Abstract
Background and Aims
Single-stranded DNA oligodeoxynucleotides (ssODNs) have been shown to elicit immune responses in mammals. In plants, RNA and genomic DNA can activate immunity, although the exact mechanism through which they are sensed is not clear. The aim of this work was to study the possible effect of ssODNs on plant immunity.
Key Results
The ssODNs IMT504 and 2006 increased protection against the pathogens Pseudomonas syringae pv. tomato DC3000 and Botrytis cinerea but not against tobacco mosaic virus-Cg when infiltrated in Arabidopsis thaliana. In addition, ssODNs inhibited root growth and promoted stomatal closure in a concentration-dependent manner, with half-maximal effective concentrations between 0.79 and 2.06 µm. Promotion of stomatal closure by ssODNs was reduced by DNase I treatment. It was also diminished by the NADPH oxidase inhibitor diphenyleneiodonium and by coronatine, a bacterial toxin that inhibits NADPH oxidase-dependent reactive oxygen species (ROS) synthesis in guard cells. In addition it was found that ssODN-mediated stomatal closure was impaired in bak1-5, bak1-5/bkk1, mpk3 and npr1-3 mutants. ssODNs also induced early expression of MPK3, WRKY33, PROPEP1 and FRK1 genes involved in plant defence, an effect that was reduced in bak1-5 and bak1-5/bkk1 mutants.
Conclusions
ssODNs are capable of inducing protection against pathogens through the activation of defence genes and promotion of stomatal closure through a mechanism similar to that of other elicitors of plant immunity, which involves the BAK1 co-receptor, and ROS synthesis.
Keywords: IMT504, 2006, DNA, plant immune system, Arabidopsis thaliana, elicitor, BAK1, stomatal immunity
INTRODUCTION
Nucleic acids trigger defence against pathogens in all kingdoms of life. Given that they are present in both the pathogen and the host during an infective process, these molecules have been proposed to act either as microbe-associated molecular patterns (MAMPs) or as damage-associated molecular patterns (DAMPs) (Heil, 2009; Gallucci and Maffei, 2017). In bacteria, recognition of foreign DNA by both restriction enzymes and clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease 9 (CRISPR-Cas) are involved in defence against bacteriophages (Garneau et al., 2010). The mechanisms of DNA recognition have been best characterized in mammals, where DNA perception promotes immunity against bacteria and viruses. The Toll-like receptor 9 (TLR9) is located in the endoplasmic reticulum and was shown to recognize DNA present in endosomes, which activates the production of pro-inflammatory cytokines (Latz et al., 2004a, b). This receptor preferentially recognizes single-stranded unmethylated CpG-rich DNA, although methylated single-stranded CpG DNA and double-stranded DNA (dsDNA) can also activate it less effectively (Hartmann and Krieg, 2000; Krieg, 2002; Ohto et al., 2015; Hartmann, 2017; Ohto et al., 2018). The CpG-rich single-stranded DNA oligodeoxynucleotide (ssODN) 2006 is a potent activator of TLR9 (Hartmann et al., 1999), while mammalian self-DNA bound to antibodies can be endocytosed and subsequently activates TLR9 (Ohto et al., 2015). It was also demonstrated that RNase 7, a 14.5-kDa antimicrobial ribonuclease constitutively expressed in the human epidermis, promotes self-DNA recognition in keratinocytes and activates antiviral immune responses in the skin (Kopfnagel et al., 2018). In addition, association mapping studies have linked mutations in the TLR9 promoter to inflammatory diseases (Demirci et al., 2007). DNA can also activate inflammatory and local antiviral responses in the cytoplasm of mammalian cells, where it can be present as a result of viral infection or upon extensive extracellular endocytosis, through the activation of different DNA receptors, such as cyclic GMP-AMP synthase-stimulator of interferon genes (sGAS-STING), Z-DNA-binding protein, the receptor for advanced glycation end-products (RAGE) and several receptors belonging to the PYHIN family (Sirois et al., 2013; Sun et al., 2013; Collins et al., 2015; Li and Chen, 2018). Non-CpG oligonucleotides containing a PyNTTTTGT motif, such as IMT504, have also been shown to stimulate B lymphocytes and plasmacytoid dendritic cells of the human immune system (Elias et al., 2003; Rodriguez et al., 2006). Both CpG- and non-CpG-containing oligonucleotides have been shown to improve the activity of vaccines targeting infectious diseases and cancer (Elias et al., 2005; Jahrsdörfer and Weiner, 2008; Bode et al., 2011; Montaner et al., 2012; Adamus and Kortylewski, 2018).
Double-stranded RNA (dsRNA) can also activate antiviral responses in the cytosol upon recognition by RIG1 and MDA5 proteins (Takeuchi and Akira, 2008a, b; Ablasser et al., 2009). RNA can also be recognized in the endolysosomal compartment by other members of the Toll-like family, TLR3, TLR7 and TLR8 (Gasser et al., 2017), and, based on genomic structure and sequence similarity, it has been proposed that TLR9 forms a subfamily with TLR7 and TLR8 (Chuang and Ulevitch, 2000; Du et al., 2000). It was demonstrated that single-stranded RNAs (ssRNAs) derived from human immunodeficiency virus-1 (HIV-1) are able to activate TLR7 and TLR8, stimulating dendritic cells and macrophages to secrete interferon α and cytokines as part of the defence response (Heil et al., 2004).
Like in animals, plant immunity is also activated by both DNA and RNA. Bacterial DNA was demonstrated to act as an effective elicitor in Arabidopsis thaliana plants, triggering reactive oxygen species (ROS) generation and callose deposition, an effect that was reduced by DNA CpG methylation (Yakushiji et al., 2009). It was also shown that the extracellular DNA present in pea root-cap slime is required for defence against a necrotrophic fungus (Wen et al., 2009). In agreement with this observation, the absence of a single gene encoding a candidate extracellular DNase from the fungal phytopathogen Cochliobolus heterostrophus results in reduced virulence (Park et al., 2019). Huang et al. (2019) have also reported a salivary DNase II from the insect Laodelphax striatellus that acts as an effector that suppresses plant defence.
Several studies have found evidence that self-DNA, or DNA of related species, is more active in triggering immunity than foreign DNA. Autotoxicity of aged litter has been linked to its content of fragmented DNA, since inhibition of root growth by self-DNA was stronger than inhibition by DNA from unrelated species (Mazzoleni et al., 2015a). Inhibition of growth by self-DNA but not by foreign DNA was also observed in bacteria, fungi, algae, protozoa and insects (Mazzoleni et al., 2015a, b). Similarly, it was found that leaf homogenates from common bean protected this species from the bacterial pathogen Pseudomonas syringae and induced H2O2 and extrafloral nectar production. Non-self homogenates also elicited common bean defences, but to a lesser extent (Duran-Flores and Heil, 2014). Similar results were obtained when fragmented self-DNA was used instead of leaf homogenates (Duran-Flores and Heil, 2018) or DNA. In lettuce it was also observed that self-DNA induced plant defences, induced changes in CpG methylation and inhibited seed germination and root growth to a higher extent than non-self-DNA (Vega-Muñoz et al., 2018). By contrast, non-self-DNA from phylogenetically distant plant species did not exhibit a protective role in lettuce. It was also shown that self-DNA was more effective than heterologous plant or insect DNA in inducing plasma membrane depolarization and calcium signalling in lima bean and maize (Barbero et al., 2016). RNA has also been shown to activate plant defences, since pre-infiltration of total RNAs from Pseudomonas syringae pv. tomato DC3000 (Pst DC3000), but not from A. thaliana, activated innate immunity in this plant, reducing susceptibility to both bacterial and fungal pathogens (Lee et al., 2016).
