Skip to main content
Veterinary World logoLink to Veterinary World
. 2020 Jul 9;13(7):1294–1302. doi: 10.14202/vetworld.2020.1294-1302

Clinicopathological and molecular profiles of Babesia vogeli infection and Ehrlichia canis coinfection

Thanakorn Rawangchue 1, Sivapong Sungpradit 1,2,
PMCID: PMC7429385  PMID: 32848303

Abstract

Background and Aim:

Canine babesiosis, a tick-borne parasitic disease, is caused by the hemoprotozoa, Babesia vogeli, and Babesia gibsoni. Infection with these parasites, which is endemic globally, leads to life-threatening immunosuppression in dogs. The merozoites invade the red blood cells (RBCs) of infected dogs. Ehrlichia canis, an intracellular bacterium that infects monocytes, is transmitted by the same tick species (Rhipicephalus sanguineus) during blood consumption and coinfection with B. vogeli and E. canis has been reported. Although the hematology and biochemistry of canine babesiosis have been studied, more studies are needed to develop a better understanding of the hematobiochemical and molecular profiles associated with cases of single infection and coinfection of canine babesiosis in Thailand. This study aimed to investigate the hematological, biochemical, and molecular profiles of B. vogeli infection and E. canis coinfection.

Materials and Methods:

The study included 33 B. vogeli–positive blood samples and 11 E. canis–coinfected blood samples. To exclude coinfection with Hepatozoon canis and Anaplasma platys, only dogs with B. vogeli infection and B. vogeliE. canis coinfection were included in the study. A multiplex polymerase chain reaction (PCR) assay was conducted to detect B. vogeli, E. canis, and H. canis, and a conventional PCR assay was conducted for the detection of A. platys. Besides, the PCR assay and sequencing, comprehensive data analysis was conducted, including a microscopic blood parasite examination and hematological and biochemical data analysis.

Results:

The comparison of the hematobiochemical data between the B. vogeli–positive and E. canis coinfection groups identified that there were statistically significant differences in the RBC parameters, including RBC count, hemoglobin concentration, hematocrit, and RBC distribution width (p=0.001). Neither B. vogeli infection nor coinfection with E. canis was associated with the sex, breed, recorded clinical signs, geographic origin of the dog and also B. vogeli 18S rRNA gene sequencing results.

Conclusion:

Coinfection with E. canis increased the severity of babesiosis. The pathogenic mechanisms underlying this infection, such as destruction of RBCs, require further investigation. This study may enhance diagnosis, treatment, and prevention of canine babesiosis.

Keywords: 18S rRNA gene, Babesia vogeli, coinfection, Ehrlichia canis, hematobiochemical data, red blood cell

Introduction

Canine babesiosis, which occurs worldwide, is a tick-borne disease caused by the small (Babesia gibsoni, Babesia conradae, and Babesia vulpes) and large (Babesia vogeli, Babesia canis, and Babesia rossi) Babesia groups [1-3] and is a life-threatening condition for dogs [4]. The previous studies have reported the sizes of the small and large intraerythrocytic-stage merozoites as measuring 1×3 μm and 2-2.5×4.5-5 μm in size, respectively [5,6]. The trophozoite and merozoite morphology in red blood cells (RBCs) is typically ring-shaped and forms pyriform bodies, respectively [7]. The main species of canine babesiosis in Thailand is B. vogeli, carried by Rhipicephalus sanguineus, which is commonly known as the brown dog tick [8-12].

Babesia-infected dogs may be asymptomatic [8] or present with various clinical signs that range from mild to peracute and deadly. Clinical manifestations include anorexia, lethargy, fever, pale mucous membrane, jaundice, and renal disease [13-15], depending on the parasite and the host’s, age, sex, and breed [12,16]. Natural and experimental in vivo infections with B. vogeli have shown subclinical signs. In immunosuppressed animals, such as splenectomized dogs, the pathogen causes severe acute infection, which is followed by fever, anorexia, malaise, regenerative anemia, thrombocytopenia, and increased white blood cell (WBC) count [6,17]. By contrast, many studies have reported that there are decreased numbers of WBC in dogs with canine babesiosis [18,19]. A retrospective canine babesiosis study in the Small Animal Teaching Hospital of Chulalongkorn University in Thailand found that hypocytic hypochromic anemia and thrombocytopenia were the major clinical hematological findings in dogs with canine babesiosis [20]. However, other studies have shown the occurrence of macrocytic hyperchromic anemia in canine babesiosis [18,19]. Hematological profiles of canines with coinfections of BabesiaEhrlichia have been studied in South Africa, but the prevalence of coinfection in South Africa is low and the main hemoprotozoan species is B. rossi [21]. Although coinfections have frequently been reported in Thailand in the literature describing the canine hemoparasite prevalence [9,10,22], information about the hematobiochemical patterns of the infection and the molecular diversity of B. vogeli and Ehrlichia canis coinfection remains lacking.

This study aimed to investigate 44 Babesia-positive blood samples, including samples that had a single infection with Babesia and samples that had BabesiaEhrlichia concurrent infections that were confirmed by microscopic and molecular examinations. Comprehensive and hematobiochemical data were analyzed, and Babesia 18S rRNA and Ehrlichia 16S rRNA genes were sequenced for the identification of Babesia subspecies, as well as for the genetic variation of both hemoparasites.

Materials and Methods

Ethical approval

The study protocol (no. MUVS-2018-12-66) was approved by the Faculty of Veterinary Science-Animal Care and Use Committee (FVS-ACUC), Mahidol University, Thailand.

