KMN-159, a novel EP₄ receptor selective agonist, stimulates osteoblastic differentiation in cultured whole rat bone marrow

Abstract

KMN-159 is the lead compound from a series of novel difluorolactam prostanoid EP₄ receptor agonists aimed at inducing local bone formation while avoiding the inherent side effects of systemic EP₄ activation. KMN-159 is a potent, selective small molecule possessing pharmacokinetic properties amenable to local administration. Unfractionated rat bone marrow cells (BMCs) were treated once at plating with escalating doses of KMN-159 (1 pM to 10 μM). The resulting elevated alkaline phosphatase (ALP) levels measured 9 days post-dose are consistent with increased osteoblastic differentiation and exposure to KMN-159 at low nanomolar concentrations for as little as 30 minutes was sufficient to induce complete osteoblast differentiation of the BMCs from both sexes and regardless of age. ALP induction was blocked by an EP₄ receptor antagonist but not by EP₁ or EP₂ receptor antagonists and was not induced by EP₂ or EP₃ receptor agonists. Addition of BMCs to plates coated with KMN-159 24 days earlier resulted in ALP activation, highlighting the chemical stability of the compound. The expression of phenotype markers such as ALP, type I collagen, and osteocalcin was significantly elevated throughout the osteoblastic differentiation timecourse initiated by KMN-159 stimulation. An increased number of tartrate-resistant acid phosphatase-positive cells was observed KMN-159 or PGE₂ treated BMCs but only in the presence of exogenous receptor activator of nuclear factor kappa-Β ligand (RANKL). No change in the number of adipocytes was observed. KMN-159 also increased bone healing in a rat calvarial defect model with a healing rate equivalent to recombinant human bone morphogenetic protein-2. Our studies show that KMN-159 is able to stimulate osteoblastic differentiation with a very short time of exposure, supporting its potential as a therapeutic candidate for augmenting bone mass.

1. Introduction

Prostaglandin E₂ (PGE₂) is a metabolite of arachidonic acid formed through the actions of cyclooxygenases 1 and 2 (COX-1 and COX-2) and PGE synthase (Narumiya, Sugimoto, & Ushikubi, 1999). It mediates a wide variety of physiological effects in many tissues, among which is bone. It has been known for nearly 50 years that PGE₂ and the related molecule PGE₁ can induce both bone resorption (Klein & Raisz, 1970) and bone formation (Blumenkrantz & Sondergaard, 1972), but the prevailing thought then was that they were primarily pro-resorptive. However, in the early 1980s, PGE₁ was shown to clearly lead to bone formation in humans (Ueda et al., 1980) and subsequently, PGE₂ was shown to induce bone formation in rats (Ueno et al., 1985) and dogs (High, 1987; Marks & Miller, 1988). Since that time, many studies have shown that while PGE₂ can promote both bone resorption and formation, its actions favor formation, thereby leading to increased bone mass and strength (Jee & Ma, 1997; Li, Thompson, & Paralkar, 2007; Vrotsos, Miller, & Marks, 2003). In spite of this, systemic administration of PGE₂ is accompanied by a number of undesirable side effects including vasodilation and flushing, lethargy, and diarrhea limiting its use as a therapeutic agent (Li et al., 2007).

The physiological effects of PGE₂ are mediated through four G protein-coupled receptors (GPCRs) designated EP₁ through EP₄ (Breyer, Bagdassarian, Myers, & Breyer, 2001; Narumiya & Furuyashiki, 2011; Sugimoto & Narumiya, 2007). In 1995, Scutt et al. showed that the PGE₂-mediated transition of non-adherent bone marrow stem cells to adherent, committed osteoblastic precursor cells occurs through a cyclic AMP mechanism, implicating what are now recognized as the EP₂ and EP₄ receptors (Scutt, Zeschnigk, & Bertram, 1995). An early study of EP₂ and EP₄ receptor knockout mice demonstrated that these animals show differential effects on their bone phenotypes (Pan et al., 1998). Use of EP receptor selective antagonists subsequently confirmed that the EP₄ receptor is responsible for the majority of the anabolic action of PGE₂ on bone (Machwate et al., 2001; Weinreb, Grosskopf, & Shir, 1999). Similarly, EP₄ receptor selective agonists induced bone formation both locally and systemically (Cameron et al., 2006; Hagino, Kuraoka, Kameyama, Okano, & Teshima, 2005; Ito et al., 2006; Ke et al., 2006; Ninomiya et al., 2011; Yoshida et al., 2002).

The current therapeutic agents used in clinical applications to generate bone at a specific skeletal site or to aid in local bone repair are primarily protein-based receptor ligands such as recombinant human bone morphogenetic protein-2 (rhBMP-2) and parathyroid hormone or antibodies against proteins such as receptor activator of nuclear factor kappa-B ligand (RANKL) or sclerostin (SOST). As such, they have relatively high cost of goods and have more stringent storage conditions. In addition, the morphogenic activities associated with the BMP protein family have raised safety concerns (James et al., 2016; Tannoury & An, 2014). These factors together limit their widespread use as bone anabolic agents in restorative dental and orthopedic applications. To alleviate these issues in a potential therapeutic, we developed a series of novel small molecule difluorolactam EP₄ receptor agonists (Barrett et al., 2019). These compounds offer good chemical stability, longer anticipated shelf lives, much lower cost of goods when compared to protein-based agents, and as will be shown in the work presented here, potent stimulation of osteogenesis. Other EP₄ receptor agonists including ONO-AE1–329 (Yoshida et al., 2002); ONO-4819 (Hagino et al., 2005; Ito et al., 2006; Tanaka et al., 2004; Toyoda, Terai, Sasaoka, Oda, & Takaoka, 2005; Yoshida et al., 2002); and CP432 (Ke et al., 2006), previously described in the literature, restore bone mass following either local and systemic administration. Our compounds are potent, selective EP₄ agonists that are rapidly cleared, avoiding systemic exposure that causes EP₄ receptor-associated toxicity.

The goal of this work was to characterize the induction of osteoblast differentiation by KMN-159, both in vitro, using total rat bone marrow as a source of osteogenic stem cells, and in vivo using a calvarial defect model. We demonstrate that a single dose of KMN-159 induces typical parameters of osteoblastogenesis in an EP₄-specific manner in vitro without affecting adipogenesis and repairs a rat calvarial defect at a rate equivalent to that of rhBMP-2.

2. Materials and Methods

2.1. Reagents

The Cyclic AMP Select ELISA Kit; Secreted Alkaline Phosphatase (SEAP) Reporter Gene Assay Kit; 3-isobutyl-1-methylxanthine (IBMX); dexamethasone (dex); PGE₂; PGE₁; 11-deoxy-PGE₂; 11-deoxy-PGE₁; 11-deoxy-8-aza-PGE₁; KMN-165; KMN-80; and KMN-159; ONO-8711; PF-04418948; ONO-AE3–208; sulprostone; butaprost; L-ascorbic acid; β-glycerophosphate (βGP), and calcitriol were all obtained from Cayman Chemical Company, Inc. (Ann Arbor, MI). [³H]-PGE₂ was purchased from NEN Radiochemicals (Boston, MA). Cell culture media and reagents were purchased from Gibco (Thermo Fisher Scientific, Waltham, MA)) and fetal calf serum (FCS) was purchased from Atlanta Biologicals (Flowery Branch, GA). para-nitrophenyl phosphate (pNPP) substrate was purchased from Southern Biotech (Birmingham, AL) and RANKL and macrophage colony-stimulating factor (M-CSF) were purchased from PeproTech (Rocky Hill, NJ). The acid phosphatase, leukocyte kit and Oil Red O stain were purchased from Sigma-Aldrich (St. Louis, MO). The GeneJET RNA Purification Kit was purchased from Thermo Fisher Scientific (Waltham, MA); the iScript Reverse Transcription Supermix and SsoAdvanced Universal SYBR Green Supermix were both purchased from BioRad (Hercules, CA); and oligonucleotides were purchased from IDT (Coralville, IA). Recombinant human bone morphogenetic protein-2 (rhBMP-2) was purchased from Invitrogen (Thermo Fisher Scientific, Waltham, MA) and Puros Demineralized Bone Matrix Putty (DBM) was a product of RTI Surgical (Marquette, MI).

