducted 14 days after treatment. b A comparison of shoot fresh weight, shoot dry weight, and plant height between WT, WPB106-cas-1, and WPB106-cas-2 plants is shown in a. Values of shoot fresh weight and shoot dry weight represent weight of 10 plants per treatment. Mean values and standard deviations are shown. Asterisks indicate significant differences to WT (**P <0 0.01)

The main agronomic traits were not altered in rice mutants

To survey whether mutations in the OsRR22 gene affect other agronomic traits, we characterized two homozygous T2 mutant lines by measuring their plant height, days to 50% flowering, no. of tillers per plant, no. of grains per panicle, spikelet fertility, 1000-seed weight, and yield per plant under normal field conditions. Student’s t test showed that none of the T2 mutant lines was significantly different from WT plants under normal growth conditions (Table 4). These results showed that CRISPR/Cas9-induced mutations in the OsRR22 gene did not significantly influence agronomic traits under normal field conditions.

Table 4.

Agronomic traits of homozygous T2 mutant lines

Lines Days to 50% flowering Plant height (cm) No. of tillers per plant No. of grains per panicle Spikelet fertility (%) 1000-seed weight (g) Yield per plant (g)
WT 87.81 ± 0.7a 92.82 ± 3.91a 8.49 ± 0.25a 123.51 ± 3.23a 93.11 ± 3.09a 25.15 ± 0.79a 21.19 ± 0.57a
WPB106-cas-1 87.01 ± 1.19a 95.01 ± 2.23a 8.43 ± 0.21a 124.01 ± 4.46a 96.45 ± 1.98a 25.05 ± 0.94a 20.72 ± 0.77a
WPB106-cas-2 86.51 ± 0.71a 93.03 ± 2.86a 8.38 ± 0.23a 123.52 ± 3.05a 94.29 ± 2.58a 25.29 ± 0.61a 20.82 ± 0.64a

The data are measured for five plants per line. Values followed by the same letter (a) are not significantly different (P < 0.05)

Discussion

CRISPR/Cas9 is a new genome-editing technique, which is highly specific and efficient. So far, the CRISPR/Cas9 technology has been widely used to improve major crops, such as rape, corn, rice, and soybean (Bortesi and Fischer 2015). However, few studies reported the direct genome editing of elite rice cultivars with the CRISPR/Cas9 technology. The ERF transcription factor gene OsERF922 was mutated by CRISPR/ Cas9 to enhance the blast resistance of the rice variety Kuiku131 with normal phenotypes (Wang et al. 2016). Knockout of the thermo-sensitive genic male-sterile (TGMS) gene tms5 of 11 fertile elite cultivars produced TGMS lines with good agronomic characteristics (Zhou et al. 2016). WPB106, a water-saving and drought-resistant elite japonica cultivar (Luo 2010), has the advantages of drought resistance, early maturity, and cooking quality; however, it is very sensitive to salinity. To quickly improve its salt tolerance, we applied the CRISPR/Cas9 technology. In this study, we used the Cas9-OsRR22-gRNA expressing vector to knockout OsRR22 and achieved 64.3% mutant plants in T0 transgenic plants. We obtained two homozygous mutant lines that harbor mutagenesis in OsRR22 without exogenous T-DNA. The evaluation of the salinity tolerance at the seedling stage showed that the salinity tolerance of T2 homozygous mutant lines was significantly enhanced compared to that of WT plants. Furthermore, the result of field trials showed no significant difference between T2 homozygous mutant lines and WT plants in the main agronomic traits under normal field conditions. Our study provides a successful case for improving rice salinity tolerance via the CRISPR/Cas9 technology and thus demonstrated that OsRR22 has promising potential to accelerate the improvement of the salinity tolerance in rice breeding.

