Skip to main content
Plant Biotechnology Journal logoLink to Plant Biotechnology Journal
. 2020 Feb 13;18(9):1869–1881. doi: 10.1111/pbi.13346

Natural variation and CRISPR/Cas9‐mediated mutation in GmPRR37 affect photoperiodic flowering and contribute to regional adaptation of soybean

Liwei Wang 1,†, Shi Sun 1,†, Tingting Wu 1, Luping Liu 1, Xuegang Sun 1, Yupeng Cai 1, Jicun Li 2, Hongchang Jia 1, Shan Yuan 1, Li Chen 1, Bingjun Jiang 1, Cunxiang Wu 1, Wensheng Hou 1,✉, Tianfu Han 1,✉
PMCID: PMC7415786  PMID: 31981443

Summary

Flowering time is a critical determinant of the geographic distribution and regional adaptability of soybean (Glycine max) and is strongly regulated by photoperiod and temperature. In this study, quantitative trait locus (QTL) mapping and subsequent candidate gene analysis revealed that GmPRR37, encoding a pseudo‐response regulator protein, is responsible for the major QTL qFT12‐2, which was identified from a population of 308 recombinant inbred lines (RILs) derived from a cross between a very late‐flowering soybean cultivar, ‘Zigongdongdou (ZGDD)’, and an extremely early‐flowering cultivar, ‘Heihe27 (HH27)’, in multiple environments. Comparative analysis of parental sequencing data confirmed that HH27 contains a non‐sense mutation that causes the loss of the CCT domain in the GmPRR37 protein. CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants in soybean exhibited early flowering under natural long‐day (NLD) conditions. Overexpression of GmPRR37 significantly delayed the flowering of transgenic soybean plants compared with wild‐type under long photoperiod conditions. In addition, both the knockout and overexpression of GmPRR37 in soybean showed no significant phenotypic alterations in flowering time under short‐day (SD) conditions. Furthermore, GmPRR37 down‐regulated the expression of the flowering‐promoting FT homologues GmFT2a and GmFT5a, and up‐regulated flowering‐inhibiting FT homologue GmFT1a expression under long‐day (LD) conditions. We analysed haplotypes of GmPRR37 among 180 cultivars collected across China and found natural Gmprr37 mutants flower earlier and enable soybean to be cultivated at higher latitudes. This study demonstrates that GmPRR37 controls soybean photoperiodic flowering and provides opportunities to breed optimized cultivars with adaptation to specific regions and farming systems.

Keywords: soybean (Glycine max (L.) Merr.), flowering time, QTL, GmPRR37, CRISPR/Cas9, adaptation

Introduction

The transition from the vegetative to reproductive phase is a key developmental switch in flowering plants (Blumel et al., 2015). Activation of the transition to flowering depends on a complex network with (epi‐) genetic factors and environmental stimuli (Blumel et al., 2015; Mouradov et al., 2002). Timing of flowering is critical for adaptability, productivity and quality of seed crops. Thus, understanding the molecular mechanisms underlying flowering is crucial for crop genetic improvement.

Soybean (Glycine max (L.) Merr.) is a facultative short‐day (SD) plant and is cultivated worldwide in a broad range of latitudes, although each cultivar is restricted to a relatively narrow latitude range (Watanabe et al., 2012). Photoperiod sensitivity is one of the key determinants for soybean flowering time and is regulated by the interaction between endogenous circadian rhythm and exogenous day length, which varies at different geographical latitudes. Successful identification of major genes and quantitative trait loci (QTL) underlying flowering time is a prerequisite for understanding the soybean photoperiod flowering pathway.

A large number of QTLs in different linkage groups [e.g. first flower‐104, pod maturity beginning (R7)‐5, pod maturity (R8)‐178 QTL] have been identified to be involved in flowering and maturity and are catalogued in SoyBase (http://soybase.org/). Among these, 11 have been confirmed as major effect QTLs that control the time to flowering and maturity in soybean: E1 and E2 (Bernard, 1971), E3 (Buzzell, 1971), E4 (Buzzell and Voldeng, 1980), E6 (Bonato and Vello, 1999), E7 (Cober and Voldeng, 2001), E8 (Cober et al., 2010), E9 (Kong et al., 2014), E10 (Samanfar et al., 2017), qDTF‐J1 (Takeshima et al., 2016) and J (Ray et al., 1995). The genes underlying QTLs E1‐E4, E9, E10, qDTF‐J1 and J have been identified, and their functions in the photoperiod control of flowering have been characterized (Kong et al., 2010; Liu et al., 2008; Lu et al., 2017; Samanfar et al., 2017; Sun et al., 2011; Takeshima et al., 2016; Watanabe et al., 2009; Watanabe et al., 2011; Xia et al., 2012; Yue et al., 2017; Zhao et al., 2016). Despite these progresses, bioinformatics analysis has revealed that there were 333 (Watanabe et al., 2012) to 491 (Jung et al., 2012) orthologs of Arabidopsis flowering‐time genes in soybean. Thus, the molecular cloning of genes associated with flowering in soybean has lagged behind that in the model plant Arabidopsis.

In Arabidopsis, photoperiodic flowering relies on circadian clock (Greenham and McClung, 2015). Circadian clocks, which are endogenous mechanisms for keeping time, allow organisms to coordinate biological processes with the time of day and thus provide an adaptive advantage (Bendix et al., 2015; Farre and Liu, 2013). Pseudo‐response regulators (PRRs) are key components of circadian networks in Arabidopsis (Farre et al., 2005; Farre and Liu, 2013; Nakamichi et al., 2012; Perales and Mas, 2007; Wang et al., 2013) and are defined as proteins containing two conserved domains: a N‐terminal response‐regulator receiver domain and a C‐terminal CCT (CONSTANS, CO‐like, and TOC1) domain. Arabidopsis has five PRR family members (APRR1/TOC1, APRR3, APRR5, APRR7 and APRR9). Genetic analysis has revealed that APRRs are involved in the regulation of photoperiodic flowering in Arabidopsis (Murakami et al., 2004; Nakamichi et al., 2005). Phylogenetic analyses indicate that the common ancestor of plants possessed homologues of three PRR groups (TOC1, PRR7/3 and PRR5/9) in its genome (Farre and Liu, 2013; Satbhai et al., 2011). Recent studies have demonstrated that PRRs are functionally conserved among plants. For example, several PRR37 genes showing high sequence similarity to both PRR7 and PRR3, such as Ppd‐H1 in barley (Hordeum vulgare), Ppd‐D1 in wheat (Triticum aestivum L.), SbPRR37 in sorghum (Sorghum bicolor (L.) Moench) and OsPRR37 in rice (Oryza sativa L.), have been shown to regulate photoperiod flowering in crops (Beales et al., 2007; Gao et al., 2014; Koo et al., 2013; Liu et al., 2018a; Murphy et al., 2011; Turner et al., 2005; Yan et al., 2013). In soybean, two genes homologous to PRR3 (GmPRR3A and GmPRR3B) are the most likely candidates responsible for two QTLs controlling growth period (Li et al., 2019a). However, the molecular identification, functional characterization and mechanism of PRR3/7 in soybean have remained elusive.

The objective of this study was to identify QTLs regulating soybean flowering time using a population of 308 recombinant inbred lines (RILs) derived from a cross between a very late‐flowering soybean cultivar, ‘Zigongdongdou (ZGDD)’, and an extremely early‐flowering soybean cultivar, ‘Heihe27 (HH27)’. Through map‐based cloning and candidate gene analysis, we found that GmPRR37 is responsible for one of the major effect QTLs we identified, qFT12‐2. HH27 contains a non‐sense mutation in the CCT domain of the protein encoded by GmPRR37. CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants exhibit early flowering under natural long‐day (NLD) conditions, while no significant phenotypic alterations in flowering time were observed under SD conditions. Overexpression of the functional ZGDD GmPRR37 gene in the soybean cultivar Jack significantly delayed flowering time under long‐day (LD) and NLD conditions, but had little effect on flowering time under SD conditions. These results suggest that GmPRR37 functions as a suppressor in LD‐dependent flowering pathway in soybean. We genotyped GmPRR37 in 180 cultivars from diverse soybean growing areas across a wide geographic range in China and demonstrated that loss‐of‐function of GmPRR37 has contributed to the cultivation of soybean in higher latitude regions.