Unlike in mammals, the molecular basis of DNA perception in plants is not clear. It was found that nucleotide-binding leucine-rich repeat (NB-LRR) receptor I2 from tomato (Fenyk et al., 2016) and Rx1 from potato (Fenyk et al., 2015) can bind both double- and single-stranded DNA as well as ssRNA in vitro. Rx1 was shown to regulate the DNA-binding activity of a Golden2-like transcription factor (Townsend et al., 2018) and triggered immune responses leading to cell death after activation by a PVX virus capsid (Knip et al., 2019). However, neither I2 nor Rx1 has been linked to nucleic acid sensing in vivo.
Pattern-triggered immunity (PTI) allows plants to recognize MAMPs or DAMPs through pattern recognition receptors (PRRs), which leads to activation of basal resistance. PRRs are all cell-surface-localized receptors, receptor-like kinases (RLKs) or receptor-like proteins (RLPs). RLKs and RLPs differ in that the former possess a cytoplasmic kinase domain, while the latter do not (Saijo et al., 2018). BAK1 [BRASSINOSTEROID INSENSITIVE1 (BRI1)-ASSOCIATED RECEPTOR KINASE1] is an RLK belonging to the family of leucine-rich repeat like kinase (LRR-RLK) receptors and act as co-receptor, or adaptor, of several LRR-RLK receptors involved in MAMP and DAMP perception, such as FLAGELLIN SENSING2 (FLS2) flagellin receptor (Chinchilla et al., 2007a, b) and PEP RECEPTOR1 (PEPR1), which recognizes endogenous PROPEP peptide-derived DAMPs, including PEP1 (Huffaker et al., 2006). BAK1 belongs to a subfamily of LRR-RLKs that includes BAK1-LIKE1 (BKK1), which can also heterodimerize with FLS2 or PROPEP1 (Roux et al., 2011). BAK1 is shared by several signalling pathways controlling developmental as well as defence responses (reviewed in Chinchilla et al., 2009). Consistent with a role in plant immunity, plants depleted in BAK1 showed reduced responses to flg22 and exhibited more symptoms in response to virulent bacteria (Heese et al., 2007; Chinchilla et al., 2007b). BAK1 might be involved in sensing of dsRNA, since this nucleic acid has been shown to activate plant defence against oilseed rape mosaic virus (ORMV) in a BAK1-dependent manner (Niehl et al., 2016).
While the immunostimulatory effect of single-stranded DNA (ssDNA) has been well characterized in mammals, it has not been investigated in plants. In this work we found that ssODNs IMT504 and 2006, previously shown to activate immunity in mammalian cells, can protect A. thaliana from Botrytis cinerea and from Pst DC3000, but not from crucifer-infecting tobacco mosaic virus (TMV-Cg). Both IMT504 and 2006 promoted stomatal closure, activated expression of defence genes and inhibited root growth, in a BAK1-dependent manner.
MATERIALS AND METHODS
Plant material and growth conditions
Plants were grown in Petri dishes containing half-strength Murashige and Skoog (MS) medium with 1 % sucrose under a 12 h:12 h light/dark cycle (photon flux density 90 μE) at 22–23 °C. The relative humidity was maintained at 60–700 %. After a week plants were transferred to a mixture of vermiculite, peat moss and perlite (1:1:1). Experiments were performed using Arabidopsis thaliana ecotype Columbia-0 (Col-0) or the following mutants: npr1-3 (Cao et al., 1997), mpk3 (SALK_151594), bak1-5 (Nekrasov et al., 2009; Schwessinger et al., 2011) and bak1-5/bkk1 (Schwessinger et al., 2011).
Bacterial strain
Strain Pst DC3000 (Ma et al., 1991) was grown overnight at 28 °C in Luria–Bertani medium supplemented with kanamycin 50 μg/mL and rifampicin 50 μg/mL.
Bacterial infection assays
Oligonucleotides (4 μm), flg22 (1 μm) or sterile water (mock) were infiltrated into leaves from 4-week-old A. thaliana plants using a needleless syringe. Twenty-four hours after pretreatment, Pst DC3000 suspensions were sprayed on A. thaliana leaves as previously described (Macho et al., 2012). Briefly, cells were harvested by centrifugation, and pellets were resuspended in 10 mm MgCl2 at an OD600 of 0.1. Immediately prior to spraying, Silwet L-77 0.02 % (v/v) was added to the bacterial suspension. Bacteria were sprayed onto leaf surfaces, and plants were not covered. Four hours and 4 d post-inoculation (dpi), six 0.6-cm2 leaf discs (three discs per plant) per treatment were harvested and surface-sterilized (30 s in 70 % ethanol followed by 30 s in sterile distilled water). Leaf discs from two different plants were ground in 10 mm MgCl2 in a tube using a plastic pestle. After grinding, samples were serially diluted 1:10 and plated on PYM solid medium (Cadmus et al., 1976) supplemented with the appropriate antibiotics. Plates were placed at 28 °C for 2 d, after which the colony-forming units were counted.
Botrytis cinerea infection assay
Oligonucleotides (4 μm) or sterile water were infiltrated into 4-week-old A. thaliana leaves with a needleless syringe. Twenty-four hours after pretreatment, leaves were detached, placed on MS agar plates (without sucrose) and inoculated with conidial suspensions of B. cinerea isolate B05.10 (Rossi et al., 2011). The inoculum consisted of 5-µL droplets of a conidial suspension (5 × 105 conidia/mL) or medium alone (for mock treatment) prepared as previously described (Real et al., 2004; Flors et al., 2007). The adaxial surface of three fully expanded leaves per plant from four plants was inoculated with one droplet on the right side of the central vein and incubated in MS agar (without sucrose) in Petri dishes. Plates were sealed to maintain humidity. Symptoms were recorded and measured 48 h post-inoculation and the lesion area was measured using ImageJ software (Analyze tool).