2.2. Rat EP₄ receptor binding

The rat EP₄ receptor was expressed in HEK293T cells. Competition binding assays were conducted from 30 nM to 30 pM against [³H]-PGE₂ (180 Ci/mmol), which was held constant at 0.5 nM. Assays were performed in 10 mM 2-(N-morpholino) ethanesulphonic acid (MES) buffer containing 1 mM EDTA and 10 mM MnCl₂, pH 6.0, during a 120 minute incubation at room temperature. The membrane fraction was recovered on glass fiber filters using a cell harvester, and after washing with cold assay buffer solution, radioactivity was measured with a liquid scintillation analyzer. The individual IC₅₀ values were determined using non-linear regression analysis of the binding-concentration curves of 7 to 11 data points (GraphPad Prism 8.1.2 software). The inhibition constants K_i values were calculated using the Cheng Prusoff equation K_i = IC₅₀ / (1 ± L/K_d) where L is the concentration of the ligand in the assay, and K_d is the affinity of the radioligand for the receptor. A Scatchard plot was used to determine K_d.

2.3. Measurement of cyclic 3,5-adenosine monophosphate (cAMP) production

Rat EP₂ and EP₄ receptors were separately expressed in HEK293T cells by reverse transfection on 96-well plates with optimized amounts of cDNA expression constructs immobilized on the surface. Activation of the EP receptors was measured as an increase in cAMP levels using the cAMP Select ELISA kit. Before stimulation with test compounds, cells were incubated in serum-free media containing 0.5 mM IBMX for 30 minutes after which the test compounds were added for an additional 30 minutes.

2.4. Activation of CRE-regulated reporter gene

The rat EP₂ and EP₄ receptors were individually reversed-transfected in HEK-293T/17 cells with a cAMP response element (CRE)-regulated SEAP reporter. Previously optimized amounts of DNA constructs were immobilized on the surface of 96-well plates. Binding of agonists to these EP receptors in the transfected cells initiates a signal transduction cascade through the activation of the adenylate cyclase signaling pathway resulting in the secretion of SEAP into culture media. Media samples were collected 6 to 24 hours after addition of test compounds to the cells. After heat-inactivation of endogenous alkaline phosphatase by incubating at 65°C for 30 minutes, the SEAP reporter gene activity was measured using the SEAP Reporter Gene assay kit. PGE₂ was simultaneously tested as a positive control.

2.5. Animal experiments

Sprague-Dawley rats were purchased from Envigo (Indianapolis, IN). Rats <6 months of age were considered young, while rats >12 months of age were considered old. All experiments were done in compliance with the US National Research Council’s Guide for the Care and Use of Laboratory Animals, the US Public Health Service’s Policy on Humane Care and Use of Laboratory Animals, and Guide for the Care and Use of Laboratory Animals and were reviewed and approved by the IACUC of either Ramapo College of New Jersey or Myometrics LLC.

2.6. Total rat bone marrow cell culture and assays

2.6.1. Total bone marrow cell isolation and plating

Total bone marrow cells (BMCs) were isolated from the tibiae and femora of either young or old female or male Sprague-Dawley rats as indicated. Following harvest, the ends of the bones were removed using Rongeurs forceps and the bone marrow extruded into complete plating medium (MEMα supplemented with 10% FCS and 50 μg/mL gentamicin) using a 21-gauge needle attached to a syringe. The marrow was disrupted by trituration using a serological pipet and then filtered through a 100 μm pore nylon filter (VWR). Cells were diluted 1:10 in phosphate-buffered saline (PBS) and counted using a hemocytometer. Sufficient cells were then diluted in complete plating medium to plate 1.8 × 10⁵ cells/cm² at 0.25 mL medium/cm² and treated one single time at plating with the indicated concentration of compound from 1000x stocks in ethanol.

Cells were immediately plated in (a) 24-well plates for assessment of ALP activity and determination of compound EC₅₀ values (n = 8 wells/concentration); (b) 12-well plates for assessment of mineralization (n = 4 or 6 wells / concentration); or (c) 6-well plates for RNA isolation (n = 3 wells / concentration), and cultured in a humidified incubator (37°C; 5% CO₂). On day 4, complete plating medium supplemented with dex (10 nM final concentration) was added (50% of original plating volume).

2.6.2. rBMC culture for mineralization

For cultures plated for assessment of mineralization or for RNA isolation, beginning on day 7 cells were fed with differentiation medium, consisting of complete plating medium supplemented with ascorbic acid, dex and βGP (final concentrations 100 μg/mL, 10 nM, and 10 mM, respectively) every 3 days.

2.6.3. Receptor specificity using antagonists

To test the effects of blocking the various EP receptors on ALP activity induction using receptor-selective antagonists, cells were incubated in suspension (7.2 × 10⁵ cells/mL) for 30 minutes (37°C; 5% CO₂) with either ONO-8711 (an EP₁-selective antagonist), PF-04418948 (an EP₂ selective antagonist), or ONO-AE3–208 (an EP₄-selective agonist) at a final concentration of 1μM prior to addition of various doses of KMN-159. The cells were then plated into 24-well plates and cultured as described above.

2.6.4. Stability of dry KMN-159

To test the stability of dried KMN-159, the compound was diluted in 100% ethanol in half-log steps and added to 24-well plates (final concentrations 1pM to 1μM). The plates were dried with lids off in a biosafety cabinet overnight. 100% ethanol was added to an equivalent number of wells as vehicle-only controls. The plates were then stored at room temperature, exposed to room light, for 24 days. BMCs were prepared as above and plated into the wells containing the dried compound or vehicle control. Cells were cultured for 9 days, harvested, and assayed for ALP activity (see below).

2.6.5. Time of rBMC exposure to KMN-159

To test the time of exposure to KMN-159 needed to activate osteoblastic differentiation, total BMCs from young female rats prepared as above were treated in suspension with 1μM KMN-159 or 0.1% ethanol vehicle for the indicated times; pelleted by centrifugation for 5 minutes at 200 × g; resuspended in fresh plating medium with no compound at 7.2 × 10⁵ cells/mL; immediately plated in 24-well or 12-well plates as above; and cultured for ALP activity or mineralization endpoints (see below).

2.6.6. Assay for ALP enzyme activity

ALP enzyme activity was determined for all of the experiments described above by lysing the cells growing in 24-well plates on day 9 after plating. Cells were harvested by aspirating the medium, rinsing the wells in PBS, and then adding 0.25 mL/well ALP lysis buffer (150 mM Tris pH8.4, 0.1 mM ZnCl₂, 0.1 mM MgCl₂, 1% Triton X-100). Following a 30-minute incubation at room temperature, plates were stored at −80°C until assayed. ALP activity was measured by incubating 80 μL cell lysate with 50 μL pNPP substrate and reading product formation at 405 nm on a MultiSkanGo plate reader (ThermoFisher).

2.6.7. Determination of cell number and ALP-positive area

To determine cell number, total BMCs were plated on 24-well plates (n = 8 wells each vehicle, 1μM PGE₂, or 1μM KMN-159) and fed on day 4 as above. On days 5, 6, and 7, plates were fixed in cold 100% methanol for 10 minutes and air dried. Plates were stained with DAPI (0.5 μg/mL in PBS) for 10 minutes, rinsed with water, and the number of nuclei in each well was determined using a BioTek Cytation running Gen5 software.

To determine the area occupied by ALP-positive colonies, total BMCs were prepared, plated in 6-well plates with all wells on a plate treated with either vehicle, 1μM PGE₂, or 1μM KMN-159 and fed on day 4 as above. On day 9, cells were fixed in cold 100% methanol for 10 minutes at room temperature and air dried. ALP histochemical staining was performed as described (Owen & Pan, 2008). The ALP positive area for each well was determined using a BioTek Cytation running Gen5 software.

2.6.8. Assay for culture mineralization

Mineralization of the BMC cultures was assessed by von Kossa staining. On day 21 after plating, cells growing in 12-well plates were fixed in 2% paraformaldehyde in PBS for 10 minutes at room temperature, rinsed 3 times with water, and air dried. They were then stained with 5% AgNO₃ in water using 0.5 mL/well followed by 2 cycles of UV light exposure (auto setting in a Stratalinker (Stratagene)). The stained plates were then rinsed extensively with water, air dried, and the von Kossa staining positive area for each well was determined using a BioTek Cytation running Gen5 software.