Results

Phenotypic analysis of flowering time in the RIL population

The flowering time of 308 RILs and the parents HH27 and ZGDD were determined in Beijing 2016 and 2017, in Xinxiang 2016 and 2017, in Sanya 2016 and 2017, in Jining 2016 and in Xiangtan 2017. Each location‐year combination was defined as an experimental environment, and these eight environments were named BJ16, BJ17, XX16, XX17, SY16, SY17, JN16 and XT17, respectively. There were highly significant differences (P < 0.01) in flowering time between the two parents under all environments, with ZGDD flowering much later than HH27. Among the RILs, there was wide variation in flowering time across eight environments, and obvious bi‐directional transgressive segregation in all environments except SY16 and BJ17, suggesting polygenic quantitative genetic control (Figure S1, Table S1).

Genotyping of the RIL population based on 2b‐RAD and genetic map construction

We used 2b‐RAD to genotype the RIL population. DNA was digested with BsaXI or FalI and sequenced with the Illumina Hiseq X ten platform. For BsaXI‐digested DNA, the sequencing depth was 44× for HH27, 43× for ZGDD and 15× for the 308 RILs (Table S2). For FalI‐digested DNA, the sequencing depth was 93× for HH27, 90× for ZGDD and 27× for the 308 RILs (Table S3). The sequencing depth detail for each RIL is shown in Table S2 and S3. After genotyping, 7,123 polymorphic single‐nucleotide polymorphism (SNP) markers were identified and used for linkage map construction. The final molecular linkage map consisted of 3,454 markers on 20 linkage groups that spanned 2208.16 cM with an average distance of 0.64 cM between adjacent markers (Figure S2, Table S4).

QTL analysis of flowering time in multiple environments

Based on the high‐density genetic map, a total of 69 flowering‐time QTLs spread over 10 soybean chromosomes were identified through single‐environment QTL analysis (Table S5). Of these QTLs, nine were identified across multiple environments, and six were identified in a single environment (Table S5). The nine stable QTLs detected across multiple environments may explain the genetic basis of soybean flowering regulation, and we mainly focused on these QTLs in subsequent analysis. Comparative analysis showed that well‐characterized genes (E1, E2, FT5a, FT2a and E3) underlying flowering time in soybean were located within the genomic regions of qFT6, qFT10, qFT16‐1, qFT16‐2 and qFT19 (Table S5). qFT11 was identified in more than five environments and using BLUP values, but it only accounted for 2.26‐5.44% of the phenotypic variation. The major effect QTL qFT12‐2 was confirmed across seven environments and using BLUP values, with an average logarithm of the odds (LOD) score ranging from 5.37 to 40.11. Furthermore, qFT12‐2 explained more than 10% of the phenotypic variation in three environments. Based on these results, we chose the major QTL qFT12‐2 for further analysis.

Glyma.12G073900 is the candidate gene for qFT12‐2

qFT12‐2 was delimited to a 636‐kb region between markers Chr12‐5445349 and Chr12‐6081748 on chromosome 12, which harboured 47 genes according to the Williams 82 reference genome (Figure 1a, b, Table S6). One of these genes, Glyma.12G073900 was homologous to APRR7, which was confirmed to participate in the circadian clock‐controlled flowering pathway in Arabidopsis (Nakamichi et al., 2010; Nakamichi et al., 2005). In addition, homologous genes in other crops have also been shown to regulate photoperiodic flowering (Beales et al., 2007; Gao et al., 2014; Koo et al., 2013; Liu et al., 2018a; Murphy et al., 2011; Turner et al., 2005; Yan et al., 2013). Recently, a major QTL qFT12‐1, overlapping with qFT12‐2 identified in our study, was mapped to a 56.4‐kb region, harbouring only four annotated genes, of which the Arabidopsis PRR7 homologue Glyma.12G073900 was confirmed to be the strongest candidate gene for qFT12‐1 (Li et al., 2019b). This suggested that Glyma.12G073900 was the likely candidate gene underlying qFT12‐2.

Figure 1.

Figure 1

Mapping and subsequent cloning of the flowering time QTL qFT12‐2. (a) Chromosome 12 harbours a major QTL, qFT12‐2, identified via QTL mapping using the flowering time data for the ZGDD × HH27 RIL population grown under eight environments (SY17, XT17, XX16, XX17, JN16, BJ16 and BJ17) and using BLUP values. BLUP values of flowering time for each line were obtained across eight environments. (b) The 636‐kb genomic region between markers Chr12‐5445349 and Chr12‐6081748 in the Williams 82 reference genome contains 47 predicted genes. (c) Allelic variation in the candidate gene Glyma.12G073900 between ZGDD and HH27. (d) Comparison of the Glyma.12G073900 sequence in ZGDD and HH27. The arrowhead indicates the position of the non‐sense mutation in HH27. An asterisk indicates the termination of translation.

Sequence analysis of Glyma.12G073900 in the RIL parents

We cloned and sequenced the genomic region of Glyma.12G073900 in the two parents. Analysis of the 16 508 bp Glyma.12G073900 sequence, which included 2554 bp of sequence upstream of the start codon, the 12 968 bp predicted coding region and 986 bp of the 3′ UTR, revealed 18 SNPs and one insertion/deletion polymorphism between ZGDD and HH27 (Figure 1c). One SNP in exon 6 results in variation at the 378th amino acid (glutamine in ZGDD and lysine in HH27). A non‐sense mutation (C1879T) in exon 8 of Glyma.12G073900 was identified in HH27, resulting in premature termination of translation after 626 amino acids, whereas the Glyma.12G073900 protein of ZGDD is predicted to be 789 amino acids in length (Figure 1c, d). Moreover, this non‐sense mutation causes the loss of the CCT domain (Figure S3d), which functions in nuclear localization in CONSTANS family proteins (Robson et al., 2001). We also genotyped the non‐sense variant (C1879T, Chr12‐5520945) in the RIL population using Kompetitive allele specific PCR (KASP). Among three markers (Chr12‐5502184, Chr12‐5520945 and Chr12‐6081748) within the qFT12‐2 interval, Chr12‐5520945 was the most strongly associated with flowering time across all environments except SY16 (P < 0.01) (Figure S4). These findings support the inference that Glyma.12G073900 is the candidate gene responsible for the qFT12‐2 QTL.

In phylogenetic analysis, Glyma.12G073900 showed slightly higher amino acid sequence similarity with APRR3 than APRR7 (Figure S3a). The N‐terminal response‐regulator receiver domain and the C‐terminal CCT domain are conserved between the PRRs and ZGDD Glyma.12G073900 (Figure S3b,d). However, Glyma.12G073900 in ZGDD contains an EAR motif (LxLxL), which is required for the repressive activity of three APRR proteins (APRR9/7/5) and is not conserved in APRR3 (Figure S3c). Therefore, we hereafter refer to Glyma.12G073900 as GmPRR37.

GmPRR37 displays a constitutive and diurnal expression pattern

The 2370 bp coding sequence (CDS) of GmPRR37 was cloned from the late‐flowering cultivar ZGDD. We examined the expression levels of GmPRR37 in different organs (root, hypocotyl, unifoliate leaf, trifoliolate leaf, stem and shoot apex) of SD‐ and LD‐treated ZGDD plants on day 14 of the photoperiod treatment. Under both LD and SD (LD, 16 h: 8 h, light: dark; SD, 12 h: 12 h, light: dark) conditions, GmPRR37 was primarily expressed in unifoliate and trifoliolate leaves and had lower expression levels in the other tissues (Figure 2a). We also investigated the diurnal expression pattern of GmPRR37 in trifoliolate leaves throughout the course of days 10 and 11 (13 time points). Under both LD and SD conditions, GmPRR37 showed diurnal expression that peaked in the afternoon ~8 h after the lights were turned on (Figure 2b), indicating that GmPRR37 expression is modulated by the circadian clock. A previous study revealed that the OsPRR37 transcript exhibits a diurnal pattern in leaves with a maximum at Zeitgeber 8 under both SD and LD conditions (Gao et al., 2014), indicating that GmPRR37 may function similarly to OsPRR37 in flowering regulation.

Figure 2.

Figure 2

Expression pattern of GmPRR37. (a) Expression levels of GmPRR37 in different organs of ZGDD plants on day 14 after commencing long‐day (LD, 16 h: 8 h, light: dark) or short‐day (SD, 12 h: 12 h, light: dark) treatment. Samples were collected 8 h after the lights were turned on. (b) Expression levels of GmPRR37 in trifoliate leaves of ZGDD throughout a 48‐h period on days 10 and 11 of LD or SD treatment. The relative expression levels are normalized to GmActin. The data are means ± SE of three biological replicates.