Comprehensive data collection

Retrospective comprehensive data, including signalment (age, sex, breed, and geographic origin), recorded clinical signs, and hematobiochemical profiles, from 44 dogs were gathered from medical records provided by Prasu-Arthorn Animal Teaching Hospital, Mahidol University, on the 1st day of registration, between February and December 2019. A map showing the provinces in Thailand where the babesiosis cases were located was drawn using a template obtained from www.simplemaps.com (Figure-1).

Figure-1.

Figure-1

Geographic distribution of the babesiosis cases in this study.

Blood sample preparation

The blood samples (1 mL) were obtained from Prasu-Arthorn Animal Teaching Hospital, Faculty of Veterinary Science, Mahidol University, Salaya Campus, Nakhon Pathom, Thailand. The samples were drawn from the cephalic or saphenous veins of the dogs and preserved in ethylenediaminetetraacetic acid in plain tubes for hematobiochemical analysis. Thin buffy coat smears were prepared and stained using Giemsa solution and sent to the laboratory of the parasitology unit for routine microscopic detection. Thirty-three Babesia– positive samples and 11 samples that had BabesiaEhrlichia coinfection were identified and further confirmed by molecular examination.

DNA preparation

DNA was isolated from 200 μL of blood from samples positive for Babesia and BabesiaEhrlichia coinfection using a NucleoSpin Blood Kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany), according to the manufacturer’s instructions. Briefly, 200 μL of blood sample were incubated with 25 μL proteinase K and 200 μL of binding buffer at 70°C for 15 min. DNA was eluted in 50 μL of elution buffer preheated at 70°C. It was then stored at −20°C until use.

B. vogeli and B. vogeli–E. canis coinfection 18S rRNA gene amplification and sequencing

DNA isolated from blood samples was used as a template to amplify the majority of the 18S rRNA genes of Babesia spp. using multiplex polymerase chain reaction (PCR) [23] to verify B. vogeli and E. canis and exclude Hepatozoon canis infections in the samples.

The multiplex PCR amplifications were conducted using 5 μL of genomic DNA with the primers Ba103F, Ba721R, Ehr1401F, Ehr1780R, Hep001F, and Hep737R. The PCR reactions contained 5 μL total DNA template, 20 μL of the reagents which composed of 0.4 pmol of each primer, and 300 μM of each deoxyribonucleotide triphosphate (dNTP), four units of HotStarTaq DNA Polymerase (QIAGEN, Hilden, Germany), 1X PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl), 1.5 mM MgCl2, and RNase-free water to a total volume of 25 μL. The reactions were conducted in a S1000 Thermal Cycler (Bio-Rad, Hercules, CA, USA), with the following steps: 15 min at 95°C; 30 cycles of 45 s at 94°C, 45 s at 65°C, and 90 s at 72°C; and 10 min at 72°C. The PCR products were examined through gel electrophoresis on a 2.5% agarose gel stained with GelRed (Biotium, Hayward, CA, USA) and visualized under ultraviolet (UV) light (GeneGenius, Cambridge, UK). The amplicons (619 base pairs) were then purified using QIAquick PCR purification kits (QIAGEN Inc., Valencia, CA, USA), according to the manufacturer’s protocol. Bidirectional sequencing of all PCR products was conducted using First BASE Laboratories (Selangor, Malaysia). The DNA sequences were then analyzed using an ABI 3730xl sequencer (Applied Biosystems, Foster City, CA, USA) with fluorescent dye terminator sequencing. The DNA sequencing was conducted using the Babesia-specific primers Ba103F and Ba721R.

Anaplasma platys conventional PCR

Conventional PCR for the detection of A. platys was used to exclude A. platys coinfection. The reactions were conducted using 5 μL of the total DNA as a template and 20 μL of 0.4 pmol of each primer (Ana45F: 5′GTCGAACGGATTTTTGTCGT3′ and Ana671R: 5′GCCACTGGTGTTCCTCCTAA3′) [24], 300 μM of each dNTP, four units of iTaq DNA Polymerase (iNtRON Biotechnology, Kyungki-Do, South Korea), 1X PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl), 1.5 mM MgCl2, and RNase-free water. The amplification was conducted in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The thermocycling steps consisted of one step for 10 min at 95°C followed by 35 cycles of 30 s at 94°C, 30 s at 55°C, and 45 s at 72°C, with a final extension step of 10 min at 72°C. Aliquots of the amplicons were detected using gel electrophoresis on 2.0% agarose gel stained with GelRed (Biotium, Hayward, CA, USA) and visualized under UV light (Syngene, Cambridge, UK).

E. canis 16S rRNA gene amplification and sequencing

For the detection of E. canis, conventional PCR was used to amplify the 16S rRNA genes. The reactions were conducted using 5 μL of the total DNA template and 20 μL of 0.4 pmol of each primer (Ecan 16S-94F: 5′GTGGCAGACGGGTGAGTAAT3′ and Ecan 16S-1102R: 5′GAGTGCCCAGCATTACCTGT3′), 300 μM of each dNTP, four units of iTaq DNA Polymerase (iNtRON Biotechnology, Kyungki-Do, South Korea), 1X PCR buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl), 1.5 mM MgCl2, and RNase-free water. The amplification was conducted in a T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). The thermocycling consisted of one step of 10 min at 95°C followed by 35 cycles of 30 s at 94°C, 30 s at 58°C, and 45 s at 72°C, with a final extension step of 10 min at 72°C. Aliquots of the amplicons were detected using gel electrophoresis with a 2.0% agarose gel stained with GelRed (Biotium, Hayward, CA, USA) and visualized under a UV light (Syngene, Cambridge, UK). The amplicons (1009 base pairs) were then purified using the QIAquick PCR purification kit (QIAGEN Inc., Valencia, CA, USA), according to the manufacturer’s protocol. Bidirectional sequencing of all PCR products was conducted using First BASE Laboratories (Selangor, Malaysia). The DNA sequences were then analyzed using an ABI 3730xl sequencer (Applied Biosystems, Foster City, CA, USA) with fluorescent dye terminator sequencing. The DNA sequencing was conducted using E. canis- specific primers Ecan 16S-94F and Ecan 16S-1102R.