2.6.9. Assay for osteoclastogenesis

To test the effects of KMN-159 on osteoclastogenesis, total BMCs were prepared as above, except that the final cell concentration was 8 × 10⁵ cells/mL. Cells were treated once at plating with the indicated doses of KMN-159, PGE₂, or vehicle (0.1% ethanol) in phenol red-free MEMα supplemented with 10% FCS and 16 ng/mL each RANKL and M-CSF and plated in 24-well plates (2 × 10⁵ cells/cm²; n = 6 wells). On days 4 and 8, culture medium was replaced with plating medium lacking RANKL and M-CSF but now supplemented with 10 nM calcitriol. On day 14, cultures were fixed for 10 minutes in 2% paraformaldehyde in PBS and stained for tartrate-resistant acid phosphatase (TRAP) enzyme activity. TRAP positive cells were manually counted at 100x final magnification.

2.6.10. Assay for adipogenesis

To test the effects of KMN-159 on adipogenesis, total BMCs were prepared as above, except that the final cell concentration was 1.1 × 10⁶ cells/mL. Cells were treated at plating (and at medium replacement on days 3,6, and 9) with 1μM KMN-159, 1μM PGE₂, or vehicle (0.1% ethanol) in MEMα supplemented with 10% FCS, 10 μg/mL insulin, and 1 μM dex and plated in 24-well plates (5.5 × 10⁵ cells/cm²; n = 8 wells). On day 12, cultures were fixed for 10 minutes in 2% paraformaldehyde in PBS and stained for lipid droplets with Oil Red O (1.8 mg/mL in 60% isopropanol). Staining was quantitated by eluting the Oil Red O in 99% isopropanol (0.25 mL/well for 5 minutes at room temperature) and measuring absorbance at 490 nm.

2.7. Assessment of gene expression

RNA was isolated on the indicated days from young female BMCs cultured in 6-well plates (n = 3 at each time point). Lysis buffer was added directly to the rinsed cell layers on the plates and total RNA was isolated. RNA was quantitated by absorbance at 260 nm, reverse transcribed, and gene expression was assessed on a BioRad CFX96 system using SsoAdvanced Universal SYBR Green Supermix. Primers were chosen using Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) and shown in Table 1. The product of each primer pair was verified to be of the correct size and the sole reaction product by agarose gel electrophoresis prior to use in RT-qPCR. GAPDH was used as a control for normalization of expression.

Table 1:

Primer Pairs for RT-qPCR

Gene	GenBank Accession	Forward Primer (5’→3’)	Reverse Primer (5’→3’)	PCR Product Size (bp)
Type I collagen alpha I	NM_053304.1	TTTCCCCCAACCCTGGAAAC	CAGTGGGCAGAAAGGGACTT	287
Alkaline phosphatase	NM_013059.1	GACAAGAAGCCCTTCACAGC	TTCTGTTCCTGCTCGAGGTT	476
Osteocalcin	NM_013414	GAGGGCAGTAAGGTGGTGAA	AGAGAGAGGGAACAGGGAGG	267
Runx2	NM_001278483.1	CGCCTCACAAACAACCACAG	TCACTGCACTGAAGAGGCTG	225
RANKL	NM_057149.1	CAACCGAGACTACGGCAAGT	AGTCGAGTCCTGCAAACCTG	301
OPG	NM_012870.2	GACCCCAGAGCGAAACACG	GGCACAGCAAACCTGAAGAA	234
GAPDH	NM_017008.4	ATGGGAAGCTGGTCATCAAC	CCACAGTCTTCTGAGTGGCA	375

Primers were chosen using Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The product of each primer pair was verified to be of the correct size and the sole product prior to use in RT-qPCR.

2.8. Determination of in vitro and in vivo pharmacokinetic (PK) characteristics

PK assays including in vitro protein binding; half-life in plasma, blood, and hepatocytes; and intrinsic clearance in hepatocytes were performed by Eurofins Pharma Discovery Services (Bois l’Évêque, France). Protein binding in rat plasma was determined at a compound concentration of 10 μM by equilibrium dialysis during 4 hours at 37°C as described by Banker et al. (Banker, Clark, & Williams, 2003). Half-life determination in rat plasma and blood was performed at a compound concentration of 1 μM by incubation at 37°C during 0, 30, 60, 90 and 120 minutes according to the Di et al protocol (Di, Kerns, Hong, & Chen, 2005). Half-life and intrinsic clearance in rat hepatocytes were evaluated by incubating the compounds at 37°C with 0.7 million viable cells/mL during 0, 30, 60, 90 and 120 minutes according to the protocol of Obach et al (Obach et al., 1997). At the end of each time points, acetonitrile was added to the incubation mixture followed by centrifugation. Samples were analyzed by HPLC-MS/MS and peak areas were recorded for each analyte.

In vivo assays including half-life; mean residence time; clearance; volume of distribution; and area under the curve were carried out by Absorption Systems (Exton, PA). Briefly, KMN-159 was dosed by intravenous route of administration at 0.5 mg/kg in 3 male Sprague-Dawley rats. Blood samples were collected up to 24 hours post-dose and plasma concentration were determined by LC-MS/MS. PK parameters were calculated from the time course of the plasma concentration with Phoenix WinNonlin (v.6.1) software using a non-compartmental model.

2.9. Rat calvarial defect model

Three-month old female Sprague-Dawley rats were anesthetized to effect with inhaled isoflurane. A calvarial through-and-through osteotomy of 2.6 mm in diameter was trephined centrally into the dorsal portion of the parietal bone using a high-speed rotary hand piece and a trephine bur. The indicated dosing matrix (below) was then placed into the defect, smoothed with a spatula to evenly cover the defect area, and the margins of the wounds were closed using silk sutures.

KMN-159 was delivered set inside calcium phosphate cement (CPC) that, after loading with drug and setting, was ground to a fine powder and suspended in demineralized bone matrix at a ratio of 1:8 (weight/volume). KMN-159 was tested at 30 μg/mL with a negative control group (dosing matrix containing ethanol vehicle) and a positive control group (50 μg/mL rhBMP-2) included as comparators (n = 5 rats/group). Briefly, the volume of a single defect was calculated to be ~11 μL and therefore the total treatment volume for 5 rats was 55 μL. Since the ratio of CPC to dosing solution was 1:8, 6.8 mg of calcium phosphate cement was used per group. KMN-159 dissolved and diluted in ethanol was added to the 6.8 mg of calcium phosphate cement and the ethanol allowed to evaporate. The cement was then wet with a setting solution, mixed thoroughly for 1 minute, and allowed to set overnight at room temperature. CPC containing no KMN-159 was also made up for the vehicle and rhBMP-2 treatment groups. The cement-KMN-159 mixture was then ground to a fine powder with a mortar and pestle. The powdered cement was added to 55 μL of Puros DBM and thoroughly mixed using two spatulas. The cement-DBM mix was rolled into a single length of material of equal thickness, cut into five equal length pieces, and placed in a calvarial defect within four hours of formulation. For the rhBMP-2 treatment group, rhBMP-2 protein dissolved in PBS was added to the ground cement immediately before mixing with the DBM.

At intervals of 1 week, each rat was anesthetized with isoflurane to effect and while unconscious, their cranium was imaged with a dental cone beam CT scanner (Vatech Pax-Duo3D). The acquired scan was then constructed into a three dimensional computer tomography image and the area of the defect was measured using the manufacturer’s software. The experiment was terminated eight weeks after surgery. The area of open defect measured each week was compared to that of the first week and the degree of repair calculated by the following formula: (original area – current area)/original area * 100.

2.10. Statistical analysis

The EC₅₀ values (concentration producing a half-maximal response) of functional activation in EP overexpressed systems and BMCs cultures were determined by non-linear regression analysis of the concentration-response curves 12 data points) generated using GraphPad Prism 8.1.2 software. Results are expressed as mean ± SEM of (n) experiments. Analysis of the EC₅₀ differences was performed using ANOVA followed by Tukey post hoc test (GraphPad Prism 8.1.2 software). Statistical evaluation of the different treatments and/or time of treatment was performed using appropriate 1-way or 2-way ANOVA followed by Tukey or Sidak post hoc tests (GraphPad Prism 8.1.2 software) as indicated in the legends of the corresponding figures.