CRISPR/Cas9‐induced Gmprr37 mutants exhibit early flowering phenotype

To determine whether the mutation in the GmPRR37 candidate gene is responsible for flowering time, we used the CRISPR/Cas9 system to generate targeted mutagenesis of the GmPRR37 in soybean cultivar ZGDD and Gmprr37 in Jack. Sequence analysis showed that Jack and HH27 had an identical non‐sense mutation resulting in premature termination of the predicted GmPRR37 protein compared with ZGDD. The target site (named GmPRR37‐CP) in the first exon of GmPRR37 (ZGDD) and Gmprr37 (Jack) was chosen (Figure S5a), and the mutants induced by CRISPR/Cas9 for the two cultivars were respectively named Gmprr37‐ZGDD (1‐bp deletion) and Gmprr37‐Jack (11‐bp deletion) (Figure S5b,c,d,e). In the T2 generation, homozygous Gmprr37‐ZGDD mutants induced by CRISPR/Cas9 displayed 15.8 days earlier in flowering time compared with WT (ZGDD) under NLD conditions (23rd June‐5th October, 2019) in Beijing, China (39°57′ N, 116°19′ E) (Figure 3a,b). However, the flowering times of the Gmprr37‐ZGDD mutants were basically the same as WT plants under SD (12 h: 12 h, light: dark) conditions: 25.8 ± 1.2 DAE for Gmprr37‐ZGDD mutants vs. 24.2 ± 1.9 DAE for WT (Figure 3c). We also examined the flowering time of WT (Jack) plants and Gmprr37‐Jack mutants under both SD and LD (SD, 12 h: 12 h, light: dark; LD, 16 h: 8 h, light: dark) conditions, the flowering time of Gmprr37‐Jack mutants were almost the same as WT plants: 24.1 ± 1.1 DAE for Gmprr37‐Jack mutants vs. 24.2 ± 1.4 DAE for WT under SD conditions and 55.8 ± 1.8 DAE for Gmprr37‐Jack mutants vs. 56.6 ± 2.3 DAE for WT under LD conditions (Figure 3d,e). These results verify that GmPRR37 is the gene for the qFT12‐2 QTL and suppresses flowering under LD conditions.

Figure 3.

Figure 3

Phenotypes of the CRISPR/Cas9‐induced Gmprr37 mutants. (a) Images of WT (cv ZGDD) and homozygous T2 Gmprr37 mutants under natural long‐day conditions (NLD, 23rd June‐5th October) in Beijing, China (39°57′N, 116°19′E) (middle panel). A magnified view of the area in the red box is shown in the left and right panel. (b) Flowering time (days) of WT (cv ZGDD) plants and homozygous Gmprr37‐ZGDD mutants under NLD conditions. (c) Flowering time (days) of WT (cv ZGDD) plants and homozygous Gmprr37‐ZGDD mutants under SD (12 h: 12 h, light: dark) conditions. (d) Flowering time (days) of WT (cv Jack) plants and homozygous Gmprr37‐Jack mutants under LD (16 h: 8 h, light: dark) conditions. (e) Flowering time of WT (cv Jack) plants and homozygous Gmprr37‐Jack mutants under SD (12 h: 12 h, light: dark) conditions. The exact numbers of individual plants are shown. The flowering time is shown as the mean ± standard deviation, and statistical significance was determined using Student's t tests: **, P < 0.01.

Overexpression of GmPRR37 in soybean delays flowering

For further verification of the role of GmPRR37 in flowering time control, we generated a construct containing the CDS of ZGDD GmPRR37 driven by the CaMV35S promoter and transformed it into the soybean cultivar Jack. Under NLD conditions (23rd July‐27th August) in Beijing, China (39°57′ N, 116°19′ E), the flowering times of three independent transgenic lines were significantly delayed by 3.6, 5.5 and 4.4 days compared with the recipient parent Jack (P < 0.01) (Figure 4a, b, c). Furthermore, under LD (16 h: 8 h, light: dark) conditions, the three transgenic lines flowered 4.1, 5.1 and 2.5 days later than the wild‐type (WT) plants (P < 0.01) (Figure 4e,f,g). However, the GmPRR37 transgenic line 1 (22.7 ± 0.8 day after emergence, DAE), line 2 (23.6 ± 0.9 DAE) and line 3 (22.8 ± 0.9 DAE) flowered at the same time as WT (22.2 ± 0.7 DAE) under SD (12 h: 12 h, light: dark) conditions (Figure 4d). These results further confirm that GmPRR37 is the correct qFT12‐2 candidate gene and also acts as a flowering suppressor in soybean, especially under LD conditions.

Figure 4.

Figure 4

Phenotypes of the GmPRR37 transgenic soybean plants. (a) Images of WT (cv Jack) and GmPRR37 overexpression line 2 plants under natural long‐day conditions (NLD, 23rd July‐27th August) in Beijing, China (39°57′ N, 116°19′ E) (upper panel). A magnified view of the area in the red box is shown in the lower panel. (b) Flowering times of three GmPRR37 overexpression lines and wild‐type (WT) plants under NLD conditions. The exact numbers of individual plants are shown. The flowering time is shown as the mean ± standard deviation, and statistical significance was determined using Student's t tests: **, P < 0.01. (c) Expression levels of GmPRR37 in leaves at 25 DAE (day after emergence) under NLD conditions. Error bars indicate the SE values of three replications, and statistical significance was determined using Student's t tests: **, P < 0.01. (d) Flowering times of three GmPRR37 overexpression lines and WT plants under SD (12 h: 12 h, light: dark) conditions. (e) Images of WT and GmPRR37 overexpression Line 2 plants under LD (16 h: 8 h, light: dark) conditions (upper panel), and a close‐up view of the areas framed by the red boxes (lower panel). (f) Flowering time (days) of three GmPRR37 overexpression lines and WT plants under LD conditions. Flowering time is shown as the mean ± standard deviation, and statistical significance was determined using Student's t tests: **, P < 0.01. (g) Expression levels of GmPRR37 in leaves at 35 DAE under LD conditions. Error bars indicate the SE values of three replications, and statistical significance was determined using Student's t tests: **, P < 0.01.

GmPRR37 delays flowering time by promoting GmFT1a and suppressing GmFT2a and GmFT5a under LD conditions

To investigate the relationship between GmPRR37 and genes involved in photoperiodic flowering, we examined the expression of GmFT1a, GmFT2a, GmFT5a, J (GmELF3), E2 (GmGIa), GmCOL1a and GmCOL1b, which are known to play key roles in photoperiod‐controlled flowering pathway, in CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants, Gmprr37‐Jack mutants and transgenic plants overexpressing GmPRR37 under LD and SD conditions. The results indicated that GmFT2a and GmFT5a expression were significantly up‐regulated and GmFT1a expression was down‐regulated in the Gmprr37‐ZGDD mutants under LD (13.5 h: 10.5 h, light: dark) conditions (Figure 5a). Meanwhile, the expression of GmELF3, GmGIa, GmCOL1a and GmCOL1b was not affected in the Gmprr37‐ZGDD mutants under LD conditions (Figure 5a). Whereas all the seven genes expression were not altered in the Gmprr37‐ZGDD mutants under SD (12 h: 12 h, light: dark) conditions (Figure 5b). As shown in Figure S6, the expression levels of these seven genes were not affected in the Gmprr37‐Jack mutants, findings consistent with no significant phenotypic alterations in flowering time observed under both SD and LD (SD, 12 h: 12 h, light: dark; LD, 16 h: 8 h, light: dark) conditions (Figure 3d, e).

Figure 5.

Figure 5

Expression levels of flowering‐related genes in leaves of the WT plants, CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants and transgenic plants overexpressing GmPRR37 under LD and SD conditions. (a) Expression analysis in the WT plants (cv ZGDD) and CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants under LD (13.5 h: 10.5 h, light: dark) conditions. (b) Expression analysis in the WT plants (cv ZGDD) and CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants under SD (12 h: 12 h, light: dark) conditions. (c) Expression analysis in the WT plants (cv Jack) and GmPRR37 overexpression line 2 under LD (16 h: 8 h, light: dark) conditions. (d) Expression analysis in the WT plants (cv Jack) and GmPRR37 overexpression line 2 under SD (12 h: 12 h, light: dark) conditions. Relative transcript levels of these genes were normalized to GmActin. Error bars indicate the SE values of three replications. Statistical significance was determined using Student's t tests: **, P < 0.01.