Bioinformatic and phylogenetic analysis

The B. vogeli 18S rRNA and E. canis 16S rRNA sequence results were analyzed using several programs. All sequencing results were compared with sequences available in the GenBank database using the Basic Local Alignment Search Tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple alignments of all nucleotide sequences were conducted using the ClustalW web-based tool (https://www.genome.jp/tools-bin/clustalw) [25]. Phylogenetic trees were reconstructed using maximum likelihood analysis with bootstrapping (100 replications) in the advanced mode of the Phylogeny.fr web server (http://www.phylogene.fr/) [26]. All sequences were compared with published sequences in the GenBank database that originated from other geographic locations globally. H. canis and Trypanosoma evansi were included as the outgroup for the 18S rRNA and A. platys was included as the outgroup for the 16S rRNA phylogenetic tree, respectively.

Statistical analysis

The commercial software IBM SPSS Statistics (IBM, Armonk, NY, USA) version 18 was used for data analysis. Independent t-tests were used to compare the sexes and breeds of the B. vogeli–infected group with the coinfected group. The clinical signs and geographic origins were evaluated using one-way analysis of variance. The ages and hematobiochemical data of the infected dogs were compared using the Mann–Whitney U-test. p<0.05 was considered statistically significant.

Results

Analysis of comprehensive data

The 44 dog samples were naturally infected with B. vogeli or coinfected with B. vogeli and E. canis. The microscopic screening and conventional and multiplex PCR results confirmed either the single B. vogeli infection (33 samples, 75%) or coinfection with E. canis (11 samples, 25%).

The median age of the 33 Babesia-infected dogs was 36 months, with a range from 1 to 156 months. This group included 19 (57.60%) male and 14 (42.40%) female dogs (Table-1). The most prevalent breeds were mixed breeds (15/33=45.45%) and Poodles (5/33=15.15%), and the third most prevalent breeds were Shih Tzus, Siberian Huskies, and Cocker Spaniels (2/33=6.06%). The most common clinical sign was anorexia with or without depression or fever (13/33=39.40%) (Table-1). The main geographic origin of the coinfected dogs was the Bangkok Metropolis (16/33=48.49%), followed by Nakhon Pathom (11/33=33.33%), Nonthaburi (5/33=15.15%), and Chonburi (1/33=3.03%) provinces (Figure-1 and Table-1).

Table-1.

Comparison of sex, breed, age, clinical signs, and geographic origin of the B. vogeli infection and E. canis coinfection cases.

Parameters n (%) Median (range) Statistic type p-value
Sex N/A Independent t-test 0.79
B. vogeli infection cases 33
 Male 19 (57.60)
 Female 14 (42.40)
E. canis coinfection cases 11
 Male 7 (63.64)
 Female 4 (36.36)
Breed N/A Independent t-test 0.48
B. vogeli infection cases 33
 Mixed breed 15 (45.45)
 Pure breed 18 (54.55)
E. canis coinfection cases 11
 Mixed breed 7 (63.64)
 Pure breed 4 (36.36)
Age (months) Mann-Whitney U test 0.57
B. vogeli infection cases 33 36 (1-156)
E. canis coinfection cases 11 71 (2-120)
Clinical sign N/A One-way ANOVA 0.57
B. vogeli infection cases 33
 Anorexia 13 (39.40)
 Musculoskeletal disorder 6 (18.18)
 Others 14 (42.42)
E. canis coinfection cases 11
 Anorexia 5 (45.46)
 Musculoskeletal disorder 2 (18.18)
 Others 4 (36.36)
Geographic origin N/A One-way ANOVA 0.89
B. vogeli infection cases 33
 Bangkok metropolis 16 (48.49)
 Nakhon Pathom 11 (33.33)
 Nonthaburi 5 (15.15)
 Chonburi 1 (3.03)
E. canis coinfection cases 11
 Bangkok metropolis 6 (54.55)
 Nakhon Pathom 3 (27.27)
 Samut sakhon 2 (18.18)

B. vogeli=Babesia vogeli, E. canis=Ehrlichia canis

The median age of the 11 Babesia–Ehrlichia coinfected dogs was 71 months, with a range from 2 to 120 months. This group included seven (63.64%) male and four (36.36%) female dogs. The most prevalent breed was mixed breed (7/11=63.64%), followed by Shih Tzus and Pomeranians (2/11=18.18% each). The most common clinical sign was anorexia with or without depression (5/11=45.46%). Other clinical signs observed in the remaining dogs (4/11=36.36%) included fever, abdominal distention, uveitis, and hypoglycemia. The major geographic origin of the coinfected dogs was the Bangkok Metropolis (6/11=54.55%), followed by Nakhon Pathom (3/11=27.27%), and Samut Sakhon (2/11=18.18%) provinces (Figure-1 and Table-1).

As shown in Table-1, the sex (male and female), breed (pure and mixed), age, clinical signs, and geographic origin of the dogs were not significantly different between the B. vogeli and the coinfected group (p=0.79, 0.48, 0.57, 0.57, and 0.89, respectively).