3. Results

3.1. KMN-159 binds to and activates the EP₄ receptor

We developed a novel small molecule series of EP₄ receptor-selective agonists with the goal of developing innovative therapeutic agents for use in a variety of applications (Barrett et al., 2019). One such application is promotion of bone healing through stimulation of osteogenesis. In order to begin the biological characterization of these molecules in a rat model system, we screened several test compounds against overexpressed rat EP₄ and EP₂ receptors in HEK293 cells (Table 2). Binding of endogenous PGE₂ or exogenous agonists to the EP₄ and/or EP₂ receptors activates adenylyl cyclase, resulting in rapid increased formation of intracellular cAMP. Moreover, agonist binding to both receptors activates the transcription factor cAMP-responsive element-binding protein (CREB) downstream of the signal transduction cascade. As can be seen in Table 2, both PGE₂ and PGE₁ bind to the rat EP₄ receptor and activate both the EP₂ and EP₄ receptors with similar potency as measured by the subsequent production of cAMP or stimulation of a CRE- SEAP reporter construct. As reported by Barrett et al. (Barrett et al., 2019) and exemplified in Table 2, KMN-159, incorporating both difluoromethylene into the lactam ring and acetylene into the ω-chain, retained EP₄ selectivity versus EP₂ but also demonstrated remarkable sub-nanomolar potency for both cAMP accumulation and CRE-SEAP activation through the EP₄ receptor.

Table 2:

Compound Structures, Receptor Binding and Signaling

Compound	Structure	rat EP4 receptor binding Ki (nM)	rat EP2 receptor cAMP levels EC50 (nM)	rat EP2 receptor CREB activation EC50 (nM)	rat EP4 receptor cAMP levels EC50 (nM)	rat EP4 receptor CREB activation EC50 (nM)
PGE2		0.19	88.4 ± 4.2 (n = 5)	2.8 ± 0.7 (n = 9)	0.48 ± 0.09 (n = 5)	0.03 ± 0.002 (n = 56)
PGE1		0.20	79.5 ± 9.1 (n = 3)	4.5 ± 0.46 (n = 3)	0.51 ± 0.07 (n = 9)	0.02 ± 0.004 (n = 3)
11-deoxy-PGE2		0.42	679 ± 49.2 (n = 3) a, b	38.7 ± 4.5 (n = 3)	1.1 ± 0.16 (n = 3) a, b	0. 02 ± 0.007 (n = 3)
11-deoxy-PGE1		0.21	617 ± 12.2 (n = 3) a, b, c	37.2 ± 6.3 (n = 3)	1.3 ± 0.24 (n = 3) a, b	0.06 ± 0.012 (n = 3) a, b, c
11-deoxy-8-aza-PGE1		1.61**	>10,000 a, b, c, d	2410 ± 50 (n = 3) a, b, c, d	2.6 ± 0.62 (n = 3) a, b, c, d	0.16 ± 0.049 (n = 3) a, b, c, d
KMN-165		0.20**	>10,000 a, b, c, d	851 ± 63 (n = 3) a, b, c, d, e	0.30 ± 0.025 (n = 3) c, d, e	0.03 ± 0.007 (n = 3) d, e
KMN-80		1.11	>10,000 a, b, c, d	>10,000 (n = 3) a, b, c, d, e, f	2.6 ± 0.31 (n = 6) a, b, c, d, f	0.17 ± 0.014 (n = 6) a, b, c, d, f
KMN-159		0.24	>10,000 (n = 3) a, b, c, d	>10,000 (n = 3) a, b, c, d, e, f	0.50 ± 0.08 (n = 4) c, d, e, f, g	0.03 ± 0.003 (n = 7) d, e, g

^**binding Ki (nM) for human EP₄

The indicated compounds were tested for binding to the rat or human (for 11-deoxy-8-aza-PGE₁ and KMN-165) EP₄ receptor and for activation of the rat EP₂ and EP₄ receptors as measured by cAMP levels or stimulation of a CRE-SEAP reporter gene. K_i and EC₅₀ values are expressed in nM concentration. Values >10,000 indicate that the EC50 is not calculable because the concentration-response curve shows less than 25% effect at the 10 μM concentration. All the compounds with reported EC₅₀ were full agonists reaching 100% of the PGE₂ maximal response. EC₅₀ values are expressed as the mean ± SEM of (n) replicates. Statistical analysis of the differences was performed using ANOVA followed by Tukey test. P < 0.01 as compared to

^aPGE₂,

^bPGE₁,

^c11-deoxy-PGE₂,

^d11-deoxy-PGE₁,

^e11-deoxy-8-aza PGE_1,

^fKMN-165,

^gKMN-80.

3.2. Influence of agonist structure on activation of ALP in young female rat BMCs

We evaluated biological activity of several test compounds with slight structural variations. We obtained total bone marrow cells (BMCs) from rat long bones (femora and tibiae) and treated only once at plating with the desired concentration of test compound. We then assayed for alkaline phosphatase (ALP) enzyme activity 9 days later. Figure 1 shows the results of the averages of at least three dose response curves for each compound in young female rats. As can be seen in Figure 1A–D, the 11-deoxy analogs of both PGE₂ and PGE₁ showed EC₅₀ values (35.8 ± 14.2 nM and 95.8 ± 21.9 nM, respectively) that were not different from the parent compounds (31.6 ± 5.4 nM and 132 ± 35 nM, respectively). Interestingly, a difluoro substitution alpha to the lactam ring carbonyl of 11-deoxy-8-aza-PGE₁ (EC₅₀ = 91.2 ± 26.6 nM, Figure 1E), generated a significant EC₅₀ shift in the resulting compound, KMN-165 (EC₅₀ = 10.6 ± 2.6 nM, Figure 1F). A unique acetylene ω-chain substitution into 11-deoxy-8-aza-PGE₁ increased EP₄ selectivity over EP₂ (see Table 2), but the potency of the resulting compound, KMN-80, was unchanged from the parent compound in the BMC ALP assay (compare Figures 1E and 1G). However, the combination of the difluoro substitution of the lactam ring and the acetylene-bearing ω-chain in the same compound resulted in both selectivity for EP₄ (Table 2) and an approximately 40-fold increase in potency in the BMCs (EC₅₀ = 2.44 ± 0.45 nM for KMN-159 (Figure 1H) as compared to an EC₅₀ = 91.2 ± 26.6 nM for 11-deoxy-8-aza-PGE₁, Figure 1E).

Figure 1: Dose responsive activation of ALP enzyme activity in young female rat BMCs by EP₄ receptor agonists.

BMCs isolated from young female rats were treated once at plating with varying doses of the indicated compounds. Cells were cultured and ALP enzyme activity determined on day 9 as described in the Methods. Compounds tested were (A) PGE₂; (B) PGE₁; (C) 11-deoxy-PGE₂; (D) 11-deoxy-PGE₁; (E) 11-deoxy-8-aza-PGE₁; (F) KMN-165; (G) KMN-80; and (H) KMN-159. EC₅₀ values are expressed as the mean ± SEM of (n) replicates. Statistical analysis of the differences was performed using ANOVA followed by Tukey test. P < 0.01 as compared to ^aPGE₂, ^bPGE₁, ^c11-deoxyPGE₂, ^d11-deoxyPGE₁, ^e11-deoxy-8-aza PGE_1, ^fKMN-165, ^gKMN-80. P < 0.05 as compared to ^a’PGE₂, ^b’PGE₁, ^c’11-deoxyPGE₂.