Virus infection assays
The third oldest expanded leaf of each plant (1.08 stage) was dusted with carborundum. Subsequently, 5 μL of semipurified TMV-Cg virus (Asurmendi et al., 2004) diluted in 20 mM phosphate buffer (pH 7) was added and the surface of the leaf and was gently abraded. Mock-inoculated plants were buffer-rubbed. Samples of systemic leaves (half of rosette upper third oldest expanded leaf) were taken at 5 and 7 dpi. Leaves were frozen in individual tubes in liquid nitrogen and stored at −80 °C until RNA extraction. The TMV-Cg infection level was determined as relative accumulation of TMVCg-CP transcript by RT-qPCR. The following primers were used for qRT-PCR: TMVCg-CP FW, 5′ TGTCGCAATCGTATCAAAC 3′; TMVCg-CP RV, 5′ CTGTATCTGGAAACCGCTG 3′. Plants were infiltrated with distilled water or ssODN IMT504 (4 μm) 24 h before virus infection with TMVCg. Total RNA was isolated from frozen A. thaliana leaf tissues using Trizol Reagent (Thermo Fisher, USA) and subsequently treated with DNAse I (Thermo Fisher, USA). For mRNA detection, first-strand cDNA was synthesized using MMLV reverse transcriptase (Thermo Fisher, USA) according to the manufacturer’s instructions. All qRT-PCR experiments were carried out using an ABI Prism 7500 Real-Time PCR System (Applied Biosystems, USA), following MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) requirements. Ubiquitin5 (UBQ5, NM-116090) was used as an internal reference gene (FW, 5′ CGGACCAGCAGCGATTGATT 3′; RV, 5′ ACGGAGGACGAGATGAAGCG 3′).
Chemicals
Oligonucleotides (IMT 504, CATCATTTTGTCATTTTGT CATT; 2006, TCGTCGTTTTGTCGTTTTGT) were synthesized by IDT (Integrated DNA Technologies, USA) in both phosphodiester and phosphorothioate versions. In the latter case, all bonds between nucleotides were phosphorothioate. All ssODNs were solubilized in water. Abscisic acid (ABA, mixed isomers), coronatine and diphenyleneiodonium (DPI) were purchased from Sigma (USA), while flg22 was synthesized by GL Biochem (China) and PEP1 by Abbiotec (USA). PEP1 and ABA were dissolved in ethanol, coronatine in methanol and DPI in DMSO, taking care to maintain the final concentration of all solvents below 1 % (v/v). For root length and qRT-PCR experiments, phosphorothioate ssODNs were used, while phosphodiester ssODNs were used for the rest of the experiments.
RNA isolation and qRT-PCR
Gene expression assays were performed on RNA extracted from five 7-d-old seedlings grown in 1× MS liquid medium supplemented with 0.5 % sucrose (w/v) (Millet et al., 2010) (four biological replicates per treatment). Seedlings were incubated with H2O (control), 100 nm flg22 or phosphorothioate versions of the oligonucleotides (4 µm) for 4 h. Plant material was frozen in liquid nitrogen, and total RNA was extracted using Trizol Reagent (Thermo Fisher, USA) according to the manufacturer’s instructions. RNA samples were treated with RQ-1 DNA-free DNase I (Promega, USA) and quantified with a Nanodrop spectrophotometer (Biophotometer Plus, Eppendorf). Complementary DNA synthesis was performed using MMLV reverse transcriptase (Promega, USA) according to the manufacturer’s instructions. qRT-PCR experiments were carried out with a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). Elongation factor 1 (EF1) was used as an internal reference gene. Primers used for qRT-PCR were as follows: EF1c (At1g18070) FW, 5′ AGCACGCTCTTCTTGCTTTC 3′; RV, 5′ GGGTTGTATCCGACCTTCTTC 3′; MPK3 (At3g45640) FW, 5′ TCCCTGGTAAAGACCATGTTCA 3′; RV, 5′ TCGGTGTGCCAAGCAACTC 3′; WRKY33 (At2g38470) FW, 5′ TTCGTATGGCTGCTTCTTTTC 3′; RV, 5′ TGAGGTTTAGGATGGTTGTGG 3′; PROPEP 1 (At5g64900) FW, 5′ TGGCTCTACTCGTCACAACG 3′; RV, 5′ CAATGTAACTTAAAGTGCCTAATTATG 3′; and FRK1 (At2g19190) FW, 5′ CAGAAACAGCGCGAAACGA 3′; RV, 5′ GGTCGGGCGGTCTGAAA 3′. qRT-PCR data analysis was performed and primer efficiencies were obtained using LinReg PCR software (Ramakers et al., 2003). The EF1c gene was used to standardize the expression of a given target gene; a ratio between treatments was then calculated using the algorithm developed by Pfaffl (2001). Relative expression ratios were determined and statistical analysis was performed using the fgStatistics software interface (J. A. Di Rienzo, pers. comm., National University of Córdoba, Argentina). The cut-off for statistically significant differences was set at P < 0.05.
Stomatal aperture bioassays
Stomatal bioassays were performed as previously described (Gudesblat et al., 2009). Epidermal peels from Col-0 or mutant leaves of 4-week-old plants were floated on 10:10 buffer under light (10 mm KCl and 10 mm MES-KOH, pH 6.15) for 2.5 h, then ABA (20 µm), flg22 (5 µm), PEP1 (100 nm) or ssODNs IMT504 and 2006 at indicated concentrations were added to the incubation medium and peels were incubated for a further 1.5 h. DPI (20 µm) or coronatine (1.56 µm) was applied 30 min prior to addition of flg22, IMT504 or 2006. For the DNase I experiment, IMT504 (1 µg) was incubated with or without 1 µL (1 U) of RQ-DNase I (Promega, USA) in the reaction buffer supplied by the manufacturer for 30 min at 37 °C. Aliquots of the reactions were diluted in 10:10 buffer with the epidermal peels so that the final concentration of the initial input of IMT504 was 4 µm. Peels were also incubated with an identical volume of reaction buffer with DNase I as a control. EC50 values from dose–response curves were calculated using GraphPad Prism software (v5.01).
Root length measurements
Seedlings were grown on MS agar plates for 2 d and subsequently transferred to 1× MS liquid medium supplemented with 0.5 % sucrose (w/v) for a further 5 d in the presence of phosphorothioate versions of the ssODNs. Root length was measured with ImageJ software. Half-maximal effective concentration (EC50) values from concentration–response curves were calculated using GraphPad Prism software (v5.01).
RESULTS
ssODNs elicit plant innate immunity in A. thaliana
To investigate whether ssODNs are able to trigger plant defence, we performed a bacterial infection assay with Pst DC3000. Leaves from 4-week-old A. thaliana were infiltrated with the ssODNs IMT504 and 2006, the flagellin-derived peptide flg22 (Felix et al., 1999), or water as control. Plants were sprayed with Pst DC3000 24 h later. We observed that pretreatment with IMT504 or 2006 reduced pathogen growth to a similar extent as flg22 (Fig. 1A). A similar 24-h pretreatment with IMT504 or 2006 also conferred some protection against the necrotrophic fungus B. cinerea (Fig. 1B), thus showing that the assayed ssODNs elicit a defence response against these pathogens. Next, we studied whether IMT504 protects against TMV-Cg infection, by monitoring TMV-Cg coat protein (CgCP) mRNA accumulation through qPCR. Pretreatment with the ssODN failed to protect the plant against TMV-CG (Fig. 1C). Thus, the tested ssODNs confer protection against bacterial and fungal infections, but not against TMV-Cg.