Compared with WT plants, the expression of flowering‐inhibiting gene GmFT1a was significantly higher, and the flowering‐promoting gene GmFT2a and GmFT5a were significantly lower in the leaves of the GmPRR37 overexpression plants under LD (16 h: 8 h, light: dark) conditions (Figure 5c). The expression levels of GmELF3, GmGIa, GmCOL1a and GmCOL1b were similar between overexpression line 2 and WT under LD conditions (Figure 5c). Under SD (12 h: 12 h, light: dark) conditions, the expression levels of these seven genes were not affected in the GmPRR37 overexpression plants (Figure 5d). The results of these LD and SD experiments demonstrate that GmPRR37 functions as a repressor of GmFT2a and GmFT5a, and an activator of GmFT1a to delay flowering in LD conditions.

Geographical distribution of naturally occurring alleles and haplotypes

To evaluate the effect of mutations in GmPRR37 on soybean adaptation, we determined the genotypes of 180 re‐sequenced soybean cultivars that have been conventionally cultivated in China (Table S7). We found five SNPs and one indel in the full‐length Glyma.12g073900 sequence (Gm12:5508365‐5522772). SNPs S1 and S2, and indel S3 are intron variants, SNP S6 is a 3′ UTR variant, SNP S4 is a mis‐sense variant (Lys to Gln) and SNP S5 is a non‐sense variant (Figure 6a). Only two SNPs (S4 and S5) are located in the CDS. All six polymorphisms coincide with those identified between the RIL parents HH27 and ZGDD (Figure 1c). Based on the polymorphisms, we found one nonfunctional variant, Gmprr37, and two functional variants GmPRR37‐1 and GmPRR37‐2 (Figure 6a, Table S7). Among the 180 cultivars, Gmprr37 was the most widely distributed and was significantly associated with earlier flowering time compared with GmPRR37‐1 and GmPRR37‐2 (Figure 6b). The allele frequency of the functional variants (GmPRR37‐1 and GmPRR37‐2) declined from 13.51% in South China cultivars to 4.35% in Yellow‐Huai‐Hai Region cultivars and 1.03% in Northeast China cultivars. Furthermore, no cultivars harboured GmPRR37 in the northern‐limit regions (from 40.45°N to 53°N) in China (Figure 6c). We have shown that overexpression of GmPRR37 can significantly delay soybean flowering under long photoperiod conditions (Figure 4). Taken together, the effect of the functional variants on delayed flowering was gradually enhanced with the increase of day length from low to high latitudes; thus, germplasms with dominant alleles were artificially excluded during soybean cultivar improvement in higher latitudes in China. These findings indicate that natural variations in GmPRR37 play an important role in soybean adaptation from low to high latitudes, and especially in the ability of soybean cultivars to grow in higher latitude regions with long photoperiods.

Figure 6.

Figure 6

Identification of haplotypes in soybean cultivars. (a) Natural variation in nucleotide sequence of GmPRR37 in soybean cultivars. (b) Flowering time (days) of cultivars with different GmPRR37 alleles. Statistical significance was determined using Student's t tests: **, P < 0.01. (c) Geographical distribution of different haplotypes in China. BLUP values for flowering time for each cultivar were used for statistical analysis.

Discussion

GmPRR37 is responsible for qFT12‐2 in soybean

Flowering time is a critical determinant of the regional adaptation of soybean. Previous studies have uncovered a number of flowering‐time loci, which are catalogued in SoyBase (http://soybase.org/). In the current study, qFT12‐2, a major effect QTL controlling flowering time, was identified across different photoperiodic environments using 308 RILs derived from a cross between the late‐flowering soybean cultivar ZGDD and the early‐flowering soybean cultivar HH27 (Figure 1a). Our comparative analysis showed that qFT12‐2 overlapped with the recently reported QTL qFT12.1 uncovered by linkage analysis (Liu et al., 2018b) and the locus SAL10 identified in a GWAS study (Fang et al., 2017). Bioinformatics analysis revealed that GmPRR37, a homologue of PRRs, which have been demonstrated to act as regulators of photoperiod flowering in various plant species (Beales et al., 2007; Gao et al., 2014; Koo et al., 2013; Liu et al., 2018a; Murphy et al., 2011; Nakamichi et al., 2010; Turner et al., 2005; Yan et al., 2013), was a strong candidate gene for qFT12‐2 (Figure 1, Figure S3, Table S6). GmPRR37 from the RIL parent HH27 carries a non‐sense mutation that leads to the deletion of the CCT domain in the encoded protein (Figure S3d). Functional GmPRR37 alleles were strongly associated with late‐flowering time in conventionally cultivated germplasms (Figure 6b). To further investigate the function of GmPRR37, genetic transformation was conducted in soybean. We found that overexpression of GmPRR37 in soybean significantly delayed flowering time, and CRISPR/Cas9‐induced Gmprr37 mutants exhibited early flowering under long photoperiod conditions (Figures 3 and 4). The results from linkage, bioinformatics and transgenic transformation analysis support the conclusion that GmPRR37 is the causal gene of qFT12‐2.

GmPRR37 acts as a suppressor in an LD‐dependent flowering pathway

Overexpression of OsPRR37 in rice significantly delays flowering time (Liu et al., 2018a), and Osprr37 mutants show reduced photoperiod sensitivity and flower earlier than WT (Koo et al., 2013). However, in Arabidopsis, mutants of APRRs are associated with late flowering (Murakami et al., 2004; Nakamichi et al., 2005). These findings suggest that there is functional differentiation of PRRs between LD and SD plants.

In this study, CRISPR/Cas9‐induced Gmprr37‐ZGDD mutants showed significantly early flowering under NLD conditions, but the flowering time was almost the same between Gmprr37‐ZGDD mutants and WT plants under SD conditions (Figure 3). Transgenic overexpression of GmPRR37 significantly delayed flowering under long photoperiod conditions, while the GmPRR37 overexpression lines showed no alteration in flowering time under SD conditions (Figure 4). These results suggest that GmPRR37 acts as a suppressor in LD‐dependent flowering pathway in soybean. Under LD conditions, GmPRR37 down‐regulates the expression of the flowering‐promoting FT homologues GmFT2a and GmFT5a (Figure 5). Similarly, OsPRR37 acts as a LD‐specific suppressor of rice florigen (Hd3a) and a rice‐specific flowering integrator (Ehd1) (Gao et al., 2014; Yan et al., 2013), and its activity is gradually enhanced with increased day length, causing a more significant delay in rice flowering (Gao et al., 2014). Furthermore, GmPRR37 exhibits the same diurnal expression pattern as OsPRR37 in rice, which is regulated by the circadian clock under both LD and SD conditions (Gao et al., 2014). Whereas, GmPRR37 up‐regulates the expression of the flowering‐inhibiting FT homologue GmFT1a, which has opposite roles of flowering‐promoting genes GmFT2a/5a (Liu et al., 2018c). This finding demonstrates that GmPRR37 confers an expanded regulation mechanism of circadian clock on photoperiodic flowering pathways in soybean. Our insights into GmPRR37 will facilitate the investigation and characterization of the circadian clock and photoperiodic flowering in soybean.

GmPRR37 provides an opportunity to improve soybean adaptation to diverse geographic regions and farming systems

Soybean is cultivated worldwide in a broad range of latitudes, although each cultivar is restricted to a relatively narrow latitude range. This wide distribution of soybean species results from rich natural variations and different combinations of genes and QTLs controlling flowering time. For example, natural mutants of GmELF3 (Yue et al., 2017) and ft2aft5a double mutants created by CRISPR/Cas9 (Cai et al., 2020) can improve soybean adaptation to tropical and low‐altitude regions, whereas natural variations in GmGBP1 are associated with soybean ecological adaptation to high latitudes (Zhao et al., 2018). Various combinations of mutations at the E loci (E1, E2, E3 and E4) provided considerable genetic plasticity that contributed to soybean cultivation at diverse latitudes (Jiang et al., 2014; Tsubokura et al., 2014).