3.3. Influence of age on activation of ALP in old female rat BMCs

To determine if the age of the bone marrow cell donor animal influenced the osteogenic response to EP₄ agonists, BMCs from old female rats were used to test PGE₂, PGE₁, KMN-80 and KMN- 159. As can be seen in Figure 2 A–D, the EC₅₀ values for all compounds tested were lower than those observed when tested in younger female rats. For example, the ALP EC₅₀ calculated for PGE₂ treatment of BMCs isolated from older animals was 15.6 ± 4.1 nM (Figure 2A) as compared to 31.6 ± 5.4 nM for younger animals (Figure 1A). Similarly, the ALP EC₅₀ calculated for PGE₁ treatment of BMCs from older animals was 51.5 ± 12.3 nM (Figure 2B) as compared to 132 ± 35 nM for BMCs from younger rats (Figure 1B). KMN-80 and KMN-159 showed ALP EC₅₀ values significant different than those corresponding to PGE₂ and PGE₁ (Figure 2C and 2D, respectively).

Figure 2: Dose responsive activation of ALP enzyme activity in old female or young male rat BMCs by EP₄ receptor agonists.

BMCs isolated from old female rats (A-D) or young male rats (E-H) were treated once at plating with varying doses of the indicated compounds. Cells were cultured and ALP enzyme activity determined on day 9 as described in the Methods. Compounds tested were (A, E) PGE₂; (B, F) PGE₁; (C, G) KMN-80; and (D, H) KMN-159. EC₅₀ values are expressed as the mean ± SEM of (n) replicates. Statistical analysis of the differences was performed using ANOVA followed by Tukey test. P < 0.01 as compared to aPGE₂, bPGE₁, cKMN-80; P < 0.05 as compared to a’PGE₂, c’11-deoxyPGE₂ in the same animal group.

In particular, KMN-159 exhibited in the old group the highest potency among all the female BMCs tested (EC₅₀ = 1.61 ± 0.36 nM, Figure 2D).

3.4. Influence of sex on activation of ALP in young male rat BMCs

In order to address whether the sex of the bone marrow donor animal influenced the osteogenic response to EP₄ agonists, we compared the calculated EC₅₀ values for ALP activity for BMCs isolated from young male rats (Figure 2 E–H) with those found from young female rats (Figure 1). In this case, the ALP EC₅₀ for PGE₂ was found to be 55.2 ± 25.4 nM for male rat BMCs (Figure 2E) as compared to 31.6 ± 5.4 nM for female rat BMCs (Figure 1A) and 103 ± 21 nM for PGE₁ in male (Figure 2F) as compared to 132 ± 35 nM in female rat BMCs (Figure 1B). The ALP calculated EC₅₀ values for KMN-159 were 4.21 ± 0.71 nM (Figure 2H) and 2.44 ± 0.45 nM (Figure 1H), respectively, for male and female rat BMCs. A two-way ANOVA analysis of ALP activity of all the BMCs tested in the presence of PGE₂, PGE₁, KMN-80 and KMN-159 (alpha 0.05) confirmed the effect of sex for PGE₂ and PGE₁ (P < 0.05) and the effect of age for PGE₁ and KMN-80 (P < 0.01). For KMN-159, however, neither sex nor age was significant.

3.5. Effects of KMN-159 on cell number, ALP-positive colony area, and mineralization

ALP activity values might increase following PGE₂ or KMN-159 treatment due to an increase in the number of cells in the cultures. Figure 3A shows that when the total cell number was determined on days 5, 6, or 7, no significant differences in the number of cells were observed among vehicle, PGE₂ or KMN-159-treated cultures. Since ALP enzyme activity is considered a marker for extracellular matrix maturation in preparation for its eventual mineralization (Owen et al., 1990), its increase in a dose-dependent manner following treatment with KMN-159 suggested that an increase in extracellular matrix mineralization would follow. We first determined the area of ALP positive colonies following treatment of BMCs with vehicle, 1μM PGE₂, or 1μM KMN-159. As can be seen in Figure 3B, both PGE₂ and KMN-159 similarly increase the ALP positive area as compared to vehicle. To then test the effects on mineralization, we treated BMCs once at plating with 1μM KMN-159. This dose was chosen since regardless of age or sex of the donor animal, treatment of 1μM KMN-159 always maximally stimulated the increase in ALP activity. When KMN-159-treated BMCs were cultured under conditions which promote mineralization, we observed an increase in mineralized area as detected by von Kossa staining when compared to vehicle treated BMCs (see Figure 5C, below).

Figure 3: Treatment of rat BMCs with PGE₂ or KMN-159 does not change total adherent cell number in culture but increases the ALP positive area.

BMCs were treated once at plating with either vehicle (●), PGE₂ (1μM; ■), or KMN-159 (1μM; ▲). On day 4 after plating, cultures were fed with 50% plating volume of fresh medium containing dexamethasone (10 nM final). (A) On days 5, 6, and 7, a 24-well plate was fixed in methanol and air dried. All plates were then stained with DAPI and the number of cells quantitated by counting nuclei using the BioTek Cytation system (n = 8 wells / treatment / day). Statistical analysis of the differences was performed using 2-way ANOVA followed by Tukey test and shows no effect of either treatment. P < 0.001 among the different time points. (B) On day 9, one 6-well plate for each treatment was fixed and stained for ALP activity. The ALP positive area was quantitated using the BioTek Cytation system (n = 6 wells / treatment). Statistical analysis of the differences was performed using ANOVA followed by Tukey test. ** P < 0.01 and * P < 0.05 as compared to vehicle control and n.s. indicates non-significance.

Figure 5: KMN-159 is Stable at Room Temperature and Stimulates Osteogenesis in BMCs After a Short Exposure.

(A) KMN-159 was diluted in ethanol to the final concentrations noted and added to the wells of 24-well plates (n = 8 wells / dilution). Ethanol vehicle alone was added to a corresponding set of plates. The ethanol solvent was evaporated overnight and the plates stored for 24 days at room temperature in room light. BMCs were then added to the wells, fed on day 4, harvested on day 9, and ALP enzyme activity assayed. (B, C) BMCs were treated with either 1μM KMN-159 or vehicle (0.1% ethanol) and incubated in suspension at 37°C for the indicated times. KMN-159 was removed and cells were then plated as described in Methods for determination of ALP activity (n = 8 wells / treatment / time) or mineralization (n = 6 wells / treatment / time). All cultures were fed with fresh medium containing dexamethasone (10 nM final) on day 4. ALP activity is expressed as fold increase following KMN-159 treatment over the corresponding vehicle treated wells (B). Assessment of mineralization was performed only at 30 or 60 minute treatments. Cultures were fed with osteogenic media on day 7 after plating and every 3 days thereafter, and fixed on day 21. Mineralization assessed by von Kossa staining (C). Quantification of the mineralization (D) is expressed as the total number of pixels per well that were von Kossa staining positive (■ vehicle treated; ■ KMN-159 treated). Statistical analysis of the differences was performed using 2-way ANOVA followed by Sidak test. Effect of treatment ** P < 0.01.

3.6. Activation of ALP by KMN-159 in rBMCs occurs through EP₄

In our initial studies, the claim of KMN-159 EP₄ selectivity was based on receptor binding as well as cAMP accumulation and CREB activation in an EP₄ recombinant overexpression system (Table 1). In order to demonstrate the EP₄ receptor selectivity of the dose-dependent ALP response in the rat BMC culture system, BMCs were treated with various doses of either KMN-159; the EP₂-selective agonist butaprost; or the EP₃-selective agonist sulprostone. BMCs were also treated with various doses of KMN-159 following a 30 minute pretreatment with receptor-specific antagonists (Figure 4). As can been seen in Figure 4A, while KMN-159 treatment of the BMCs once at plating yielded a dose-dependent increase in ALP activity, treatment of the cells with either butaprost or sulprostone at doses ranging from 1 pM to 10 μM resulted in no change in ALP activity over that observed in vehicle treated cultures. The use of receptor-specific antagonists showed complementary results. As can be seen in Figure 4B, pretreatment of the BMCs with either ONO-8711, an EP₁ selective antagonist; PF-04418948, an EP₂ selective antagonist; or vehicle for 30 minutes prior to the addition of the indicated doses of KMN-159 resulted in very similar dose-dependent increases in ALP activity with EC₅₀ values of 2.18 nM, 1.67 nM, and 2.15 nM respectively. In contrast, pretreatment of the BMCs with the EP₄-selective antagonist ONO-AE3–208 for 30 minutes prior to KMN-159 addition dramatically shifted the ALP dose response curve to the right, yielding an EC₅₀ value of 1498 nM.