Fig. 1.
ssODNs induce immunity against Pst DC3000 and B. cinerea but not against TMV-Cg in A. thaliana. (A) ssODNs protect from Pst DC3000. Col-0 plants were infiltrated with H2O (mock), flg22 (1 μm), IMT504 (4 μm) or 2006 (4 μm) 24 h prior to infection with Pst DC3000. Bacterial growth was measured at 0 and 4 dpi. CFU, colony-forming units. (B) ssODNs protect from B. cinerea. Col-0 plants were infiltrated with H2O (mock), IMT504 (4 μm) or 2006 (4 μm) 24 h prior to infection with B. cinerea, and lesion areas were measured 48 h after inoculation. (C) TMV-Cg accumulation 5 and 7 dpi in Col-0 plants pre-infiltrated 24 h before infection with IMT504 (4 μm) relative to H20 (mock) control. TMV-Cg infection was determined as relative accumulation of TMVCg-CP transcript by RT-qPCR. Different letters indicate statistically significant differences [P < 0.05, (A) two-way ANOVA, (B, C) one-way ANOVA]. Error bars represent the standard error from two biological replicates per treatment in three independent experiments (A), from 12 lesion replicates in three independent experiments and 30 replicates in one additional independent experiment (B), and from eight replicates in two independent experiments (C).
SSODNs inhibit root growth and promote stomatal closure in a BAK1-dependent manner
Elicitors capable of triggering PTI, such as flg22 (Zipfel et al., 2006; Bartels and Boller, 2015) as well as dsRNA (Niehl et al., 2016) and exogenous DNA (Mazzoleni et al., 2015b; Duran-Flores and Heil, 2018; Vega-Muñoz et al., 2018), have been shown to inhibit root growth. Therefore, we tested the effect of IMT504 and 2006 on root growth in A. thaliana seedlings. We found no effect on root growth with regular ssODNs; however, when IMT504 and 2006 with phosphorothioate instead of phosphodiester bonds were used we found that both inhibited root growth in a concentration-dependent manner, with EC50 1.037 and 2.06 µm, respectively (Fig. 2A). Phosphorothioate bonds render ssODNs resistant to nucleases (Wickstrom, 1986). Lack of effect of regular ssODNs with phosphodiester bonds might be due to nuclease degradation after prolonged incubation in culture medium. Promotion of stomatal closure is another common response triggered by different elicitors of plant defence, such as flg22 (Melotto et al., 2006; Zhang et al., 2008), chitin, chitosan (Lee et al., 1999; Gust et al., 2007; Amborabé et al., 2008) and PEP1(Zheng et al., 2018). For this reason, we tested the effect of ssODNs on stomata, and found that IMT504 and 2006 promoted stomatal closure in a concentration-dependent manner, with EC50 1.05 and 0.79 µm, respectively (Fig. 2B). Promotion of closure by IMT504 was strongly reduced by treatment with DNase I but not by the enzyme buffer alone (Fig. 2C), showing that ssODN integrity is required to elicit stomatal immunity. Next, we tested whether BAK1, an LRR-RLK protein that has been shown to act as co-receptor of multiple proteins involved in MAMP perception (Yasuda et al., 2017), is required for the effect of ssODNs. For this purpose we measured inhibition of root growth and promotion of stomatal closure in bak1-5 and bak1-5/bkk1 mutants, since BKK1 is a receptor similar to BAK1 and with partially redundant function (Roux et al., 2011). We found a partial reduction in inhibition of root growth by IMT504 in both mutants (Fig. 3A), and a strong reduction in promotion of stomatal closure (Fig. 3B). These results indicate that ssODNs activate responses similar to those of other MAMPs and require BAK1 to activate immune responses.
Fig. 2.
ssODNs inhibit root growth and promote stomatal closure in a concentration-dependent manner. (A) IMT504 and 2006 inhibit Col-0 root growth. Two-day-old seedlings were transferred for 5 d to liquid MS medium supplemented with IMT504 or 2006 at the indicated concentrations. (B) IMT504 and 2006 promote stomatal closure in Col-0. Stomatal apertures were measured 1.5 h after incubation with IMT504 or 2006 at the indicated concentrations. (C) DNase I treatment reduces promotion of stomatal closure by IMT504. A 30-min pretreatment of IMT504 with DNase I, but not with DNase I buffer alone, reduced its capacity to promote stomatal closure. IMT504 was used at 4 μm for the stomatal assay. Different letters indicate significant differences (P < 0.05, one-way ANOVA). Error bars represent the standard error from three independent trials (A, B); n = 5 (A) or n = 40 (B, C) per trial.
Fig. 3.
ssODNs inhibit root growth and promote stomatal closure in a BAK1-dependent manner. (A) bak1-5 and bak1-5/bkk1 mutants are less sensitive than Col-0 in inhibition of root growth by IMT504 and 2006. Two-day-old seedlings were incubated for 5 d in liquid MS medium supplemented with phosphorothioate IMT504 (4 μm) or 2006 (4 μm). (B) bak1-5 and bak1-5/bkk1 mutants fail to close stomata in response to IMT504 and 2006. Stomatal apertures were measured 1.5 h after incubation with H2O (mock), ABA (20 µm), flg22 (5 µm), PEP1 (100 nm), IMT504 (4 μm) or 2006 (4 μm). Different letters in (A) and (B) indicate significant differences (P < 0.05, two-way ANOVA). Error bars represent the standard error from three independent trials; n = 5 (A) or n = 40 (B) per trial.
Signalling elements involved in induction of defence by ssODNs
Reactive oxygen species produced by NADPH oxidase RBOHD are required for stomatal closure triggered by MAMPs (Torres and Dangl, 2005; Kadota et al., 2014; Toum et al., 2016). To find out whether NADPH oxidases are also involved in signalling downstream of ssODNs, we conducted stomatal assays in the presence of the NADPH oxidase inhibitor DPI. As shown in Fig. 4A, we found that DPI significantly reduced closure induced by IMT504 and 2006, consistent with an involvement of ROS in ssODN signalling. This possibility was further strengthened by the observation that coronatine, a bacterial toxin previously shown to inhibit ROS synthesis in guard cells (Toum et al., 2016), significantly inhibited ssODN-induced stomatal closure (Fig. 4B). We next investigated sensitivity to ssODNs of npr1-3 and mpk3 mutants, previously shown to be affected in promotion of stomatal closure by MAMPs such as flg22 (Macho et al., 2012), and found that both mutants were only partially insensitive to ssODNs. By contrast, they were completely insensitive to flg22, as previously reported. Together, these results indicate that ssODNs share signalling components with other MAMPs, such as flg22; however, the fact that npr1-3 and mpk3 mutants retain some sensitivity suggests that signalling cascades downstream of ssODNs and flg22 in guard cells are not identical.