In the current study, we found that one nonfunctional variant Gmprr37, which is significantly associated with early‐flowering time, has contributed to soybean adaptation to higher latitude regions (Figure 6). CRISPR/Cas9‐mediated targeted mutagenesis of Gmprr37 mutants in a very late‐flowering soybean cultivar ZGDD displayed early flowering by about 15.8 days under NLD conditions (Figure 3). It is conceivable that the CRISPR/Cas9 system can be employed to knockout GmPRR37 in late‐flowering soybean cultivars and thus enable these cultivars to be introduced to higher latitudes or planted in spring in multiple cropping systems. Transgenic overexpression of GmPRR37 significantly delayed flowering and maturation when sown in summer of Beijing (Figure 4); thus, GmPRR37 could be used to breed cultivars with longer growth period in temperate region. Furthermore, flowering was significantly delayed in GmPRR37 backgrounds with various E loci genotypes compared with Gmprr37 (Figure S6). Our identification of GmPRR37 may provide opportunities to breed highly optimized cultivars with flexible adaptation to specific regions and farming systems.

We also investigated whether flowering time variations could be attributed to haplotype combinations of GmPRR37, E1, E2, FT5a, FT2a and E3 (genes underlying qFT12‐2, qFT6, qFT10, qFT16‐1, qFT16‐2 and qFT19, respectively) in the RIL population and found that haplotype combinations of these loci could explain 63.73%, 81.69%, 76.41%, 82.13%, 33.59%, 73.55%, 74.49% and 81.16% of the flowering time variations in SY16, XX16, JN16, BJ16, SY17, XT17, XX17 and BJ17, respectively (Table S5). Notably, allelic combinations of these loci can explain a much larger percentage of variation in flowering time under the six environments with relatively longer daylengths (BJ16, BJ17, XX16, XX17, JN16 and XT17) but explain a substantially lower percentage of variance in the other two environments with SD conditions (SY16 and SY17). These observations indicate that selection of specific haplotype combinations of these genes could improve the regional fitness of soybean, especially under LD conditions. Further efforts to comprehensively analyse the respective contribution and allelic combinations of GmPRR37, classical E genes and other genetic loci controlling flowering time would facilitate the rational design of soybean cultivars with optimum adaptation to target photoperiod environments.

In summary, through map‐based cloning, genetic transformation and diversity analyses, we find that GmPRR37 acts as a floral repressor under long photoperiod conditions and has contributed to soybean ecological adaption. Phylogenetic analysis showed that there are 14 soybean orthologs of Arabidopsis PRR genes. The expression patterns of GmPRR37 showed a clear circadian rhythm. Therefore, we speculate that GmPRRs might play an important role in the circadian clock and photoperiod flowering in soybean. The findings of this study can facilitate the breeding of soybean adapted to diverse geographic regions and multiple farming systems.

Experimental procedures

RIL population construction and phenotypic analysis

A F6:7 recombinant inbred line (RIL) population derived from a cross between the very late‐flowering soybean cultivar ZGDD belonging to maturity group (MG) VIII and the extremely early‐flowering soybean cv HH27 (MG 0) were created using the single‐seed descent method. The cross was developed under SD conditions, followed by successive self‐pollination until the F6 generation in Sanya (Hainan province, China) (18°18′N, 109°30′E), which has short photoperiods. A set of 308 RILs along with the parents were planted during 2016 and 2017 at five locations in Beijing (40°13′N, 116°33′E) on July 3, 2016 and June 17, 2017, in Xinxiang (Henan province, China) (35°08′N, 113°45′E) on July 5, 2016 and June 22, 2017, in Sanya (Hainan province, China) (18°18′N, 109°30′E) on December 19, 2016 and March 18, 2017, in Jining (Shandong province, China) (35°27′N, 116°34′E) on July 3, 2016 and in Xiangtan (Hunan province, China) (27°40′N, 112°39′E) on June 20, 2017. Each location and year combination was considered as an experimental environment, and these eight environments were named BJ16, BJ17, XX16, XX17, SY16, SY17, JN16 and XT17, respectively. The RILs and parents were planted in a 1.5 m row, with 0.5 m separating rows and a space of 0.1 m between adjacent plants. All lines were arranged in a randomized complete block design with two replications. The flowering time of five plants was investigated in each replication. Flowering time was calculated as the period from emergence (VE) to beginning bloom (R1) as previously described (Fehr et al., 1971).

The flowering‐time phenotype in a single environment was determined by taking the average for each family from two replications. To eliminate the influence of environmental effects on phenotypic variation, best linear unbiased predictor (BLUP) values of flowering time for each line were obtained across eight environments using a mixed linear model with the fitting of both genotype and environment as random effects using the R package ‘lme4’ (R Core Team, 2013).

DNA extraction and genotyping

Genomic DNA was extracted and purified from the newly expanded trifoliate leaves of each of the parents and the 308 RILs using the Plant Genomic DNA Kit (Tiangen Biotech, Beijing, China). The 2b‐RAD libraries were prepared for the 310 samples as previously described (Wang et al., 2012). Raw reads were trimmed to remove adaptor sequences, and the 3′ terminal positions of each read were eliminated. Reads with no restriction sites or containing ambiguous bases (N), low‐quality positions (>20% nucleotides with a Phred quality score <20), or long homopolymer regions (>8%) were removed. High‐quality reads were aligned using the SOAP software v2.21 (Li et al., 2009). A maximum of two mismatches (–v 2) were allowed for each read, and those mapped onto more than one position in the genomic reference sequence were excluded (–r 0). The match mode was set to ‘find the best hits’ (–M 4). The SNPs were filtered with the RADtyping program v1.0 (Fu et al., 2013) using the following criteria: (1) Polymorphic loci with more than two alleles were deleted; (2) segregating markers that could be genotyped in at least 80% of the individuals were kept for analysis; (3) all SNPs with a minor allele frequency (MAF) < 0.05 were removed; and (4) only one bi‐allelic SNP at each locus was retained.

Genetic map construction and QTL analysis

Based on the genotypic data for 308 RILs, a genetic map with 20 linkage groups was constructed using the Kosambi mapping function of the Joinmap v4.1 software (Stam, 1993). The LOD threshold was set as 5.0 to determine the genetic position of each marker.

The additive QTLs for flowering time were detected using inclusive composite interval mapping of additive functionality (ICIM‐ADD) in the QTL IciMapping software v4.1 (Li et al., 2008; Meng et al., 2015). Missing phenotypes were deleted, and a 1 cM walk speed with a stepwise regression probability of 0.001 was used for QTL detection. The LOD value threshold for evaluating the significant QTLs was determined using 1,000 permutations at the 0.05 significance level. Thus, a LOD score of 3.29 was set to define the presence of a QTL. QTL designations were defined adopting the previously reported nomenclature (McCouch et al., 1997).

Analysis of diurnal expression patterns

For analysis of the expression pattern of GmPRR37, the soybean cultivar ZGDD was grown under SD (12 h: 12 h, light: dark) and LD (16 h: 8 h, light: dark) photoperiods. After entraining for 14 days, different organs (root, hypocotyl, unifoliate leaf, stem, trifoliolate leaf and shoot apex) were sampled in bulk from three plants for each treatment and then stored in liquid nitrogen. We also collected trifoliolate leaves at 4‐h intervals for a total of 48 h on days 10 and 11 of LD or SD treatment..

RNA extraction, reverse transcription and quantitative real‐time PCR

For reverse transcription and quantitative real‐time PCR, total RNA was isolated from different tissues using the Trizol Up Plus RNA Kit (Tiangen Biotech). cDNAs were synthesized with Superscript II reverse transcriptase (TransGen Biotech). The qRT‐PCR was performed using the ABI7900 system (Applied Biosystems). The PCR reactions contained 1 μL of 1:5 diluted cDNA, 0.2 μL of gene‐specific primers, 0.2 μL of 50× ROX High Reference Dye, 5 μL of 2 ×KAPA SYBR® FAST qPCR Master Mix (KAPA Biosystems) and water to a final volume of 10 μL. The PCR cycling conditions were as follows: 95 °C for 30 min followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Three biological replicates were performed for each reaction, and the qRT‐PCR data were analysed using SDS2.3 software. The primers used for real‐time quantitative PCR are listed in Table S8.