Analysis of hematobiochemical data

The RBC count, hemoglobin concentration, hematocrit, and RBC distribution width (RDW) were significantly different between the B. vogeli and the coinfected group (p=0.001, 0.001, 0.001, and 0.005, respectively). The RBC count, hemoglobin concentration, and hematocrit levels in the coinfected group were lower than the reference value ranges, whereas the RDW was higher. The platelet count was not significantly different (p=0.125) between the groups. Both groups exhibited thrombocytopenia (a platelet count of less than 200×103 cells/μL), with 32/33 (96.97%) dogs in the B. vogeli-infected group and 9/11 (81.82%) dogs in the coinfected group affected. The WBC count was not significantly different between the two groups (p=0.86). Differential counting of the WBCs showed that there was significantly different lymphocytosis (p=0.013) in the B. vogeli-infected group (Table-2).

Table-2.

Comparison of hematological and blood chemical profiles of B. vogeli infection and E. canis coinfection cases. Statistical differences were assessed by the Mann–Whitney U-test. Statistically significant differences are marked with an asterisk.

Parameters n Median (range) References (range) p-value
Hematology
Hemoglobin concentration (g/dL) 10-18 0.001*
B. vogeli infection cases 33 11.8 (3.5-17.7)
E. canis coinfection cases 11 6.6 (2.0-11.8)
Red blood cell count (RBC)×106 (cells/mm3) 5-9 0.001*
B. vogeli infection cases 33 4.96 (1.60-7.15)
E. canis coinfection cases 11 3.00 (1.00-4.69)
hematocrit (%) 35-55 0.001*
B. vogeli infection cases 33 35.0 (10.4-50.3)
E. canis coinfection cases 11 20.1 (5.5-32.8)
Mean cell volume (fL) 60-77 0.242
B. vogeli infection cases 33 69 (59-92)
E. canis coinfection cases 11 67 (59-74)
Mean corpuscular hemoglobin (pg) 20-25 0.242
B. vogeli infection cases 33 23.5 (20.0-32.8)
E. canis coinfection cases 11 22.4 (17.4-26.5)
Mean corpuscular hemoglobin concentration (g/dL) 32-36 0.724
B. vogeli infection cases 33 34.0 (30.0-35.8)
E. canis coinfection cases 11 34.0 (29.4-36.3)
RBC distribution width (%) 12-15 0.005*
B. vogeli infection cases 33 15.2 (13.9-19.5)
E. canis coinfection cases 11 16.9 (14.9-19.7)
White blood cell count (cells/μL) 6000-17000 0.86
B. vogeli infection cases 33 7700 (3900-39000)
E. canis coinfection cases 11 11300 (1500-25200)
Segmented neutrophils (cells/μL) 2060-10600 0.818
B. vogeli infection cases 33 6364 (560-35880)
E. canis coinfection cases 11 7973 (0-24192)
Band neutrophils (cells/μL) 0-300 0.081
B. vogeli infection cases 33 0 (0-98)
E. canis coinfection cases 11 0 (0-84)
Monocytes (cells/μL) 0-840 0.681
B. vogeli infection cases 33 188 (0-3500)
E. canis coinfection cases 11 228 (0-1470)
Lymphocytes (cells/μL) 0-840 0.013*
B. vogeli infection cases 33 1470 (196-7616)
E. canis coinfection cases 11 567 (0-3332)
Eosinophils (cells/μL) 0-840 0.087
B. vogeli infection cases 33 0 (0-1064)
E. canis coinfection cases 11 0 (0-595)
Basophils (cells/μL) 0-840 0.564
B. vogeli infection cases 33 0 (0-133)
E. canis coinfection cases 11 0 (0-0)
Platelet count×103(cell/μL) 200-500 0.125
B. vogeli infection cases 33 41 (6-217)
E. canis coinfection cases 11 43 (23-254)
Plasma protein (g/L) 6.0-7.5 0.357
B. vogeli infection cases 32 9.0 (7.6-10.6)
E. canis coinfection cases 11 8.2 (5.6-12.0)
Biochemistry
Alanine aminotransferase (ALT) (U/L) 0-50 0.51
B. vogeli infection cases 26 44.5 (5.0-358.0)
E. canis coinfection cases 9 59.0 (13.0-133.0)
Creatinine (mg/dL) 0.5-1.8 0.153
B. vogeli infection cases 28 0.9 (0.5-2.8)
E. canis coinfection cases 9 1.5 (0.3-3.3)

B. vogeli=Babesia vogeli, E. canis=Ehrlichia canis

Plasma protein was not significantly different (p=0.357), with both groups exhibiting hyperproteinemia (plasma protein more than 7.5 g/L). All 33 (100%) dogs in the B. vogeli-infected group and 8/11 (72.73%) dogs in the coinfected group displayed hyperproteinemia (Table-2).

Phylogenetic tree analysis

Phylogenetic analysis revealed that our sequences were closely related to the sequences from Thailand available in GenBank. The nucleotide sequences obtained from bidirectional sequencing of the 18S rRNA sequences of B. vogeli with coinfection of E. canis and the single B. vogeli infection groups (MT674935 and MT674936) showed that both nucleotide sequences were identical to those previously reported in Thailand (Chiangmai); B. vogeli 18S rRNA sequences (JF825145). The 16S rRNA sequences from E. canis in the coinfection group (MN660040) were identical to previously reported E. canis 16S rRNA sequences (EF139458) from samples from Thailand (Bangkok) (Figure-2).