Fig. 4.
Promotion of stomatal closure by ssODNs involves ROS production and is reduced in mpk3 and npr1-3 mutants. (A) DPI inhibits ssODN-induced stomatal closure. DPI (20 μm) was added to the incubation buffer 10 min prior to flg22 (5 μm), IMT504 (4 μm) or 2006 (4 μm). (B) Coronatine (COR, 1.56 μm) partially prevented stomatal closure induced by IMT504 (4 μm) and 2006 (4 μm). (C) npr1-3 and mpk3 mutants displayed reduced susceptibility to IMT504 and 2006. Epidermis was incubated with IMT504 (4 μm) and 2006 (4 μm) or flg22 (5 μm). Different letters indicate significant differences [P < 0.05 (A), (B) one-way ANOVA, Tukey’s test; (C) two-way ANOVA]. Error bars represent the standard error from three independent trials; n = 40 per trial in all experiments. Stomatal apertures were measured 1.5 h after application of the respective treatments.
Early defence-related genes are upregulated by ssODNs
Since ssODNs protected A. thaliana plants from pathogen attack, we investigated the induction of some genes involved in early plant defence. For this purpose, we treated 7-d-old wild-type, bak1 and bak1/bkk1 seedlings with ssODNs and measured expression of the pathogen-inducible genes MPK3 (Beckers et al., 2009), PROPEP1 (Huffaker et al., 2006), WRKY33 (Birkenbihl et al., 2012) and FRK1 (Boudsocq et al., 2010) by qRT-PCR 4 h post-incubation. All four genes were induced in response to IMT504 and 2006 in wild-type and to a lesser extent in bak1 and bak1/bkk1 mutants, albeit not in all cases with a statistically significant difference, consistent with a possible role of BAK1 in ssODN signalling (Fig. 5).
Fig. 5.
ssODNs induce defence-related genes MPK3, PROPEP1 and WRKY33. Arabidopsis thaliana 7-d-old seedlings were incubated in liquid MS medium with IMT504 (4 μm), 2006 (4 μm), flg22 (1 μm) or H2O (control, mock). Plants were harvested 4 h post-incubation and expression of MPK3, PROPEP1, WRKY33 and FRK1 was measured by qRT-PCR. Asterisks indicate significant differences relative to mock-treated plants (P < 0.05, permutation test, fgStatistics). Error bars represent the standard deviation from three independent trials with two biological replicates each. FC, fold change.
DISCUSSION
Previously it was demonstrated that DNA extracted from plants (Wen et al., 2009; Duran-Flores and Heil, 2014; Mazzoleni et al., 2015a, b; Barbero et al., 2016; Duran-Flores and Heil, 2018; Vega-Muñoz et al., 2018) or bacteria (Yakushiji et al., 2009) can activate plant defence against bacterial or fungal pathogens. In this work we showed that two ssODNs, CpG-rich 2006 and CpG-poor IMT504, can also activate plant immunity at concentrations in the low micromolar range, similar to those reported for other activators of plant immunity, such as several MAMPs and DAMPs. To our knowledge, this is the first report showing that synthetic ssDNA can activate plant immunity against bacterial and fungal pathogens. However, we failed to observe protection by the tested ssODNs against TMV-Cg, an ssRNA virus.
Induction of immunity in A. thaliana by IMT504 and 2006 has similarities with that elicited by other MAMPs, such as flagellin (Chinchilla et al., 2007a, b; Melotto et al., 2006), since both ssODNs promoted stomatal closure, inhibited root elongation and induced the transcription of defence genes. The three responses were reduced in bak1-5 and bak1-5/bkk1 mutants, in which co-receptors involved in the perception of various elicitors of plant defence are affected (Yasuda et al., 2017). These mutants were more markedly affected in promotion of stomatal closure and inhibition of root elongation, but their effect was not apparent in all cases in induction of gene expression. While the mechanism of DNA perception in plants is not clear, our results suggest that ssODNs are perceived by an LRR-RLK receptor that requires association with BAK1 co-receptor in order to activate a downstream signalling cascade. Consistent with this possibility, similar EC50s were observed for inhibition of root elongation and promotion of stomatal closure for both ssODNs, ranging from 0.791 to 2.06 µm. While flg22, a BAK1-dependent elicitor of plant immunity, has been shown to induce extracellular alkalinization with an EC50 close to 1 nm (Chinchilla et al., 2006), the same ligand only promoted stomatal closure at concentrations of 1 µm and higher (Melotto et al., 2006) and inhibited seedling growth with an EC50 close to 0.1 µm (Gomez-Gomez et al., 1999). As a reference, an EC50 close to 1 µm has been observed for NF-κB activation by 2006 in HEK293 cells expressing TLR9 (Latz et al., 2004a), although different reports describing activation of different immune responses in mammalian cells by ssDNA or dsDNA report concentrations from low nanomolar to over 100 µm (reviewed in Heil and Vega-Muñoz, 2019). In plants, the potato NB domain of the NLR R1 receptor was shown to bind to ssDNA, dsDNA and ssRNA in vitro, with dissociation constants (Kd) of 3.34, 2.75 and 12.45 µm respectively (Fenyk et al., 2015); however, this receptor has not been linked to DNA perception in vivo. Like ssODNs, dsRNA also stimulates immunity against ORMV, a dsRNA virus, in a BAK1-dependent manner (Niehl et al., 2016), indicating that, like ssODNs, dsRNAs could also be perceived by an LRR that requires BAK1 as co-receptor. The integrity of ssODNs is required for their effect, since DNase treatment abolished most of its activity.
Previously it has been shown that A. thaliana sonicated genomic self-DNA almost completely stopped root growth, while Lepidium sativum heterologous DNA only reduced it by around 10 % in the same plant (Mazzoleni et al., 2015b). In our experiments both ssODNs reduced growth by around 50 % at the highest concentration used, but only when phosphorothioate versions were used. No inhibition of growth was observed with phosphodiester ssODNs, suggesting that they could be degraded during incubation. It is difficult to make comparisons between the two experiments, since the mechanism of perception of genomic DNA and ssODNs could not be identical. Nevertheless, it would be interesting in the future to study the effect of synthetic double and single DNAs of diverse sequence to better understand the molecular mechanism underlying the differential perception of self and heterologous DNA.
It has been proposed that dsDNA acts as a DAMP in plants (Yakushiji et al., 2009; Gallucci and Maffei, 2017; Vega-Muñoz et al., 2018). ssDNA is not normally found inside plants; however, given that the TLR9 mammalian receptor can be activated by both ssDNA and dsDNA (Rigby et al., 2014; Gasser et al., 2017), it could be possible that a similar receptor is responsible for the perception of both kinds of molecule in plants. Alternatively, ssDNA perception could have evolved as a mechanism of defence against ssDNA viruses such as geminiviruses, members of the Geminiviridae family.