Many genes involved with salinity tolerance have been identified in rice, such as OsNAC6, OsPPla, OsTPSl, and OsNA’P. Transgenic rice plants overexpressing these genes showed an improved tolerance to high salt stresses. However, transgenic plants generated by gene addition are subjected to rigorous genetically modified management. Breeding strategy using CRISPR/Cas9 technology knockdown of rice transcription factor has been demonstrated to be an alternative approach for genetic improvement of rice and avoiding transgenic issue. According to the reports, there are only a few genes acting as a negative regulator of salt tolerance. Although the DST knockdown mutant could effectively improve salt tolerance, it has a large change in agronomic traits, such as leaf width, the panicle number per plant, and the main panicle length (Huang et al. 2009). OsRR22 could significantly improve salt tolerance but no changes were found in other agronomic traits (Takagi et al. 2015). Through our experiments, improved salt tolerance in the OsRR22 knockout lines free of transgene has been verified. Similarly, there was no alteration in the agronomic traits under normal conditions, which has achieved our breeding goals. Salinity tolerance is usually related to drought tolerance. Interestingly, we also carried out the drought-tolerant identification of WT and two homozygous T2 mutant lines at the seedling stage, and the results showed that there was no difference between WT and mutant lines under drought stress (Fig. S1).

In the present study, the Cas9-OsRR22-gRNA-induced mutagenic frequency of T0 plants was 64.3% and the homozygous rate of T0 mutant plants was 22.2%, which was similar to previous reported values in rice (Zhang et al. 2014; Wang et al. 2016; Zhou et al. 2016). Among six types of induced mutations in T0 plants, single-nucleotide insertions were most frequently detected (up to 44.4%), which is consistent with a previous report (Zhang et al. 2014). In addition, allele mutations could be successfully transmitted to the next generations. Moreover, we observed new mutations within the T1 offspring of rr-10, which are probably due to the continuous modification of WT alleles in Cas9-positive T1 lines. T-DNA-free plants could be found in almost all T1 segregation population. These results indicate a very convenient production of T-DNA-free homozygous mutation lines in the T1 generation.

In conventional rice breeding, efforts to breed for salinity tolerance have been attempted. However, these usually required approximately one decade due to the lack of accurate screening techniques, lack of adequate resistance resources, and timeconsuming backcrossing procedure (Hoang et al. 2016). Compared to conventional breeding, the CRISPR/Cas9 technology offers the ability to shorten the breeding period and thus significantly reducing cost (Schaart et al. 2016). For example, this experiment showed that we only required 1 year to improve the salt tolerance of WPB106 via CRISPR/ Cas9 technology. Furthermore, the CRISPR/Cas9 technology is more accurate than conventional breeding, since it only creates mutations in the target gene without changing other genes. However, rarely, negative regulatory genes with the desired function and the requirement for a PAM (-NGG) sequence form limitations of the CRISPR/Cas9 system. Conventional breeding has the advantage to improve the complex trait, while the CRISPR/Cas9 technique has the advantage in the mutagenesis of key genes. Therefore, the present study indicates that combining the CRISPR/Cas9 technique with conventional rice breeding could become a very powerful new tool for crop improvement.

Supplementary Material

Author contributions

ANZ and YL are equal contributors, and carried out the experiments and vector construction. TFL, FMW, DYK, and JJT did the transformation. ZHC, FYZ, and SFY did the evaluation of salinity tolerance. JGB, JHW, and XXL helped to evaluate the agronomic traits under normal field conditions. XQY, GLL, and LJL made the overall design of this study. All authors read and approved the final manuscript.

Funding information

This research was supported by the National High Technology Research and Development Programs of China (Grant No. 2014AA10A603 and 2014AA10A604), the Bill and Melinda Gates Foundation (Grant No. 0PP1130530-4), the Shanghai Sailing Program (Grant No. 16YF1410000), the National Natural Science Foundation of China (Grant No. 31501270), and the key program of Shanghai Prospering Agriculture by Science and Technology (Grant No. 2017-02-08-00-08-F00071).