Figure-2.

Figure-2

Phylogenetic tree analysis of Babesia vogeli 18S rRNA and Ehrlichia canis 16S rRNA gene sequences of dog samples from Nakhon Pathom, Thailand (asterisk), and other provinces and countries. Bootstrap values are provided at the beginning of each branch.

Discussion

R. sanguineus is a common hard tick in Thailand (Southeast Asia) that can carry various canine hemoparasites, including E. canis, B. vogeli, H. canis, A. platys, and Mycoplasma spp., which infect both domestic and stray dogs [12,22,27-29]. Occurrences of B. vogeli and E. canis coinfection and sole B. vogeli infections confirmed by molecular examination have been reported in Thailand [9,22]. Studies on tick-borne hemoparasite prevalence found that the ratio of coinfections of B. vogeli and E. canis to single B. vogeli infections was 2:59 (1:29.5) in Khon Kaen Province [22] and 2:17 (1:8.5) in Mahasarakham Province [9]. In the present study, to have a reliable sample comparison, we gathered 11:33 (1:3) ratio of samples of these infections from small animal hospital cases. The dogs of both groups were mainly from the Bangkok Metropolis and bordering areas, such as the Nakhon Pathom, Samut Sakhon, and Nonthaburi provinces. By contrast, a study conducted in South Africa, where the single Babesia pathogen was B. rossi, found that the ratio was 4:191 (1:48) [21]. To the best of our knowledge, the present study is the first to investigate the hematobiochemical parameters of B. vogeli infections and B. vogeli and E. canis coinfections.

In a hematobiochemical study, Niwetpathomwat et al. [20] reported decreases in the hemoglobin concentration, mean corpuscular hemoglobin (MCH), MHC concentration (MCHC), and mean platelet counts in registered babesiosis cases in the Chulalongkorn University’s Small Animal Teaching Hospital in Bangkok. Moreover, a study investigating cases of B. vogeli and E. canis coinfection in Costa Rica identified that the main clinical signs of young coinfected dogs were anemia, lethargy, and fever [30]. A 3-month-old coinfected puppy in the Philippines had lack of appetite, a pale mucous membrane, and fever, with thrombocytopenia as the most important abnormal hematological finding [31]. However, these results are not consistent with the findings of our study. In our study, in the group infected with B. vogeli, the only similar result was a decrease in the platelet count; the hemoglobin concentration, median MCH, and median MCHC values were all within the reference ranges. However, the study by Niwetpathomwat et al. [20] did not confirm the single B. vogeli infection in the canine babesiosis samples by molecular examination. Importantly, in our investigation, the RBC count, hemoglobin concentration, and median hematocrit levels in the cases with coinfection were significantly lower than in the cases with single B. vogeli infection. The previous studies demonstrated that infections of E. canis, which were confirmed using molecular techniques, led to a significant reduction in RBC count and hematocrit levels [32]. This study also demonstrated that anemic dogs infected with Mycoplasma spp. that had hematocrit levels of less than 15% had a seven-fold risk of coinfection with E. canis, as compared with a single infection of Mycoplasma spp. [28]. Coinfection with E. canis may lead to increased infection severity.

The significant increase in RDW in our ­coinfection group may be associated with increased destruction of RBCs, which may lead to regenerative anemia, including immune-mediated hemolytic anemia. RDW is related to heterogeneous erythrocyte populations in the blood circulation, whose main population is reticulocytes, rather than mature RBCs [33]. The mechanism underlying canine babesiosis has been proposed to involve intravascular and extravascular hemolysis with immune-mediated hemolytic anemia [34]. Various types of anemia, such as normocytic normochromic anemia, caused by B. canis and B. gibsoni infections [35], and hypocytic hypochromic anemia, caused by B. vogeli infection [20], have been reported. Our results indicate that coinfection with E. canis may cause macrocytic and/or microcytic hypochromic anemia, leading to the destruction of erythrocytes through an immune-mediated mechanism [36-38] resulting in the elevation of RDW.

The significance of lymphocytosis in single B. vogeli infections observed in this investigation is consistent with the previous studies conducted in Egypt [39], Italy [40], and Indonesia [41], although one study in Thailand did not describe lymphocytosis [20].

Niwetpathomwat et al. [20] reported that the levels of alkaline phosphatase (ALP) enzyme increased in cases of babesiosis. In the present study, we did not measure the levels of ALP and aspartate aminotransferase (AST), a liver enzyme, which are related to infections with B. canis and B. gibsoni [3,42]. There are three main ALP isoenzymes in canine serum [43] and the elevation of canine ALP is also associated with hepatobiliary, hepatic, and bone diseases [44-46]. In azotemic dogs infected with B. canis, the AST/ALT ratio decreased [47], and this ratio was not significantly different from those observed in B. vogeli infections [12].

In our study, the 44 bidirectional sequences of B. vogeli 18S rRNA displayed 100% identity and showed conservation with the various B. vogeli 18S rRNAs available in the GenBank database, including those from Chiangmai Province (the northern part of Thailand, JF825145) [8], Bangkok Metropolis (the central part of Thailand, KF621061-KF621074), and Khon Kaen Province (the north-eastern part of Thailand, KF621075-KF621081) [48]. By contrast, the sequences (around 200 base pairs) obtained from the Songkhla Province (the southern part of Thailand, KU765196 and KU765197) [49] had various genetic variations when aligned with our data. The genetic variation and genotyping of B. vogeli in Thailand should be further investigated using an immunodominant protein gene [50] with high levels of nucleotide diversity, such as an apical membrane antigen 1 [51].