Signalling downstream of MAMPs whose perception depends on LRR receptors that associate with BAK1, such as flg22 and elf18 (Chinchilla et al., 2007b; Nekrasov et al., 2009), is completely dependent on ROS production by RBOHD (Kadota et al., 2014). Promotion of stomatal closure by ssODNs was only partially reduced by DPI, an NADPH oxidase inhibitor, or in mpk3 and npr1-3, two mutants completely insensitive to flg22 that are presumably affected downstream of ROS in the signalling cascade (Toum et al., 2016). Further evidence that ROS are involved in ssODN signalling arises from the fact that promotion of closure by these molecules is reduced by coronatine, a bacterial toxin that affects ROS production in guard cells (Toum et al., 2016). Therefore, it seems likely that signalling cascades for flg22 and ssODNs share some elements, but do not overlap completely. More research is needed to find out which are the ROS-independent signalling events triggered by ssODNs.
In this work, we reported that two ssODNs previously shown to stimulate immunity in mammals, CpG-rich 2006 and CpG-poor IMT504, could also elicit plant defence. Further research using ssODNs with different sequences should reveal whether there is any specificity in sequence recognition, as suggested by previous findings showing that plants and other organisms preferentially activate their defences in response to foreign DNA (Vega-Muñoz et al., 2018). The use of synthetic oligonucleotides could shed light on the mechanism of stimulation of immunity by DNA, which might be a promising tool for crop protection and plant disease management.
ACKNOWLEDGEMENTS
A.A.V., G.E.G., G.C. and S.A. are Career Investigators of CONICET. L.T., F.C.G. and V.P.C. were supported by doctoral and postdoctoral scholarships from CONICET. L.T. designed and performed the experiments, compiled the data and designed the figures; G.C. and S.A. designed and performed the virus experiment. F.C.G., V.P.C. and F.A.G. collaborated with manuscript writing; A.V. and G.E.G. supervised the experiments; L.T. and G.E.G. wrote the article and conceived the project. All authors read and approved the manuscript.
FUNDING
This work was supported by Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT) (grants PICT 2013 no. 1045, PICT 2015 no. 3286, PICT 2017 no. 2320 and PICT 2017 no. 2075) and by Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) (grants PIP 2012 no. 00677 and PIP 2015 no. 00903).
LITERATURE CITED
- Ablasser A, Bauernfeind F, Hartmann G, Latz E, Fitzgerald KA, Hornung V. 2009. RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate. Nature Immunology 10: 1065–1072. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Adamus T, Kortylewski M. 2018. The revival of CpG oligonucleotide-based cancer immunotherapies. Contemporary Oncology 22: 56–60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Amborabé BE, Bonmort J, Fleurat-Lessard P, Roblin G. 2008. Early events induced by chitosan on plant cells. Journal of Experimental Botany 59: 2317–2324. [DOI] [PubMed] [Google Scholar]
- Asurmendi S, Berg RH, Koo JC, Beachy RN. 2004. Coat protein regulates formation of replication complexes during tobacco mosaic virus infection. Proceedings of the National Academy of Sciences of the USA 101: 1415–1420. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Barbero F, Guglielmotto M, Capuzzo A, Maffei ME. 2016. Extracellular self-DNA (esDNA), but not heterologous plant or insect DNA (etDNA), induces plasma membrane depolarization and calcium signaling in lima bean (Phaseolus lunatus) and maize (Zea mays). International Journal of Molecular Sciences 17: 1659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bartels S, Boller T. 2015. Quo vadis, Pep? Plant elicitor peptides at the crossroads of immunity, stress, and development. Journal of Experimental Botany 66: 5183–5193. [DOI] [PubMed] [Google Scholar]
- Beckers GJ, Jaskiewicz M, Liu Y, et al. 2009. Mitogen-activated protein kinases 3 and 6 are required for full priming of stress responses in Arabidopsis thaliana. The Plant Cell 21: 944–953. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Birkenbihl RP, Diezel C, Somssich IE. 2012. Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection. Plant Physiology 159: 266–285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bode C, Zhao G, Steinhagen F, Kinjo T, Klinman DM. 2011. CpG DNA as a vaccine adjuvant. Expert Review of Vaccines 10: 499–511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Boudsocq M, Willmann MR, McCormack M, et al. 2010. Differential innate immune signalling via Ca(2+) sensor protein kinases. Nature 464: 418–422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cadmus MC, Rogovin SP, Burton KA, Pittsley JE, Knutson CA, Jeanes A. 1976. Colonial variation in Xanthomonas campestris NRRL B-1459 and characterization of the polysaccharide from a variant strain. Canadian Journal of Microbiology 22: 942–948. [DOI] [PubMed] [Google Scholar]
- Cao H, Glazebrook J, Clarke JD, Volko S, Dong X. 1997. The Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57–63. [DOI] [PubMed] [Google Scholar]
- Collins AC, Cai H, Li T, et al. 2015. Cyclic GMP-AMP synthase is an innate immune DNA sensor for Mycobacterium tuberculosis. Cell Host & Microbe 17: 820–828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chinchilla D, Bauer Z, Regenass M, Boller T, Felix G. 2006. The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. The Plant Cell 18: 465–476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chinchilla D, Boller T, Robatzek S. 2007a Flagellin signalling in plant immunity. Advances in Experimental Medicine and Biology 598: 358–371. [DOI] [PubMed] [Google Scholar]
- Chinchilla D, Zipfel C, Robatzek S, et al. 2007. b A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature 448: 497–500. [DOI] [PubMed] [Google Scholar]
- Chinchilla D, Shan L, He P, de Vries S, Kemmerling B. 2009. One for all: the receptor-associated kinase BAK1. Trends in Plant Science 14: 535–541. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chuang TH, Ulevitch RJ. 2000. Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9. European Cytokine Network 11: 372–378. [PubMed] [Google Scholar]
- Demirci FY, Manzi S, Ramsey-Goldman R, et al. 2007. Association study of Toll-like receptor 5 (TLR5) and Toll-like receptor 9 (TLR9) polymorphisms in systemic lupus erythematosus. Journal of Rheumatology 34: 1708–1711. [PubMed] [Google Scholar]
- Du X, Poltorak A, Wei Y, Beutler B. 2000. Three novel mammalian toll-like receptors: gene structure, expression, and evolution. European Cytokine Network 11: 362–371. [PubMed] [Google Scholar]
- Duran-Flores D, Heil M. 2014. Damaged-self recognition in common bean (Phaseolus vulgaris) shows taxonomic specificity and triggers signaling via reactive oxygen species (ROS). Frontiers in Plant Science 5: 585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Duran-Flores D, Heil M. 2018. Extracellular self-DNA as a damage-associated molecular pattern (DAMP) that triggers self-specific immunity induction in plants. Brain, Behavior, and Immunity 72: 78–88. [DOI] [PubMed] [Google Scholar]