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. Bimpong IK, Manneh B, Sock M, Diaw F, Amoah NKA, Ismail AM, Gregorio G, Singh RK, Wopereis M (2016) Improving salt tolerance of lowland rice cultivar ‘Rassi’ through markeraided backcross breeding in West Africa. Plant Sci 242:288–299 [DOI] [PubMed] [Google Scholar]
  2. Bortesi L, Fischer R (2015) The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol Adv 33(1):41–52 [DOI] [PubMed] [Google Scholar]
  3. Cai Y, Chen L, Liu X, Sun S, Wu C, Jiang B, Han T, Hou W. CRISPR/Cas9-mediated genome editing in soybean hairy roots. PLoS One 10:e0136064. 10.1371/journal.pone.0136064 [DOI] [PMC free article] [PubMed]
  4. Chen X, Wang Y, Lv B, Li J, Luo L, Lu S, Zhang X, Ma H, Ming F (2014) The NAC family transcription factor OsNAP confers abiotic stress response through the ABA pathway. Plant Cell Physiol 55(3):604–619 [DOI] [PubMed] [Google Scholar]
  5. Dionisio-Sese ML, Tobita S (1998) Antioxidant responses of rice seedlings to salinity stress. Plant Sci 135:1–9 [Google Scholar]
  6. Hoang T, Tran T, Nguyen T, Williams B, Wurm P, Bellairs S, Mundree S (2016) Improvement of salinity stress tolerance in rice: challenges and opportunities. Agronomy 6:54 10.3390/agronomy6040054 [DOI] [Google Scholar]
  7. Hu H, You J, Fang Y, Zhu X, Qi Z, Xiong L (2008) Characterization of transcription factor gene SNAC2 conferring cold and salt tolerance in rice. Plant Mol Biol 67:169–181 [DOI] [PubMed] [Google Scholar]
  8. Huang XY, Chao DY, Gao JP, Zhu MZ, Shi M, Lin HX (2009) A previously unknown zinc finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control. Genes Dev 23(15:1805–1817 [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jing W, Zhang W (2017) Research progress on gene mapping and cloning for salt tolerance and variety improvement for salt tolerance by molecular marker-assisted selection in rice. Chin J Rice Sci 31(2):111–123 (in Chinese with English abstract) [Google Scholar]
  10. Karthikeyan A, Pandian SK, Ramesh M (2011) Transgenic indica rice cv. ADT43 expressing a 1-pyrroline-5-carboxylate synthetase (P5CS) gene from Vigna aconitifolia demonstrates salt tolerance. Plant Cell Tissue Organ Cult 107(3):383–395 [Google Scholar]
  11. Kumar K, Kumar M, Kim SR, Ryu H, Cho YG (2013) Insights into genomics of salt stress response in rice. Rice 6(1):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Lang N, Buu BC, Ismail AM (2011) Enhancing and stabilizing the productivity of salt-affected areas by incorporating genes for tolerance of abiotic stresses in rice. Omonrice 18:41–49 [Google Scholar]
  13. Li Z, Liu ZB, Xing A, Moon BP, Koellhoffer JP, Huang L, Ward RT, Clifton E, Falco SC, Cigan AM (2015) Cas9-guide RNA directed genome editing in soybean. Plant Physiol 169:960–970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Liang Z, Chen KL, Li TD, Zhang Y, Wang YP, Zhao Q, Liu JX, Zhang HW, Liu CM, Ran YD, Gao CX (2017) Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Nat Commun 8:14261 10.1038/ncomms14261 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Luo LJ. (2010) Breeding for water-saving and drought-resistance rice (WDR) in China. J Exp Bot 61:3509–3517 [DOI] [PubMed] [Google Scholar]
  16. Lutts S, Kinet JM, Bouharmont J (1995) Changes in plant response to NaCl during development of rice (Oryza sativa L.) varieties differing in salinity resistance. J Exp Bot 46:1843–1852 [Google Scholar]
  17. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG (2015a) A robust CRISPR/ Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8(8):1274–1284 [DOI] [PubMed] [Google Scholar]
  18. Ma X, Chen L, Zhu Q, Chen Y, Liu YG (2015b) Rapid decoding of sequence-specific nuclease-induced hetero-zygous and biallelic mutations by direct sequencing of PCR products. Mol Plant 8(8):1285–1287 [DOI] [PubMed] [Google Scholar]
  19. Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: an overview. Arch Biochem Biophys 444(2):139–158 [DOI] [PubMed] [Google Scholar]