Transformation of CRISPR/Cas9 in soybean

The CRISPR/Cas9 system was employed to knockout soybean GmPRR37 and Gmprr37. The target site (referred to here as GmPRR37‐CP) in the first exon of GmPRR37 and Gmprr37 was selected (Figure S5a) using the web tool CRISPR‐P V2.0 (Liu et al., 2017). Pairs of DNA oligonucleotides of the sgRNAs were synthesized by TSINGKE and annealed to generate dimers, which were subsequently integrated into the CRISPR/Cas9 expression vector as previously reported (Cai et al., 2018). The vector was then transformed into Agrobacterium tumefaciens strain EHA105 via electroporation. The soybean cultivar ZGDD (GmPRR37) and Jack (Gmprr37) were used for transformation according to the previously reported protocol (Chen et al., 2018). DNA extracted from leaf tissue was used to examine CRISPR/Cas9‐induced mutations at the target sites using PCR with the forward primer (5′‐GCGCTGACTTGACTGATGGATA‐3′) and reverse primer (5′‐ACAACATGGCGTGTCGAATC‐3′) and DNA sequencing analysis. Wild‐type ZGDD and its homozygous Gmprr37 mutants induced by CRISPR/Cas9 were sown under NLD conditions in Beijing, China (39°57′ N, 116°19′ E) on 23 June 2019 and under SD (12 h: 12 h, light: dark) conditions. Wild‐type Jack and the homozygous Gmprr37 mutants were grown under SD (12 h: 12 h, light: dark) and LD (16 h: 8 h, light: dark) photoperiodic conditions. The flowering time of each plant was recorded as days from VE to R1 as previously described (Fehr et al., 1971). Data are shown as mean values ± one standard deviation, and Student's t tests were used to assess the significance of differences between lines.

Transgenic overexpression in soybean

For construction of the overexpression vector, the coding region of GmPRR37 from ZGDD, the HindIII and SpeI restriction sites and an additional 15 bp of the Sp1300‐GFP vector adjacent to restriction sites were PCR‐amplified. The primers are listed in Table S8. GmPRR37 was cloned into the HindIII‐SpeI sites of the Sp1300‐GFP vector using the pEASY‐Uni Seamless Cloning and Assembly Kit (TransGen Biotech). From the resultant vector, an XbaI‐SalI fragment containing the GmPRR37::GFP cassette was isolated and then inserted into the plant binary vector pTF101.1. GmPRR37::GFP expression was driven by a 2× CaMV 35S promoter. The final plasmid was introduced into Agrobacterium tumefaciens strain EHA101 and ultimately transformed into soybean cv ‘Jack’ following the cotyledon‐node method (Chen et al., 2018). Transgenic plants were identified by daubing leaves with 160 mg/L glufosinate and detecting PAT proteins using Liberty Link strips. Putative transgenics were then subjected to molecular and phenotypic analysis. All transgenic and WT Jack plants were grown under SD (12 h: 12 h, light: dark), LD (16 h: 8 h, light: dark) and NLD (23rd July‐ 27th August, 2018, Beijing) conditions. The flowering time of each plant was recorded as days from VE to R1 as previously described (Fehr et al., 1971). Data are shown as mean values ± one standard deviation, and Student's t tests were used to assess the significance of differences between lines.

Haplotype analysis of GmPRR37

A diverse panel of 180 soybean cultivars, including 97 cultivars from Northeast China, 46 cultivars from Yellow‐Huai‐Hai, 37 cultivars from South China (Table S7), were re‐sequenced to investigate the natural variation of GmPRR37. These cultivars were chosen because they originated from different ecological regions and had extensive variation in flowering time.

The field trials with the panel of 180 soybean cultivars were performed during 2016 and 2017 at four locations: Beijing in 2016 and 2017, Xinxiang in 2016 and 2017, Jining in 2016 and Xiangtan in 2017, using a randomized complete block design with two replications. Each location and year combination was considered as an experimental environment. Flowering time was calculated as the period from VE to R1 (Fehr et al., 1971). The BLUP value of flowering time for each cultivar was obtained across the six environments and used for further statistical analysis.

Conflict of interest

The authors declare that they have no conflicts of interest.

Author contributions

L.W. performed the experiments and wrote the manuscript. S.S. constructed the RIL population. T.W. and B.J. provided the data for the diverse panel of 180 soybean cultivars. L.L., X.S., J.L. and H.J. performed the phenotypic characterization. Y.C. assisted in soybean transformation. C.W., S.Y. and L.C. revised the manuscript. T.H. and W.H. conceived the research and revised the manuscript.

Supporting information

Figure S1 Frequency distribution of flowering time among 308 RILs in different environments and the distribution of the best linear unbiased predictors (BLUP).

Figure S2 High‐density genetic linkage map for soybean.

Figure S3 Phylogenetic analysis of GmPRR37.

Figure S4 Genetic loci associated with flowering time within the qFT12‐2 interval.

Figure S5 Homozygous targeted mutagenesis of GmPRR37 (ZGDD) and Gmprr37 (Jack) induced by CRISPR/Cas9.

Figure S6 Expression levels of flowering‐related genes in leaves of the WT plants (cv Jack) and CRISPR/Cas9‐induced Gmprr37‐Jack mutants under LD and SD conditions.

Table S1 Flowering times of RILs and parents grown under eight different environments and best linear unbiased predictor (BLUP).

Table S2 Statistics of 2b‐RAD reads and mapping rates of the RILs and parents (sequencing of DNA digested with BsaXI).

Table S3 Statistics of 2b‐RAD reads and mapping rates of the RILs and parents (sequencing of DNA digested with FalI).

Table S4 Description of characteristics of the 20 linkage groups in the high‐density genetic map.

Table S5 Putative QTLs for soybean flowering time identified using an RIL population grown in eight different environments and using BLUP values.

Table S6 Predicted genes located in the mapped 636‐kb genomic region of qFT12‐2 in the Williams 82 reference genome.

Table S7 Haplotypes of GmPRR37 in 180 soybean cultivars from China.

Table S8 Primer sequences used in this study.

PBI-18-1869-s001.pdf (2.3MB, pdf)

Acknowledgements

We gratefully acknowledge Ms Weiwei Yao (CAAS) for her assistance in soybean transformation. This work was supported by the National Key R&D Program of China (2017YFD0101400), China Agriculture Research System (CARS‐04), the CAAS Agricultural Science and Technology Innovation Project and National Natural Science Foundation of China Project No.31601239.

Contributor Information

Wensheng Hou, Email: houwensheng@caas.cn.

Tianfu Han, Email: hantianfu@caas.cn.