- Elias F, Flo J, Lopez RA, Zorzopulos J, Montaner A, Rodriguez JM. 2003. Strong cytosine-guanosine-independent immunostimulation in humans and other primates by synthetic oligodeoxynucleotides with PyNTTTTGT motifs. Journal of Immunology 171: 3697–3704. [DOI] [PubMed] [Google Scholar]
- Elias F, Flo J, Rodriguez JM, et al. 2005. PyNTTTTGT prototype oligonucleotide IMT504 is a potent adjuvant for the recombinant hepatitis B vaccine that enhances the Th1 response. Vaccine 23: 3597–3603. [DOI] [PubMed] [Google Scholar]
- Felix G, Duran JD, Volko S, Boller T. 1999. Plants have a sensitive perception system for the most conserved domain of bacterial flagellin. The Plant Journal 18: 265–276. [DOI] [PubMed] [Google Scholar]
- Fenyk S, Townsend PD, Dixon CH, et al. 2015. The potato nucleotide-binding leucine-rich repeat (NLR) immune receptor Rx1 is a pathogen-dependent DNA-deforming protein. Journal of Biological Chemistry 290: 24945–24960. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fenyk S, Dixon CH, Gittens WH, et al. 2016. The tomato nucleotide-binding leucine-rich repeat immune receptor I-2 couples DNA-binding to nucleotide-binding domain nucleotide exchange. Journal of Biological Chemistry 291: 1137–1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flors V, Leyva MD, Vicedo B, et al. 2007. Absence of the endo-beta-1,4-glucanases Cel1 and Cel2 reduces susceptibility to Botrytis cinerea in tomato. The Plant Journal 52: 1027–1040. [DOI] [PubMed] [Google Scholar]
- Gallucci S, Maffei ME. 2017. DNA sensing across the Tree of Life. Trends in Immunology 38: 719–732. [DOI] [PubMed] [Google Scholar]
- Garneau JE, Dupuis MÈ, Villion M, et al. 2010. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468: 67–71. [DOI] [PubMed] [Google Scholar]
- Gasser S, Zhang WYL, Tan NYJ, et al. 2017. Sensing of dangerous DNA. Mechanisms of Ageing and Development 165: 33–46. [DOI] [PubMed] [Google Scholar]
- Gómez-Gómez L, Felix G, Boller T. 1999. A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana. The Plant Journal 18: 277–284. [DOI] [PubMed] [Google Scholar]
- Gudesblat GE, Torres PS, Vojnov AA. 2009. Xanthomonas campestris overcomes Arabidopsis stomatal innate immunity through a DSF cell-to-cell signal-regulated virulence factor. Plant Physiology 149: 1017–1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gust AA, Biswas R, Lenz HD, et al. 2007. Bacteria-derived peptidoglycans constitute pathogen-associated molecular patterns triggering innate immunity in Arabidopsis. Journal of Biological Chemistry 282: 32338–32348. [DOI] [PubMed] [Google Scholar]
- Hartmann G. 2017. Nucleic acid immunity. Advances in Immunology 133: 121–169. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hartmann G, Krieg AM. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. Journal of Immunology 164: 944–953. [DOI] [PubMed] [Google Scholar]
- Hartmann G, Weiner GJ, Krieg AM. 1999. CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells. Proceedings of the National Academy of Sciences of the USA 96: 9305–9310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heese A, Hann DR, Gimenez-Ibanez S, et al. 2007. The receptor-like kinase SERK3/BAK1 is a central regulator of innate immunity in plants. Proceedings of the National Academy of Sciences of the USA 104: 12217–12222. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heil F, Hemmi H, Hochrein H, et al. 2004. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Science 303: 1526–1529. [DOI] [PubMed] [Google Scholar]
- Heil M. 2009. Damaged-self recognition in plant herbivore defence. Trends in Plant Science 14: 356–363. [DOI] [PubMed] [Google Scholar]
- Heil M, Vega-Muñoz I. 2019. Nucleic acid sensing in mammals and plants: facts and caveats. International Review of Cell and Molecular Biology 345: 225–285. [DOI] [PubMed] [Google Scholar]
- Huang HJ, Cui JR, Xia X, et al. 2019. Salivary DNase II from Laodelphax striatellus acts as an effector that suppresses plant defence. New Phytologist 224: 860–874. [DOI] [PubMed] [Google Scholar]
- Huffaker A, Pearce G, Ryan CA. 2006. An endogenous peptide signal in Arabidopsis activates components of the innate immune response. Proceedings of the National Academy of Sciences of the USA 103: 10098–10103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jahrsdörfer B, Weiner GJ. 2008. CpG oligodeoxynucleotides as immunotherapy in cancer. Update on Cancer Therapeutics 3: 27–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kadota Y, Sklenar J, Derbyshire P, et al. 2014. Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. Molecular Cell 54: 43–55. [DOI] [PubMed] [Google Scholar]
- Knip M, Richard MMS, Oskam L, van Engelen HTD, Aalders T, Takken FLW. 2019. Activation of immune receptor Rx1 triggers distinct immune responses culminating in cell death after 4 hours. Molecular Plant Pathology 20: 575–588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kopfnagel V, Wagenknecht S, Harder J, et al. 2018. RNase 7 strongly promotes TLR9-mediated DNA sensing by human plasmacytoid dendritic cells. Journal of Investigative Dermatology 138: 872–881. [DOI] [PubMed] [Google Scholar]
- Krieg AM. 2002. CpG motifs in bacterial DNA and their immune effects. Annual Review of Immunology 20: 709–760. [DOI] [PubMed] [Google Scholar]
- Latz E, Schoenemeyer A, Visintin A, et al. 2004. a TLR9 signals after translocating from the ER to CpG DNA in the lysosome. Nature Immunology 5: 190–198. [DOI] [PubMed] [Google Scholar]
- Latz E, Visintin A, Espevik T, Golenbock DT. 2004b Mechanisms of TLR9 activation. Journal of Endotoxin Research 10: 406–412. [DOI] [PubMed] [Google Scholar]
- Lee S, Choi H, Suh S, et al. 1999. Oligogalacturonic acid and chitosan reduce stomatal aperture by inducing the evolution of reactive oxygen species from guard cells of tomato and Commelina communis. Plant Physiology 121: 147–152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lee B, Park YS, Lee S, Song GC, Ryu CM. 2016. Bacterial RNAs activate innate immunity in Arabidopsis. New Phytologist 209: 785–797. [DOI] [PubMed] [Google Scholar]
- Li T, Chen ZJ. 2018. The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer. Journal of Experimental Medicine 215: 1287–1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma H, Yanofsky MF, Huang H. 1991. Isolation and sequence analysis of TGA1 cDNAs encoding a tomato G protein alpha subunit. Gene 107: 189–195. [DOI] [PubMed] [Google Scholar]
- Macho AP, Boutrot F, Rathjen JP, Zipfel C. 2012. Aspartate oxidase plays an important role in Arabidopsis stomatal immunity. Plant Physiology 159: 1845–1856. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mazzoleni S, Bonanomi G, Incerti G, et al. 2015. a Inhibitory and toxic effects of extracellular self-DNA in litter: a mechanism for negative plant-soil feedbacks? New Phytologist 205: 1195–1210. [DOI] [PubMed] [Google Scholar]