  20. Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651–681 [DOI] [PubMed] [Google Scholar]
  21. Nieves-Cordones M, Mohamed S, Tanoi K, Kobayashi NI, Takagi K, Vernet A, Guiderdoni E, Périn C, Sentenac Véry A-A (2017) Production of low-Cs+ rice plants by inactivation of the K+ transporter OsHAK1 with the CRISPR-Cas system. Plant J 92:43–56 [DOI] [PubMed] [Google Scholar]
  22. Nishimura A, Aichi I, Matsuoka M (2006) A protocol for Agrobacterium-mediated transformation in rice. Nat Protoc 1(6):2796–2802 [DOI] [PubMed] [Google Scholar]
  23. Ray DK, Mueller ND, West PC, Foley JA (2013) Yield trends are insufficient to double global crop production by 2050. PLoS One 8(6):e66428 10.1371/journal.pone.0066428 [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ren Z, Gao J, Li L, Cai X, Huang W, Chao D, Zhu M, Wang Z, Luan S, Lin H (2005) A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nat Genet 37(10):1141–1146 [DOI] [PubMed] [Google Scholar]
  25. Schaart JG, van de Wiel CCM, Lotz LAP, Smulders MJM (2016) Opportunities for products of new plant breeding techniques. Trends Plant Sci 21:438–449 [DOI] [PubMed] [Google Scholar]
  26. SES (standard evaluation system for rice), International Rice Research Institute, Philippines 2002, pp 1–56 [Google Scholar]
  27. Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi JJ, Qiu JL, Gao C (2013) Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotech 31(8):686–688 [DOI] [PubMed] [Google Scholar]
  28. Shao GN, Xie LH, Jiao GA, Wei XJ, Sheng ZH, Tang S, Hu PS (2017) CRISPR/CAS9-mediated editing of the fragrant gene Badh2 in rice. Chin J Rice Sci 31(2):216–222 (in Chinese with English abstract) [Google Scholar]
  29. Sun S, Chao D, Li X, Shi M, Gao J, Zhu M, Yang H, Luan S, Lin H (2009) OsHAL3 mediates a new pathway in the light regulated growth of rice. Nat Cell Biol 11:845–851 [DOI] [PubMed] [Google Scholar]
  30. Svitashev S, Schwattz C, Lenderts B, Young JK, Cigan AM (2016)Genome editing in maize directed by CRISPR-Cas9 ribonucleoprotein complexes. Nat Commun 7:13274 10.1038/ncomms13274 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Takagi H, Tamiru M, Abe A, Kentaro Yoshida K, Uemura A, Yaegashi H, Obara T, Oikawa K, Hiroe Utsushi H, Eiko Kanzaki E, Mitsuoka C, Natsume S, Kosugi S, Kanzaki H, Matsumura H, Urasaki N, Kamoun S, Terauchi R (2015) MutMap accelerates breeding of a salt-tolerant rice cultivar. Nat Biotechnol 33(5):445–449 [DOI] [PubMed] [Google Scholar]
  32. Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32(9):947–951 [DOI] [PubMed] [Google Scholar]
  33. Wang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu YG, Zhao K. Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PLoS One 11:e0154027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Xia H, Huang WX, Xiong J, Yan SG, Tao T, Li JJ, Wu JH, Luo LJ (2017) Differentially methylated epiloci generated from numerous genotypes of contrasting tolerances are associated with osmotic-tolerance in rice seedlings. Front Plant Sci 8:11 10.3389/fpls.2017.00011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Zhang H, Zhang J, Wei P, Zhang B, Gou F, Feng Z, Mao Y, Yang L, Zhang H, Xu N, Zhu JK (2014) The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J 12(6):797–807 [DOI] [PubMed] [Google Scholar]
  36. Zhou H, He M, Li J, Chen L, Huang Z, Zheng S, Zhu L, Ni E, Jiang D, Zhao B, Zhuang C (2016) Development of commercial thermo-sensitive genic male sterile rice accelerates hybrid rice breeding using the CRISPR/Cas9-mediated TMS5 editing system. Sci Rep 6:37395 10.1038/srep37395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhu J, Song N, Sun S, Yang W, Zhao H, Song W, Lai J (2016) Efficiency and inheritance of targeted mutagenesis in maize using CRISPR-Cas9. J Genet Genomics 43(1):25–36 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Molecular Breeding are provided here courtesy of Gates Foundation - Open Access

RESOURCES