Figure 4: Stimulation of Osteoblastic Differentiation by KMN-159 in Rat Bone Marrow Cells Occurs via EP₄ Activation.

(A) BMCs were treated once at plating with the indicated doses of either butaprost, an EP₂ receptor selective agonist (▲); sulprostone, an EP₃ receptor selective agonist (■); or our EP₄ selective agonist KMN-159 (●). (B) BMCs were treated with the indicated doses of KMN-159 following a 30-minute pretreatment with either vehicle (●); ONO-8711, an EP₁ selective antagonist (▲); PF-04418948, an EP₂ selective antagonist (■); or ONO-AE3–208, an EP₄ selective antagonist (○). Cells were then cultured and ALP enzyme activity determined on day 9 as described in the Materials and Methods. No induction of ALP enzyme was observed when the BMCs were treated with the antagonist compounds alone (data not shown).

3.7. KMN-159 is chemically stable

Small molecule activators of bone formation typically have the advantage of chemical stability over protein activators. We previously tested the stability of KMN-159 in aqueous solution and upon sterilization by autoclaving or gamma irradiation and demonstrated a recovery higher than 90% under all conditions (data not shown). In the current work, we dried dilutions of the compound made in ethanol (or ethanol vehicle alone) onto the surfaces of 24-well plates and stored the dishes in room light at room temperature for 24 days. BMCs were then plated onto the wells and ALP enzyme was assayed on culture day 9 as described before. As can be seen in Figure 5, the dried KMN-159 showed the same ability to stimulate ALP enzyme activity as when freshly diluted. The obtained EC₅₀ for dried KMN-159 was 8.4 nM (Figure 5A), in line with the average EC₅₀ found using fresh compound (Figure 1H).

3.8. Short exposure of rBMCs to KMN-159 is sufficient to induce osteogenesis

We demonstrated above that the ALP activation induced by KMN-159 treatment of rat BMCs was modulated by the EP₄ receptor, a member of the GPCR superfamily. We therefore investigated the minimal agonist-on-receptor time required to initiate the intracellular signaling cascade resulting in the ALP activity and subsequent mineralization of the cultures weeks later. BMCs were treated with either 1μM KMN-159 or 0.1% ethanol vehicle in suspension for the desired number of minutes, then pelleted by centrifugation, resuspended in fresh plating medium with no compound, and plated. Cultures to be analyzed for ALP activity were harvested on day 9 and those for analysis of mineralization harvested on day 21. Figure 5B shows that treatment of the BMCs with 1μM KMN-159 for as little as 10 minutes (the shortest time practical to include all the steps of treatment, centrifugation, resuspension and plating) resulted in an approximately 3-fold increase in ALP activity as compared to the vehicle treated cells from the same treatment time. While a trend towards higher activity was observed with treatment times of up to 55 minutes, the results were not significantly different from each other and longer times of treatment did not yield any additional increase in ALP activity. Figure 5C shows that results of BMCs treated with 1μM KMN-159 in the same manner but fixed and stained for mineralization 21 days later. It can be seen that in the case of either 30 minutes or 60 minutes exposure to KMN-159 prior to plating (the only times examined for mineralization), the 6 wells on the right side of both plates containing KMN-159 treated BMCs had more mineralized surface area than those in the 6 wells on the left side of both plates (vehicle treated BMCs). Figure 5D shows the quantitative results of von Kossa staining for mineral.

3.9. KMN-159 modulates bone phenotype marker gene expression in rBMCs

The differentiation of osteoblastic precursor cells into mineralized osteoblasts is accompanied by the expression of a series of gene markers of osteoblastogenesis. In addition to the observed increases in the phenotypic endpoints of ALP enzyme activity and mineralized nodule formation following KMN-159 treatment of whole BMC cultures, we determined the relative expression of several of these differentiation stage marker genes following KMN-159 treatment (Figure 6). Expression of the Runt-related transcription factor 2 (Runx2) increased as expected during the osteoblastic differentiation timecourse. Its expression was further significantly increased in cultures treated with KMN-159 at days 19 and 25, potentially enhancing the expression of late bone phenotype marker genes such as osteocalcin (Figure 6A). The expression of collagen type IαI similarly increased with differentiation and, as expected based on the previously demonstrated increases in mineralization, its expression is also further increased in cultures treated with KMN- 159 (Figure 6B). The expression of ALP mRNA increased with time and in a manner consistent with the observed increases in ALP enzyme activity measured on day 9 of the BMC cultures following treatment with KMN-159 (Figure 6C). Similarly, but at later days in the osteoblast differentiation timecourse, osteocalcin gene expression increased with both, time in culture and KMN-159 treatment (Figure 6D). The expression of two genes that are critical to the formation and regulation of osteoclasts, RANKL and OPG, was also changed in KMN-159 treated cultures. KMN-159 treatment resulted in the significantly increased expression of RANKL at all timepoints tested (Figure 6E) while the expression of OPG was either unchanged or decreased in KMN-159 treated cultures (Figure 6F). The calculated ratio of RANKL to OPG expression is shown in Figure 6G.

Figure 6: KMN-159 Stimulates Expression of Osteoblast Phenotype Marker Genes.

BMCs isolated from female rats (<6 months) were treated once at plating with 1μM KMN-159 (■) or vehicle (0.1% ethanol; ■) and plated in 12-well plates. On day 4 after plating, all cultures were fed with fresh medium containing dexamethasone (10 nM final). Beginning on day 7 after plating and every 3 days thereafter, cultures were fed with osteogenic medium. RNA was prepared as indicated in Methods. Expression of GAPDH was used as a reference. Statistical analysis of the differences was performed using 2-way ANOVA followed by Tukey test. P < 0.001 effect of time and treatment. * P < 0.05; ** P < 0.01 and *** P < 0.001 as compared to vehicle control at the same timepoint.

3.10. KMN-159 induces osteoclastogenesis but not adipogenesis in rBMCs

RANKL is a crucial factor for osteoclast differentiation from myeloid lineage mononuclear precursor cells and the induction of its expression by KMN-159 directed us to examine osteoclastogenesis by measuring the formation of TRAP-positive cells in the BMC cultures. As can be seen in Figure 7, treatment of BMCs with various doses of either PGE₂ (Figure 7A) or KMN-159 (Figure 7B) in the presence of 16 ng/mL RANKL and 16 ng/mL M-CSF resulted in significantly increased numbers of TRAP-positive cells when compared to vehicle treated cultures. No increase in the number of TRAP-positive cells was observed in the absence of RANKL and M-CSF (data not shown). Since bone marrow cultures can also be induced to differentiate into adipocytes, we examined whether either KMN-159 or PGE₂ influenced adipogenesis. Figure 7C shows that under culture conditions which are favorable to adipogenesis in the rat (i.e. the presence of insulin and dexamethasone), neither 1μM PGE₂ nor 1μM KMN-159 affected adipocyte formation as measured by Oil Red O staining for lipids.

Figure 7: KMN-159 Stimulates Osteoclastogenesis but not Adipogenesis in vitro.

(A, B) For assessment of osteoclastogenesis, BMCs isolated from male rats (<6 months) were treated once at plating with the indicated doses of KMN-159, PGE₂, or vehicle (0.1% ethanol) in phenol red-free MEMα supplemented with 10% FCS and 16 ng/mL each RANKL and M-CSF and plated in 24-well plates (n = 5 – 6 wells). Cells were fixed on day 14 and stained for TRAP enzyme activity. Statistical analysis of the differences was performed using ANOVA followed by Tukey test. * P < 0.05; *** P < 0.001 as compared to vehicle control. (C) For assessment of adipogenesis, BMCs isolated from male rats (<6 months) were treated at plating and at medium replacement with 1μM KMN-159, 1μM PGE₂, or vehicle (0.1% ethanol) in MEMα supplemented with 10% FCS, 10 μg/mL insulin, and 1 μM dexamethasone (n = 8 wells). Cultures were fixed on day 12 and stained for lipids with Oil Red O. Comparison of Oil Red O staining between vehicle or either PGE₂ or KMN-159 treated cells showed no significant change.