Conclusion

Coinfection with E. canis increases the severity of babesiosis. Its pathogenic mechanisms, such as RBC destruction, should be further investigated. This study may contribute to improve the diagnosis, treatment, and prevention of the disease.

Authors’ Contributions

TR collected the samples and data. SS responsible for data analysis. Both authors conducted laboratory tests, wrote and revised the manuscript, and approved the final manuscript for submission.

Acknowledgments

This study was funded by the Faculty of Veterinary Science, Mahidol University. The authors are grateful to the technicians of the Molecular Biology Unit, The Monitoring and Surveillance Center for Zoonotic Diseases in Wildlife and Exotic Animals, Faculty of Veterinary Science, Mahidol University, for their support.

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published map and institutional affiliation.

References

  • 1.Uilenberg G, Franssen F.F, Perié N.M, Spanjer A.A. Three groups of Babesia canis distinguished and a proposal for nomenclature. Vet. Q. 1989;11(1):33–40. doi: 10.1080/01652176.1989.9694194. [DOI] [PubMed] [Google Scholar]
  • 2.Zahler M, Schein E, Rinder H, Gothe R. Characteristic genotypes discriminate between Babesia canis isolates of differing vector specificity and pathogenicity to dogs. Parasitol. Res. 1998;84(7):544–548. doi: 10.1007/s004360050445. [DOI] [PubMed] [Google Scholar]
  • 3.Solano-Gallego L, Sainz Á, Roura X, Estrada-Peña A, Miró G. A review of canine babesiosis:The European perspective. Parasit. Vectors. 2016;9(1):336. doi: 10.1186/s13071-016-1596-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Holm L.P, Kerr M.G, Trees A.J, McGarry J.W, Munro E.R, Shaw S.E. Fatal babesiosis in an untravelled British dog. Vet. Rec. 2006;159(6):179–180. doi: 10.1136/vr.159.6.179. [DOI] [PubMed] [Google Scholar]
  • 5.Sobczyk A.S, Kotomski G, Gorski P, Wedrychowicz H. Usefulness of touchdown PCR assay for the diagnosis of atypical cases of Babesia canis canis infection in dogs. Bull. Vet. Inst. Pulawy. 2005;49(3):407–410. [Google Scholar]
  • 6.Solano-Gallego L, Baneth G. Babesiosis in dogs and cats expanding parasitological and clinical spectra. Vet. Parasitol. 2011;181(1):48–60. doi: 10.1016/j.vetpar.2011.04.023. [DOI] [PubMed] [Google Scholar]
  • 7.Laha R, Das M, Sen A. Morphology, epidemiology, and phylogeny of Babesia :An overview. Trop. Parasitol. 2015;5(2):94–100. doi: 10.4103/2229-5070.162490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Buddhachat K, Meesong O, Nganvongpanit K, Osathanunkul M, Chomdej S. Molecular characterization and detection of Babesia canis vogeli in asymptomatic roaming dogs in Chiang Mai, Thailand. Thai J. Vet. Med. 2012;42(2):173–178. [Google Scholar]
  • 9.Piratae S, Pimpjong K, Vaisusuk K, Chatan W. Molecular detection of Ehrlichia canis Hepatozoon canis and Babesia canis vogeli in stray dogs in Mahasarakham Province, Thailand. Ann. Parasitol. 2015;61(3):183–187. doi: 10.17420/ap6103.05. [DOI] [PubMed] [Google Scholar]
  • 10.Piratae S, Sae-chue B, Sukumolanan P, Phosri A. Molecular detection of blood pathogens and their impacts on levels of packed cell volume in stray dogs from Thailand. Asian Pac. J. Trop. Dis. 2017;7(4):233–236. [Google Scholar]
  • 11.Simking P, Wongnakphet S, Stich R.W, Jittapalapong S. Detection of Babesia vogeli in stray cats of metropolitan Bangkok, Thailand. Vet. Parasitol. 2010;173(1-2):70–75. doi: 10.1016/j.vetpar.2010.06.025. [DOI] [PubMed] [Google Scholar]
  • 12.Sungpradit S, Pikhroh R, Thanasaksakul W. Urinary markers in Babesia canis vogeli-infected dogs. JAAS. 2016a;9(1):25–36. [Google Scholar]
  • 13.Irwin P.J. Canine babesiosis. Vet. Clin. North Am. Small Anim. Pract. 2010;40(6):1141–1156. doi: 10.1016/j.cvsm.2010.08.001. [DOI] [PubMed] [Google Scholar]
  • 14.Máthé A, Vörös K, Papp L, Reiczigel J. Clinical manifestations of canine babesiosis in Hungary (63 cases) Acta Vet. Hung. 2006;54(3):367–385. doi: 10.1556/AVet.54.2006.3.7. [DOI] [PubMed] [Google Scholar]
  • 15.Matijatko V, Torti M, Schetters T.P. Canine babesiosis in Europe:How many diseases? Trends Parasitol. 2012;28(3):99–105. doi: 10.1016/j.pt.2011.11.003. [DOI] [PubMed] [Google Scholar]
  • 16.Solano-Gallego L, Trotta M, Carli E, Carcy B, Caldin M, Furlanello T. Babesia canis canis and Babesia canis vogeli clinicopathological findings and DNA detection by means of PCR-RFLP in blood from Italian dogs suspected of tick-borne disease. Vet. Parasitol. 2008;157(3-4):211–221. doi: 10.1016/j.vetpar.2008.07.024. [DOI] [PubMed] [Google Scholar]