References

  1. Beales, J. , Turner, A. , Griffiths, S. , Snape, J.W. and Laurie, D.A. (2007) A pseudo‐response regulator is misexpressed in the photoperiod insensitive Ppd‐D1a mutant of wheat (Triticum aestivum L.). Theor. Appl. Genet. 115, 721–733. [DOI] [PubMed] [Google Scholar]
  2. Bendix, C. , Marshall, C.M. and Harmon, F.G. (2015) Circadian clock genes universally control key agricultural traits. Mol. Plant, 8, 1135–1152. [DOI] [PubMed] [Google Scholar]
  3. Bernard, R. (1971) Two major genes for time of flowering and maturity in soybeans. Crop Sci. 11, 242–244. [Google Scholar]
  4. Blumel, M. , Dally, N. and Jung, C. (2015) Flowering time regulation in crops‐what did we learn from Arabidopsis? Curr. Opin. Biotechnol. 32, 121–129. [DOI] [PubMed] [Google Scholar]
  5. Bonato, E.R. and Vello, N.A. (1999) E6, a dominant gene conditioning early flowering and maturity in soybeans. Genet. Mol. Biol. 22, 229–232. [Google Scholar]
  6. Buzzell, R. (1971) Inheritance of a soybean flowering response to fluorescent‐daylength conditions. Can. J. Genet. Cytol. 13, 703–707. [Google Scholar]
  7. Buzzell, R. and Voldeng, H. (1980) Inheritance of insensitivity to long daylength. Soybean Genet. Newsl. 7, 26–29. [Google Scholar]
  8. Cai, Y. , Chen, L. , Liu, X. , Guo, C. , Sun, S. , Wu, C. , Jiang, B. et al. (2018) CRISPR/Cas9‐mediated targeted mutagenesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol. J. 16, 176–185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cai, Y. , Wang, L. , Chen, L. , Wu, T. , Liu, L. , Sun, S. , Wu, C. et al. (2020) Mutagenesis of GmFT2a and GmFT5a mediated by CRISPR/Cas9 contributes for expanding the regional adaptability of soybean. Plant Biotechnol. J. 18, 298–309. 10.1111/pbi.13199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chen, L. , Cai, Y. , Liu, X. , Yao, W. , Guo, C. , Sun, S. , Wu, C. et al. (2018) Improvement of soybean Agrobacterium‐mediated transformation efficiency by adding glutamine and asparagine into the culture media. Int. J. Mol. Sci. 19, 3039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cober, E.R. and Voldeng, H.D. (2001) A new soybean maturity and photoperiod‐sensitivity locus linked to E1 and T . Crop Sci. 41, 698–701. [Google Scholar]
  12. Cober, E.R. , Molnar, S.J. , Charette, M. and Voldeng, H.D. (2010) A new locus for early maturity in soybean. Crop Sci. 50, 524–527. [Google Scholar]
  13. Fang, C. , Ma, Y. , Wu, S. , Liu, Z. , Wang, Z. , Yang, R. , Hu, G. et al. (2017) Genome‐wide association studies dissect the genetic networks underlying agronomical traits in soybean. Genome Biol. 18, 161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Farre, E.M. and Liu, T. (2013) The PRR family of transcriptional regulators reflects the complexity and evolution of plant circadian clocks. Curr. Opin. Plant Biol. 16, 621–629. [DOI] [PubMed] [Google Scholar]
  15. Farre, E.M. , Harmer, S.L. , Harmon, F.G. , Yanovsky, M.J. and Kay, S.A. (2005) Overlapping and distinct roles of PRR7 and PRR9 in the Arabidopsis circadian clock. Curr. Biol. 15, 47–54. [DOI] [PubMed] [Google Scholar]
  16. Fehr, W. , Caviness, C. , Burmood, D. and Pennington, J. (1971) Stage of development descriptions for soybeans, Glycine Max (L.) Merrill. Crop Sci. 11, 929–931. [Google Scholar]
  17. Fu, X. , Dou, J. , Mao, J. , Su, H. , Jiao, W. , Zhang, L. , Hu, X. et al. (2013) RADtyping: an integrated package for accurate de novo codominant and dominant RAD genotyping in mapping populations. PLoS ONE, 8, e79960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gao, H. , Jin, M. , Zheng, X.M. , Chen, J. , Yuan, D. , Xin, Y. , Wang, M. et al. (2014) Days to heading 7, a major quantitative locus determining photoperiod sensitivity and regional adaptation in rice. Proc. Natl Acad. Sci. USA, 111, 16337–16342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Greenham, K. and McClung, C.R. (2015) Integrating circadian dynamics with physiological processes in plants. Nat. Rev. Genet. 16, 598–610. [DOI] [PubMed] [Google Scholar]
  20. Jiang, B. , Nan, H. , Gao, Y. , Tang, L. , Yue, Y. , Lu, S. , Ma, L. et al. (2014) Allelic combinations of soybean maturity loci E1, E2, E3 and E4 result in diversity of maturity and adaptation to different latitudes. PLoS ONE, 9, e106042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Jung, C.H. , Wong, C.E. , Singh, M.B. and Bhalla, P.L. (2012) Comparative genomic analysis of soybean flowering genes. PLoS ONE, 7, e38250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kong, F. , Liu, B. , Xia, Z. , Sato, S. , Kim, B.M. , Watanabe, S. , Yamada, T. et al. (2010) Two coordinately regulated homologs of FLOWERING LOCUS T are involved in the control of photoperiodic flowering in soybean. Plant Physiol. 154, 1220–1231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kong, F. , Nan, H. , Cao, D. , Li, Y. , Wu, F. , Wang, J. , Lu, S. et al. (2014) A new dominant gene E9 conditions early flowering and maturity in soybean. Crop Sci. 54, 2529–2535. [Google Scholar]
  24. Koo, B.H. , Yoo, S.C. , Park, J.W. , Kwon, C.T. , Lee, B.D. , An, G. , Zhang, Z. et al. (2013) Natural variation in OsPRR37 regulates heading date and contributes to rice cultivation at a wide range of latitudes. Mol. Plant, 6, 1877–1888. [DOI] [PubMed] [Google Scholar]
  25. Li, H. , Ribaut, J.M. , Li, Z. and Wang, J. (2008) Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 116, 243–260. [DOI] [PubMed] [Google Scholar]
  26. Li, R. , Yu, C. , Li, Y. , Lam, T.W. , Yiu, S.M. , Kristiansen, K. and Wang, J. (2009) SOAP2: an improved ultrafast tool for short read alignment. Bioinformatics, 25, 1966–1967. [DOI] [PubMed] [Google Scholar]
  27. Li, M.W. , Liu, W. , Lam, H.M. and Gendron, J.M. (2019a) Characterization of two growth period QTLs reveals modification of PRR3 genes during soybean domestication. Plant Cell Physiol. 60, 407–420. [DOI] [PubMed] [Google Scholar]
  28. Li, Y. , Dong, Y. , Wu, H. , Hu, B. , Zhai, H. , Yang, J. and Xia, Z. (2019b) Positional cloning of the flowering time QTL qFT12‐1 reveals the link between the clock related PRR homolog with photoperiodic response in soybeans. Front. Plant Sci. 10, 1303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liu, B. , Kanazawa, A. , Matsumura, H. , Takahashi, R. , Harada, K. and Abe, J. (2008) Genetic redundancy in soybean photoresponses associated with duplication of the phytochrome A gene. Genetics, 180, 995–1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Liu, H. , Ding, Y. , Zhou, Y. , Jin, W. , Xie, K. and Chen, L.L. (2017) CRISPR‐P 2.0: An improved CRISPR‐Cas9 tool for genome editing in plants. Mol. Plant, 10, 530–532. [DOI] [PubMed] [Google Scholar]
  31. Liu, C. , Qu, X. , Zhou, Y. , Song, G. , Abiri, N. , Xiao, Y. , Liang, F. et al. (2018a) OsPRR37 confers an expanded regulation of the diurnal rhythms of the transcriptome and photoperiodic flowering pathways in rice. Plant Cell Environ. 41, 630–645. [DOI] [PubMed] [Google Scholar]
  32. Liu, D. , Yan, Y. , Fujita, Y. and Xu, D. (2018b) A major QTL (qFT12.1) allele from wild soybean delays flowering time. Mol. Breed. 38, 45. [Google Scholar]
  33. Liu, W. , Jiang, B. , Ma, L. , Zhang, S. , Zhai, H. , Xu, X. , Hou, W. et al. (2018c) Functional diversification of Flowering Locus T homologs in soybean: GmFT1a and GmFT2a/5a have opposite roles in controlling flowering and maturation. New Phytol. 217, 1335–1345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Lu, S. , Zhao, X. , Hu, Y. , Liu, S. , Nan, H. , Li, X. , Fang, C. et al. (2017) Natural variation at the soybean J locus improves adaptation to the tropics and enhances yield. Nat. Genet. 49, 773–779. [DOI] [PubMed] [Google Scholar]
  35. McCouch, S.R. , Cho, Y.G. , Yano, M. , Paul, E. , Blinstrub, M. , Morishima, H. and Kinoshita, T. (1997) Report on QTL nomenclature. Rice Genet. Newsl. 14, 11–13. [Google Scholar]
  36. Meng, L. , Li, H. , Zhang, L. and Wang, J. (2015) QTL IciMapping: integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 3, 269–283. [Google Scholar]
  37. Mouradov, A. , Cremer, F. and Coupland, G. (2002) Control of flowering time: interacting pathways as a basis for diversity. Plant Cell, 14(Suppl), S111–130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Murakami, M. , Yamashino, T. and Mizuno, T. (2004) Characterization of circadian‐associated APRR3 pseudo‐response regulator belonging to the APRR1/TOC1 quintet in Arabidopsis thaliana. Plant Cell Physiol. 45, 645–650. [DOI] [PubMed] [Google Scholar]
  39. Murphy, R.L. , Klein, R.R. , Morishige, D.T. , Brady, J.A. , Rooney, W.L. , Miller, F.R. , Dugas, D.V. et al. (2011) Coincident light and clock regulation of pseudoresponse regulator protein 37 (PRR37) controls photoperiodic flowering in sorghum. Proc. Natl Acad. Sci. USA, 108, 16469–16474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Nakamichi, N. , Kita, M. , Ito, S. , Yamashino, T. and Mizuno, T. (2005) PSEUDO‐RESPONSE REGULATORS, PRR9, PRR7 and PRR5, together play essential roles close to the circadian clock of Arabidopsis thaliana . Plant Cell Physiol. 46, 686–698. [DOI] [PubMed] [Google Scholar]
  41. Nakamichi, N. , Kiba, T. , Henriques, R. , Mizuno, T. , Chua, N.H. and Sakakibara, H. (2010) PSEUDO‐RESPONSE REGULATORS 9, 7, and 5 are transcriptional repressors in the Arabidopsis circadian clock. Plant Cell, 22, 594–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Nakamichi, N. , Kiba, T. , Kamioka, M. , Suzuki, T. , Yamashino, T. , Higashiyama, T. , Sakakibara, H. and et al. (2012) Transcriptional repressor PRR5 directly regulates clock‐output pathways. Proc. Natl Acad. Sci. USA, 109, 17123–17128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Perales, M. and Mas, P. (2007) A functional link between rhythmic changes in chromatin structure and the Arabidopsis biological clock. Plant Cell, 19, 2111–2123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. R Core Team (2013) R: A language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing. https://www.R-project.org/ [Google Scholar]
  45. Ray, J.D. , Hinson, K. , Mankono, J. and Malo, M.F. (1995) Genetic control of a long‐juvenile trait in soybean. Crop Sci. 35, 1001–1006. [Google Scholar]
  46. Robson, F. , Costa, M.M. , Hepworth, S.R. , Vizir, I. , Pineiro, M. , Reeves, P.H. , Putterill, J. and et al. (2001) Functional importance of conserved domains in the flowering‐time gene CONSTANS demonstrated by analysis of mutant alleles and transgenic plants. Plant J. 28, 619–631. [DOI] [PubMed] [Google Scholar]
  47. Samanfar, B. , Molnar, S.J. , Charette, M. , Schoenrock, A. , Dehne, F. , Golshani, A. , Belzile, F. and et al. (2017) Mapping and identification of a potential candidate gene for a novel maturity locus, E10, in soybean. Theor. Appl. Genet. 130, 377–390. [DOI] [PubMed] [Google Scholar]
  48. Satbhai, S.B. , Yamashino, T. , Okada, R. , Nomoto, Y. , Mizuno, T. , Tezuka, Y. , Itoh, T. et al. (2011) Pseudo‐response regulator (PRR) homologues of the moss Physcomitrella patens: insights into the evolution of the PRR family in land plants. DNA Res. 18, 39–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Stam, P. (1993) Construction of integrated genetic linkage maps by means of a new computer package: Join Map. Plant J. 3, 739–744. [Google Scholar]
  50. Sun, H. , Jia, Z. , Cao, D. , Jiang, B. , Wu, C. , Hou, W. , Liu, Y. et al. (2011) GmFT2a, a soybean homolog of FLOWERING LOCUS T, is involved in flowering transition and maintenance. PLoS ONE, 6, e29238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Takeshima, R. , Hayashi, T. , Zhu, J. , Zhao, C. , Xu, M. , Yamaguchi, N. , Sayama, T. et al. (2016) A soybean quantitative trait locus that promotes flowering under long days is identified as FT5a, a FLOWERING LOCUS T ortholog. J. Exp. Bot. 67, 5247–5258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Tsubokura, Y. , Watanabe, S. , Xia, Z. , Kanamori, H. , Yamagata, H. , Kaga, A. , Katayose, Y. et al. (2014) Natural variation in the genes responsible for maturity loci E1, E2, E3 and E4 in soybean. Ann. Bot. 113, 429–441. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Turner, A. , Beales, J. , Faure, S. , Dunford, R.P. and Laurie, D.A. (2005) The pseudo‐response regulator Ppd‐H1 provides adaptation to photoperiod in barley. Science, 310, 1031–1034. [DOI] [PubMed] [Google Scholar]
  54. Wang, S. , Meyer, E. , McKay, J.K. and Matz, M.V. (2012) 2b‐RAD: a simple and flexible method for genome‐wide genotyping. Nat. Methods, 9, 808–810. [DOI] [PubMed] [Google Scholar]
  55. Wang, L. , Kim, J. and Somers, D.E. (2013) Transcriptional corepressor TOPLESS complexes with pseudoresponse regulator proteins and histone deacetylases to regulate circadian transcription. Proc. Natl Acad. Sci. USA, 110, 761–766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Watanabe, S. , Hideshima, R. , Xia, Z. , Tsubokura, Y. , Sato, S. , Nakamoto, Y. , Yamanaka, N. et al. (2009) Map‐based cloning of the gene associated with the soybean maturity locus E3 . Genetics 182, 1251–1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Watanabe, S. , Xia, Z. , Hideshima, R. , Tsubokura, Y. , Sato, S. , Yamanaka, N. , Takahashi, R. et al. (2011) A map‐based cloning strategy employing a residual heterozygous line reveals that the GIGANTEA gene is involved in soybean maturity and flowering. Genetics, 188, 395–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Watanabe, S. , Harada, K. and Abe, J. (2012) Genetic and molecular bases of photoperiod responses of flowering in soybean. Breed. Sci. 61, 531–543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Xia, Z. , Watanabe, S. , Yamada, T. , Tsubokura, Y. , Nakashima, H. , Zhai, H. , Anai, T. et al. (2012) Positional cloning and characterization reveal the molecular basis for soybean maturity locus E1 that regulates photoperiodic flowering. Proc. Natl Acad. Sci. USA, 109, E2155–2164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yan, W. , Liu, H. , Zhou, X. , Li, Q. , Zhang, J. , Lu, L. , Liu, T. et al. (2013) Natural variation in Ghd7.1 plays an important role in grain yield and adaptation in rice. Cell Res. 23, 969–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Yue, Y. , Liu, N. , Jiang, B. , Li, M. , Wang, H. , Jiang, Z. , Pan, H. et al. (2017) A single nucleotide deletion in J encoding GMELF3 confers long juvenility and is associated with adaption of tropic soybean. Mol. Plant, 10, 656–658. [DOI] [PubMed] [Google Scholar]
  62. Zhao, C. , Takeshima, R. , Zhu, J. , Xu, M. , Sato, M. , Watanabe, S. , Kanazawa, A. et al. (2016) A recessive allele for delayed flowering at the soybean maturity locus E9 is a leaky allele of FT2a, a FLOWERING LOCUS T ortholog. BMC Plant Biol. 16, 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Zhao, L. , Li, M. , Xu, C. , Yang, X. , Li, D. , Zhao, X. , Wang, K. et al. (2018) Natural variation in GmGBP1 promoter affects photoperiod control of flowering time and maturity in soybean. Plant J. 96, 147–162. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 Frequency distribution of flowering time among 308 RILs in different environments and the distribution of the best linear unbiased predictors (BLUP).