3.11. in vitro and in vivo pharmacokinetic properties of KMN-159

In addition to positive osteogenic activity, a potential therapeutic agent for local bone applications would have certain desirable PK properties including a short half-life and relatively rapid rate of clearance. Determination of the in vitro PK properties of KMN-159 (Table 3) showed that it has moderate protein binding (53.8% ± 3.5% at 10 μM); half-lives in plasma, blood, and hepatocytes of greater than 120 minutes; and low intrinsic clearance in hepatocytes (< 8.2 μL/min/10⁶ cells). We further characterized KMN-159 by examining its PK in vivo in rats. Table 3 shows that KMN-159’s half-life in vivo is less than 15 minutes; its mean residence time is relatively low (8.3 ± 1.0 min); and its systemic exposure is low (AUC = 21.8 ± 5.55 hr.ng/mL). The in vivo clearance rate of 23.9 ± 5.95 mL/hr/kg for KMN-159 is considered high and preliminary evidence suggests that KMN-159 is cleared as parent compound in the urine (data not shown).

Table 3:

in vitro and in vivo Pharmacokinetic Properties of KMN-159

in vitro parameters			in vivo parameters
	KMN-159			KMN-159
protein binding (%)	53.8 ± 3.5		half life (min)	14.6 ± 1.3
half life - plasma (min)	>120		mean residence time last (min)	8.3 ± 1.0
half life - blood (min)	>120		clearance (L/hr/kg)	23.9 ± 5.95
half life - hepatocytes (min)	>120		steady state volume of distribution (L/kg)	3.41 ± 1.15
intrinsic clearance - hepatocytes (μL/min/106 cells)	<8.2
			area under the curve (extrapolated to infinity; hr.ng/mL)	21.8 ± 5.55

The indicated in vitro and in vivo pharmacokinetic properties of KMN-159 were determined as described in the Materials and Methods.

3.12. KMN-159 induces bone repair in a rat calvarial defect model

The ultimate measure of osteogenesis by an EP₄ agonist is whether it can induce bone formation in an animal. To test this, we chose to use a cranial osteotomy model in the rat (Figure 8). A 2.6 mm osteotomy was trephined centrally into the dorsal portion of the parietal bone and filled with calcium phosphate cement that was loaded with either KMN-159 or ethanol vehicle, set, ground to a fine powder, and suspended in demineralized bone matrix at a ratio of 1:8 (weight/volume). Rats were imaged weekly through 8 weeks post-surgery and the area of the original defect that had repaired was calculated. The defect filled with matrix containing KMN-159 (30 μg/mL) showed a rate of repair equivalent to the rhBMP-2 protein positive control and significantly greater than the repair rate of defects filled with matrix containing ethanol vehicle at all times imaged after 5 weeks.

Figure 8: KMN-159 Stimulates Repair of a Calvarial Defect in Rats.

The ability of KMN-159 to accelerate bone formation in vivo was tested using a 2.6 mm cranial osteotomy model in 3 month old female rats. Vehicle (●), KMN-159 (■) and rhBMP-2 (▲) were prepared in CPC containing DBM as described in Methods. Following placement of the CPC-DBM mixtures into the defects, the rats were scanned weekly for 8 weeks using dental cone beam CT scanner. The area of non-mineralized defect was determined each week, compared to the area measured in the same animal immediately after surgery (week 0), and the percent defect repair calculated. Data points are expressed as mean ± SEM (n = 5). Statistical analysis of the differences was performed using 2-way ANOVA followed by Tukey test. P < 0.001 effect of time and treatment. ** P < 0.05 (KMN-159 compared to vehicle control) and *** P < 0.001 (KMN-159 and rhBMP-2 as compared to vehicle control at the same time point).

4. Discussion

4.1. Receptor selectivity, safety, and pharmacokinetic profile

In order to develop an EP₄ agonist with the pharmacological characteristics desirable in a therapeutic agent aimed at stimulating bone formation in local applications, we initiated a structure-activity relationship (SAR) program which ultimately led to the development of a series of novel difluorolactam EP₄ receptor agonists (Barrett et al., 2019). KMN-159 potently binds to and activates the rat EP₄ receptor with high selectivity against the EP₂ receptor (Table 2). While we have not examined the binding of KMN-159 to any rat prostanoid receptors other than EP₄, we previously examined its binding to all the human prostanoids receptors (EP₁-EP₄, DP, FP, IP and TP). This work showed that KMN-159 binds weakly to EP₃ (Ki 258 nM as compared to 0.38 nM for EP₄ binding) and has no detectable binding to the non-EP prostanoids receptors when tested at 10 μM (Barrett et al., 2019). We addressed receptor specificity in the work presented here by using EP receptor-specific agonists and antagonists to demonstrate that the biological action of KMN-159 to stimulate alkaline phosphatase enzyme activity in rat bone marrow is EP₄ dependent (Figure 4). In addition to potency and specificity, a therapeutic agent for local applications would have a favorable safety profile to avoid both local off-target effects and any significant systemic exposure which could result in target-associated side-effects such as flushing, vasodilation, and diarrhea (Li et al., 2007). In vitro safety tests for KMN-159 were negative, including those for cytochrome P450 inhibition, bacterial cytotoxicity, Ames fluctuation, and micronucleus formation (Barrett et al., 2019). Rat PK studies reported here show KMN-159 possesses an in vivo half-life of less than 15 minutes with a relatively high rate of clearance (Table 3). These properties should help to limit its systemic exposure in local applications.

4.2. KMN-159 activates osteogenesis regardless of age or sex of donor rat

Formation of bone for the augmentation of bone mass or the repair of bone defects typically involves stem cells which are derived from the bone marrow, periosteum, endosteum, and other sources (Kostenuik & Mirza, 2017; Wang, Zhang, & Bikle, 2017). To this end, we used unfractionated rat bone marrow as a cell source since it is physiologically appropriate and practical to use in a screening strategy with ALP and mineralization endpoints. Direct comparison of the effect of sex and age of the donor animal on the ALP activation showed that PGE₂ and PGE₁ potencies are affected by sex while PGE₁ and KMN-80 are affected by age. Interestingly, neither sex nor age affected the potency of KMN-159. Nevertheless, all the compounds were potent agonists suggesting that KMN-159 and similar compounds will be efficacious regardless of the age or sex of the treatment subject. In agreement with our results, several studies have clearly demonstrated that the skeletons of both old male and female rats (>20 months old) respond well to systemic treatment with PGE₂ (Cui et al., 2001; Sibonga, Zhang, Ritman, & Turner, 2000; Yao et al., 1999).

4.3. Chemical stability of KMN-159

Proteins such as rhBMP-2 that are currently used clinically to activate bone formation have several general liabilities including cost of production and stability which can limit the shelf life of a product. The synthesis, purification, and isolation of the stable crystalline solid KMN-159 have been characterized (Barrett et al., 2019). We have observed no measurable degradation of this solid after storage at room temperature for over two years. For clinical use, we envision that KMN-159 or one of its crystalline analogs compounds would be incorporated into a delivery formulation that would be stored dry at room temperature. To test this possibility, we dried down various amounts of KMN-159 in cell culture plates and stored them at room temperature exposed to room light for 24 days. Rat BMCs subsequently plated onto the dried compound showed ALP dose-dependent activation similar to the ALP activation observed for cells treated with freshly diluted compound (compare Figures 5A and 1H). Although formal stability studies will be required later in development, this finding strongly suggests that KMN-159 formulated in a delivery matrix will be quite stable under ambient storage conditions.

4.4. Short exposure to KMN-159 is sufficient to induce osteogenesis

Many therapeutic agents including PGE₂ and KMN-159 act through G protein-coupled receptors (GPCRs) on the surface of their target cells. The EP₄ receptor to which KMN-159 binds is a GPCR that signals through Gαs and Gαi, leading to rapid modulation of adenylate cyclase activity and intracellular cAMP levels. Typically, GPCRs need to interact with their ligands for relatively short periods in order to transduce a signal and activate the appropriate pathways (Weis & Kobilka, 2018). When the total rat bone marrow cultures used in the work presented here were established, the test compounds were only added one time at the initiation of the culture. Since these compounds, including KMN-159 and PGE₂, are very stable in vitro (Table 3 and data not shown), they were present throughout the culture period under the conditions used here to facilitate compound screening. In order to investigate the time required for the KMN-159-EP₄ interaction to commit the BMCs to a program of osteogenesis (as measured by both induction of ALP and the subsequent development of mineralized colonies), we exposed the BMCs to KMN-159 for various times and then removed the compound (Figure 5B–D). Even with a time of exposure as short as 10 minutes, the induction of ALP as measured 9 days later was already at approximately 75% of the maximum reached between 30 and 60 minutes of exposure and comparable to results obtained with constant exposure. Similarly, these short exposures of the cells to KMN-159 induced increased mineralized colony formation as compared to vehicle and measured 21 days later. The initiation of the complete program of osteogenic differentiation by a single dose of compound with an exposure time of less than 60 minutes further supports the advantage of KMN-159 as a therapeutic candidate for local applications.