- Mazzoleni S, Cartenì F, Bonanomi G, et al. 2015. b Inhibitory effects of extracellular self-DNA: a general biological process? New Phytologist 206: 127–132. [DOI] [PubMed] [Google Scholar]
- Melotto M, Underwood W, Koczan J, Nomura K, He SY. 2006. Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969–980. [DOI] [PubMed] [Google Scholar]
- Millet YA, Danna CH, Clay NK, et al. 2010. Innate immune responses activated in Arabidopsis roots by microbe-associated molecular patterns. The Plant Cell 22: 973–990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Montaner A, De Nichilo A, Rodrìguez JM et al. 2012. IMT504: a new and potent adjuvant for rabies vaccines permitting significant dose sparing. World Journal of Vaccines 2: 182–188. [Google Scholar]
- Nekrasov V, Li J, Batoux M, et al. 2009. Control of the pattern-recognition receptor EFR by an ER protein complex in plant immunity. EMBO Journal 28: 3428–3438. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niehl A, Wyrsch I, Boller T, Heinlein M. 2016. Double-stranded RNAs induce a pattern-triggered immune signaling pathway in plants. New Phytologist 211: 1008–1019. [DOI] [PubMed] [Google Scholar]
- Ohto U, Shibata T, Tanji H, et al. 2015. Structural basis of CpG and inhibitory DNA recognition by Toll-like receptor 9. Nature 520: 702–705. [DOI] [PubMed] [Google Scholar]
- Ohto U, Ishida H, Shibata T, Sato R, Miyake K, Shimizu T. 2018. Toll-like receptor 9 contains two DNA binding sites that function cooperatively to promote receptor dimerization and activation. Immunity 48: 649–658 e4. [DOI] [PubMed] [Google Scholar]
- Park HJ, Wang W, Curlango-Rivera G et al. 2019. A DNase from a fungal phytopathogen is a virulence factor likely deployed as counter defense against host-secreted extracellular DNA. MBio 10: e02805–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29: e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramakers C, Ruijter JM, Deprez RH, Moorman AF. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neuroscience Letters 339: 62–66. [DOI] [PubMed] [Google Scholar]
- Real MD, Company P, García-Agustín P, Bennett AB, González-Bosch C. 2004. Characterization of tomato endo-beta-1,4-glucanase Cel1 protein in fruit during ripening and after fungal infection. Planta 220: 80–86. [DOI] [PubMed] [Google Scholar]
- Rigby RE, Webb LM, Mackenzie KJ, et al. 2014. RNA:DNA hybrids are a novel molecular pattern sensed by TLR9. EMBO Journal 33: 542–558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rodriguez JM, Elías F, Fló J, López RA, Zorzopulos J, Montaner AD. 2006. Immunostimulatory PyNTTTTGT oligodeoxynucleotides: structural properties and refinement of the active motif. Oligonucleotides 16: 275–285. [DOI] [PubMed] [Google Scholar]
- Rossi FR, Gárriz A, Marina M, et al. 2011. The sesquiterpene botrydial produced by Botrytis cinerea induces the hypersensitive response on plant tissues and its action is modulated by salicylic acid and jasmonic acid signaling. Molecular Plant-Microbe Interactions 24: 888–896. [DOI] [PubMed] [Google Scholar]
- Roux M, Schwessinger B, Albrecht C, et al. 2011. The Arabidopsis leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are required for innate immunity to hemibiotrophic and biotrophic pathogens. The Plant Cell 23: 2440–2455. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saijo Y, Loo EP, Yasuda S. 2018. Pattern recognition receptors and signaling in plant-microbe interactions. The Plant Journal 93: 592–613. [DOI] [PubMed] [Google Scholar]
- Schwessinger B, Roux M, Kadota Y, et al. 2011. Phosphorylation-dependent differential regulation of plant growth, cell death, and innate immunity by the regulatory receptor-like kinase BAK1. PLoS Genetics 7: e1002046. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sirois CM, Jin T, Miller AL, et al. 2013. RAGE is a nucleic acid receptor that promotes inflammatory responses to DNA. Journal of Experimental Medicine 210: 2447–2463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun L, Wu J, Du F, Chen X, Chen ZJ. 2013. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339: 786–791. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takeuchi O, Akira S. 2008a MDA5/RIG-I and virus recognition. Current Opinion in Immunology 20: 17–22. [DOI] [PubMed] [Google Scholar]
- Takeuchi O, Akira S. 2008b RIG-I-like antiviral protein in flies. Nature Immunology 9: 1327–1328. [DOI] [PubMed] [Google Scholar]
- Torres MA, Dangl JL. 2005. Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Current Opinion in Plant Biology 8: 397–403. [DOI] [PubMed] [Google Scholar]
- Toum L, Torres PS, Gallego SM, Benavídes MP, Vojnov AA, Gudesblat GE. 2016. Coronatine inhibits stomatal closure through guard cell-specific inhibition of NADPH oxidase-dependent ROS production. Frontiers in Plant Science 7: 1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Townsend PD, Dixon CH, Slootweg EJ, et al. 2018. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor. Journal of Biological Chemistry 293: 3218–3233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vega-Muñoz I, Feregrino-Pérez A, Torres-Pacheco I, Guevara-González R. 2018. Exogenous fragmented DNA acts as a damage-associated molecular pattern (DAMP) inducing changes in CpG DNA methylation and defence-related responses in Lactuca sativa. Functional Plant Biology, 45: 1065–1072. [DOI] [PubMed] [Google Scholar]
- Wen F, White GJ, VanEtten HD, Xiong Z, Hawes MC. 2009. Extracellular DNA is required for root tip resistance to fungal infection. Plant Physiology 151: 820–829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wickstrom E. 1986. Oligodeoxynucleotide stability in subcellular extracts and culture media. Journal of Biochemical and Biophysical Methods 13: 97–102. [DOI] [PubMed] [Google Scholar]
- Yakushiji S, Ishiga Y, Inagaki Y, Toyoda K, Shiraishi T, Ichinose Y. 2009. Bacterial DNA activates immunity in Arabidopsis thaliana. Journal of General Plant Pathology 75: 227–234. [Google Scholar]
- Yasuda S, Okada K, Saijo Y. 2017. A look at plant immunity through the window of the multitasking coreceptor BAK1. Current Opinion in Plant Biology 38: 10–18. [DOI] [PubMed] [Google Scholar]
- Zhang W, He SY, Assmann SM. 2008. The plant innate immunity response in stomatal guard cells invokes G-protein-dependent ion channel regulation. The Plant Journal 56: 984–996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zheng X, Kang S, Jing Y, et al. 2018. Danger-associated peptides close stomata by OST1-independent activation of anion channels in guard cells. The Plant Cell 30: 1132–1146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zipfel C, Kunze G, Chinchilla D, et al. 2006. Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation. Cell 125: 749–760. [DOI] [PubMed] [Google Scholar]