  • 17.Wang J, Zhang J, Kelly P, Zheng X, Li M, You J, Huang K, Qiu H, Wang Y, Zhang R, Li J, Dong J, Feng Y, Zhou J, Wang C. First description of the pathogenicity of Babesia vogeli in experimentally infected dogs. Vet. Parasitol. 2018;253(4):1–7. doi: 10.1016/j.vetpar.2018.02.028. [DOI] [PubMed] [Google Scholar]
  • 18.Furlanello T, Fiorio F, Caldin M, Lubas G, Solano-Gallego L. Clinicopathological findings in naturally occurring cases of babesiosis caused by large form Babesia from dogs of Northeastern Italy. Vet. Parasitol. 2005;134(1-2):77–85. doi: 10.1016/j.vetpar.2005.07.016. [DOI] [PubMed] [Google Scholar]
  • 19.Zygner W, Gójska O, Rapacka G, Jaros D, Wedrychowicz H. Hematological changes during the course of canine babesiosis caused by large Babesia in domestic dogs in Warsaw (Poland) Vet. Parasitol. 2007;145(1-2):146–151. doi: 10.1016/j.vetpar.2006.11.008. [DOI] [PubMed] [Google Scholar]
  • 20.Niwetpathomwat A, Techangamsuwan S, Suvarnavibhaja S, Assarasakorn S. A retrospective study of clinical hematology and biochemistry of canine babesiosis on hospital populations in Bangkok, Thailand. Comp. Clin. Pathol. 2006;15(2):110–112. [Google Scholar]
  • 21.Rautenbach Y, Schoeman J, Goddard A. Prevalence of canine Babesia and Ehrlichia co-infection and the predictive value of haematology. Onderstepoort J. Vet. Res. 2018;85(1):e1–e5. doi: 10.4102/ojvr.v85i1.1626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Laummaunwai P, Sriraj P, Aukkanimart R, Boonmars T, Boonjaraspinyo S, Sangmaneedet S, Potchimplee P, Khianman P, Maleewong W. Molecular detection and treatment of tick-borne pathogens in domestic dogs in Khon Kaen, Northeastern Thailand. Southeast Asian J. Trop. Med. Public Health. 2014;45(5):1157–1166. [PubMed] [Google Scholar]
  • 23.Kledmanee K, Suwanpakdee S, Krajangwong S, Chatsiriwech J, Suksai P, Suwannachat P, Sariya L, Buddhirongawatr R, Charoonrut P, Chaichoun K. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis Babesia spp and Hepatozoon canis in canine blood. Southeast Asian J. Trop. Med. Public Health. 2009;40(1):35–39. [PubMed] [Google Scholar]
  • 24.Sungpradit S, Hangsawek A, Chutasripanich S, Kammaled P, Moonarmart W. Type of Hepatozoon canis isolate in low and high parasitemia. Thai J. Vet. Med. Suppl. 2016b;46:377–379. [Google Scholar]
  • 25.Larkin M.A, Blackshields G, Brown N.P, Chenna R, McGettigan P.A, McWilliam H, Valentin F, Wallace I.M, Wilm A, Lopez R, Thompson J.D, Gibson T.J, Higgins D.G. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 26.Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, Chevenet F, Dufayard J.F, Guindon S, Lefort V, Lescot M, Claverie J.M, Gascuel O. Phylogeny.fr:Robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008;36(Web Server Issue):W465–9. doi: 10.1093/nar/gkn180. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jittapalapong S, Rungphisutthipongse O, Maruyama S, Schaefer J.J, Stich R.W. Detection of Hepatozoon canis in stray dogs and cats in Bangkok, Thailand. Ann. N. Y. Acad. Sci. 2006;1081(1):479–488. doi: 10.1196/annals.1373.071. [DOI] [PubMed] [Google Scholar]
  • 28.Kaewmongkol G, Lukkana N, Yangtara S, Kaewmongkol S, Thengchaisri N, Sirinarumitr T, Jittapalapong S, Fenwick S.G. Association of Ehrlichia canis Hemotropic Mycoplasma spp. and Anaplasma platys and severe anemia in dogs in Thailand. Vet. Microbiol. 2017;201(3):195–200. doi: 10.1016/j.vetmic.2017.01.022. [DOI] [PubMed] [Google Scholar]
  • 29.Pinyoowong D, Jittapalapong S, Suksawat F, Stich R.W, Thamchaipenet A. Molecular characterization of Thai Ehrlichia canis and Anaplasma platys strains detected in dogs. Infect. Genet. Evol. 2008;8(4):433–438. doi: 10.1016/j.meegid.2007.06.002. [DOI] [PubMed] [Google Scholar]
  • 30.Rojas A, Rojas D, Montenegro V, Gutiérrez R, Yasur-Landau D, Baneth G. Vector-borne pathogens in dogs from Costa Rica:First molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection. Vet. Parasitol. 2014;199(3-4):121–128. doi: 10.1016/j.vetpar.2013.10.027. [DOI] [PubMed] [Google Scholar]
  • 31.Ybañez R.H.D, Ybañez A.P, Arnado L.L.A, Belarmino L.M.P, Malingin K.G.F, Cabilete P.B.C, Amores Z.R.O, Talle M.G, Liu M, Xuan X. Detection of Ehrlichia Anaplasma and Babesia spp in dogs of Cebu, Philippines. Vet. World. 2018;11(1):14–19. doi: 10.14202/vetworld.2018.14-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Moonarmart W, Sungpradit S, Rawangchue T, Suphaphiphat K, Suksusieng S, Jirapattharasate C. Clinical history and hematological findings among canines with monocytic ehrlichiosis. Southeast Asian J. Trop. Med. Public Health. 2014;45(1):157–166. [PubMed] [Google Scholar]