Figure S2 High‐density genetic linkage map for soybean.

Figure S3 Phylogenetic analysis of GmPRR37.

Figure S4 Genetic loci associated with flowering time within the qFT12‐2 interval.

Figure S5 Homozygous targeted mutagenesis of GmPRR37 (ZGDD) and Gmprr37 (Jack) induced by CRISPR/Cas9.

Figure S6 Expression levels of flowering‐related genes in leaves of the WT plants (cv Jack) and CRISPR/Cas9‐induced Gmprr37‐Jack mutants under LD and SD conditions.

Table S1 Flowering times of RILs and parents grown under eight different environments and best linear unbiased predictor (BLUP).

Table S2 Statistics of 2b‐RAD reads and mapping rates of the RILs and parents (sequencing of DNA digested with BsaXI).

Table S3 Statistics of 2b‐RAD reads and mapping rates of the RILs and parents (sequencing of DNA digested with FalI).

Table S4 Description of characteristics of the 20 linkage groups in the high‐density genetic map.

Table S5 Putative QTLs for soybean flowering time identified using an RIL population grown in eight different environments and using BLUP values.

Table S6 Predicted genes located in the mapped 636‐kb genomic region of qFT12‐2 in the Williams 82 reference genome.

Table S7 Haplotypes of GmPRR37 in 180 soybean cultivars from China.

Table S8 Primer sequences used in this study.

PBI-18-1869-s001.pdf (2.3MB, pdf)

Articles from Plant Biotechnology Journal are provided here courtesy of Society for Experimental Biology (SEB) and the Association of Applied Biologists (AAB) and John Wiley and Sons, Ltd

RESOURCES