4.5. Gene expression associated with osteoblastogenesis

The differentiation of osteoblastic precursor cells into mineralized osteoblasts is accompanied by the sequential expression of a series of genes (Aubin, 1998; Owen et al., 1990). While vehicle treated BMCs will express ALP and eventually mineralize to some extent, BMCs treated with 1μM KMN-159 exhibit increased levels of both parameters and as such, were expected to show increased expression of genes associated with osteoblastogenesis. Figure 6 shows that the mRNAs for the early differentiation markers type I collagen and ALP increased over time in the vehicle treated cells and their levels were stimulated by KMN-159 treatment at plating. Similarly, mRNA for the late phenotype marker osteocalcin becomes detectable at day 11, increases on the later days in culture, and is significantly stimulated by KMN-159 in conjunction with the increased mineralization of the treated cultures. Runx2 supports transcription of genes essential for the maturation of osteoblasts (Lian et al., 2004). Its mRNA showed a small increase in expression (~2x) in KMN-159 treated cultures on day 5, potentially reflecting its role in stimulating the expression the other genes needed for osteoblastic differentiation. Interestingly, Runx2 levels increased with time in both vehicle and KMN-159 treated cultures through 14 days, after which its levels increased in the treated cultures, although the cells had not been exposed to compound since day 7. As in all cases of analysis of gene expression, it is important to note that expression of a gene on the mRNA level does not necessarily reflect the expression of its corresponding protein nor its subsequent biological activity.

4.6. Effects of KMN-159 on osteoclastogenesis

Two of the other genes whose expression was examined during this timecourse of KMN-159 mediated BMC osteogenesis were RANKL and OPG. RANKL is made by differentiating osteoblasts to signal mononuclear osteoclastic precursors to fuse and become active osteoclasts. Osteoblasts also make OPG, another secreted protein that acts like a decoy receptor for RANKL and thereby helps to control its activity in stimulating osteoclasts. Together, the proper ratio of these two proteins, representing the coupling of bone formation and bone resorption, is critical to maintaining homeostatic balance in the skeleton (Boyce & Xing, 2007; Martin & Sims, 2015). As with PGE₂, treatment of the BMCs with KMN-159 increased the levels of RANKL mRNA and suppressed the expression of OPG mRNA as compared to the vehicle treated cultures. When BMCs were treated with KMN-159 or PGE₂ in the presence of exogenous M-CSF and RANKL in a standard model of in vitro osteoclastogenesis, the number of TRAP positive cells increased in a dose-dependent fashion, but none was observed in the absence of these exogenous factors. Both Yoshida et al (Yoshida et al., 2002) and Ninomiya et al (Ninomiya et al., 2011) describe similar effects of PGE₂ or the EP₄ agonist ONO-4819 on osteoclast stimulation in vitro and then compared these findings to results from in vivo experiments. As they reported, both PGE₂ acting through EP₄ or an EP₄ agonist stimulated osteoclast number in vitro while in animals treated with either compound, there was no difference in osteoclast numbers despite increased bone formation. In addition, Mano et al. showed that PGE₂ acted directly on active osteoclasts to inhibit bone resorption and that the EP₄ agonist Ono-AE-604 mimicked this action in contrast to the EP₂ agonist butaprost (Mano et al., 2000). This suggests that while an EP₄ agonist can potentially increase the number of TRAP-positive cells in vitro and then only in the presence of exogenous RANKL, it may actually inhibit resorption in vivo, helping to further shift the balance of its actions on bone to anabolism.

4.7. Effects of KMN-159 on adipogenesis

The mesenchymal stem cells in bone marrow can also differentiate into functional adipocytes given the proper microenvironment and signals. We addressed the question of whether KMN-159 can positively signal adipogenesis in addition to osteogenesis by culturing whole bone marrow in the presence of insulin and found no changes in Oil Red O staining for lipid accumulation (Figure 7). Our results agree with previous work by others showing that either PGE₂ acting through the EP₄ receptor or the EP₄ agonist ONO-4819 has little effect on or suppresses adipogenesis in vivo and in vitro (Cui et al., 2001; Ninomiya et al., 2011; Tsuboi, Sugimoto, Kainoh, & Ichikawa, 2004).

4.8. Healing of a rat calvarial defect by KMN-159

The ultimate osteogenic biological activity of KMN-159 was demonstrated by incorporating it into a calcium phosphate cement and applying it in a demineralized bone matrix to a bone defect made in rat calvaria. This model is widely accepted as a model of intramembranous bone formation and is directly applicable as a model for potential use in local applications in which craniofacial bone formation is needed (Lee et al., 2010; Notodihardjo, Kakudo, Kushida, Suzuki, & Kusumoto, 2012). As seen in Figure 8, in this model, KMN-159 demonstrates a healing rate equivalent to that of rhBMP-2 and significantly greater than the healing rate seen in defects treated with the matrix alone. While the release rate KMN-159 from this matrix is not known, a stimulation of repair is clearly seen. rhBMP-2 is the primary therapeutic currently in use for local bone formation, but the fact that is a morphogen and is capable of forming bone in extraskeletal sites has given rise to increasing concerns about its safety risks. In contrast, KMN-159 is likely not a morphogen, given its signaling pathways and the lack of precedence that prostanoids and related compounds promote ectopic bone formation after decades of study in animals and humans. KMN-159 therefore possesses an inherent advantage in its safety profile as compared to members of the BMP superfamily.

5. Conclusion

In conclusion, KMN-159 demonstrates the ability to stimulate osteoblastic differentiation in vitro in total rat bone marrow from both sexes and from young and old rats as measured by induction of ALP enzyme activity, mineralized nodule formation, and osteoblast phenotype marker gene expression. Our work also shows that this agonist need only act on its target receptor for a short time in order to stimulate the complete program of osteoblastic differentiation in bone marrow precursor cells. We have also shown that in a rat calvarial defect model, KMN-159 can increase the rate of defect closure significantly over vehicle to that equivalent to rhBMP-2. The combination of the increased potency and selectivity of KMN-159 as shown by several measures, together with its pharmacokinetic properties should decrease the risk of off-target activity following release in a local administration modality. Initial safety testing shows no obvious liabilities and no overt toxicity was observed in cells except at a very high dose. It is envisioned that the application of these compounds in a local manner to increase the rate of bone formation should have many applications including but not limited to the augmentation of bone mass prior to either orthopedic or dental implants; facilitation of spinal fusion; repair of non-union fractures; bridging long bone critical defects; and craniofacial repair.

ABBREVIATIONS

PGE₂

prostaglandin E₂

PGE₁

prostaglandin E₁

cox-1

cyclooxygenase 1

cox-2

cyclooxygenase 2

GPCR

G protein-coupled receptor

rhBMP-2

recombinant human bone morphogenetic protein-2

RANKL

receptor activator of nuclear factor kappa-B ligand

OPG

osteoprotegerin

TRAP

tartrate-resistant acid phosphatase

SOST

sclerostin

SEAP

secreted alkaline phosphatase

ALP

alkaline phosphatase

IBMX

3-isobutyl-1-methylxanthine

βGP

β-glycerophosphate

FCS

fetal calf serum

pNPP

para-nitrophenyl phosphate

M-CSF

macrophage colony-stimulating factor

DBM

demineralized bone matrix putty

CPC

calcium phosphate cement

CRE

cAMP response element

CREB

cAMP-responsive element-binding protein

BMCs

total bone marrow cells

Dex

dexamethasone

PK

pharmacokinetic

Runx2

runt-related transcription factor 2

SAR

structure-activity relationship