  • 33.Cavaliere T.A. Red blood cell indices:Implications for practice. Newborn Infant Nurs. Rev. 2004;4(4):231–239. [Google Scholar]
  • 34.Köster L.S, Lobetti R.G, Kelly P. Canine babesiosis:A perspective on clinical complications, biomarkers, and treatment. Vet. Med Auckl. 2015;6(1):119–128. doi: 10.2147/VMRR.S60431. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Davitkov D, Vucicevic M, Stevanovic J, Krctic V, Tomanovic S, Glavinic U, Stanimirovic Z. Clinical babesiosis and molecular identification of Babesia canis and Babesia gibsoni infections in dogs from Serbia. Acta Vet. Hung. 2015;63(2):199–208. doi: 10.1556/AVet.2015.017. [DOI] [PubMed] [Google Scholar]
  • 36.Taylor M.A, Coop R.L, Wall R.L. Parasites of dogs and cats. In: Taylor M.A, Coop R.L, Wall R.L, editors. Veterinary Parasitology. 3rd ed. Oxford: Blackwell Publishing; 2007. pp. 356–458. [Google Scholar]
  • 37.Bai L, Goel P, Jhambh R, Kumar P, Joshi V.G. Molecular prevalence and haemato-biochemical profile of canine monocytic ehrlichiosis in dogs in and around Hisar, Haryana, India. J. Parasit. Dis. 2017;41(3):647–654. doi: 10.1007/s12639-016-0860-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kasondra A, Gupta S, Bhai G.A.B, Saini V.K. Therapeutic management of canine ehrlichiosis with aid of blood transfusion:A case report. J. Parasit. Dis. 2017;41(2):395–397. doi: 10.1007/s12639-016-0813-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Salem N.Y, Farag H.S. Clinical, hematologic, and molecular findings in naturally occurring Babesia canis vogeli in Egyptian dogs. Vet. Med. Int. 2014;2014:270345. doi: 10.1155/2014/270345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.de Caprariis D, Dantas-Torres F, Capelli G, Mencke N, Stanneck D, Breitschwerdt E.B, Otranto D. Evolution of clinical, haematological and biochemical findings in young dogs naturally infected by vector-borne pathogens. Vet. Microbiol. 2011;149(1-2):206–212. doi: 10.1016/j.vetmic.2010.10.006. [DOI] [PubMed] [Google Scholar]
  • 41.Dwi P, Nugraheni Y.R, Rohayati E.S, Prastowo J. Babesiosis in a local dog in Yogyakarta, Indonesia, a case report. Res. J. Parasitol. 2018;13(1):14–18. [Google Scholar]
  • 42.Bilwal A.K, Mandali G.C, Tandel F.B. Clinicopathological alterations in naturally occurring Babesia gibsoni infection in dogs of Middle-South Gujarat, India. Vet. World. 2017;10(10):1227–1232. doi: 10.14202/vetworld.2017.1227-1232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Hatayama K, Nishihara Y, Kimura S, Goto K, Nakamura D, Wakita A, Urasoko Y. Serum alkaline phosphatase isoenzymes in laboratory beagle dogs detected by polyacrylamide-gel disk electrophoresis. J. Toxicol. Sci. 2011;36(5):653–660. doi: 10.2131/jts.36.653. [DOI] [PubMed] [Google Scholar]
  • 44.Elhiblu M.A, Dua K, Mohindroo J, Mahajan S.K, Sood N.K, Dhaliwal P.S. Clinico-hemato-biochemical profile of dogs with liver cirrhosis. Vet. World. 2015;8(4):487–491. doi: 10.14202/vetworld.2015.487-491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kojima K, Ohno K, Kanemoto H, Goto-Koshino Y, Fukushima K, Tsujimoto H. Analysis of serum corticosteroid-induced alkaline phosphatase isoenzyme in dogs with hepatobiliary diseases. J. Small Anim. Pract. 2017;58(5):257–262. doi: 10.1111/jsap.12623. [DOI] [PubMed] [Google Scholar]
  • 46.Kruse M.A, Holmes E.S, Balko J.A, Fernandez S, Brown D.C, Goldschmidt M.H. Evaluation of clinical and histopathologic prognostic factors for survival in canine osteosarcoma of the extracranial flat and irregular bones. Vet. Pathol. 2013;50(4):704–708. doi: 10.1177/0300985812471542. [DOI] [PubMed] [Google Scholar]
  • 47.Zygner W, Gójska-Zygner O, Norbury L.J, Wedrychowicz H. Increased AST/ALT ratio in azotaemic dogs infected with Babesia canis. Pol. J. Vet. Sci. 2012;15(3):483–486. doi: 10.2478/v10181-012-0074-7. [DOI] [PubMed] [Google Scholar]
  • 48.Kongklieng A, Intapan P.M, Boonmars T, Thanchomnang T, Janwan P, Sanpool O, Lulitanond V, Taweethavonsawat P, Chungpivat S, Maleewong W. Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve analysis. J. Vet. Diagn. Invest. 2015;27(2):191–195. doi: 10.1177/1040638714567935. [DOI] [PubMed] [Google Scholar]
  • 49.Liu M, Ruttayaporn N, Saechan V, Jirapattharasate C, Vudriko P, Moumouni P.F.A, Cao S, Inpankaew T, Ybañez A.P, Suzuki H, Xuan X. Molecular survey of canine vector-borne diseases in stray dogs in Thailand. Parasitol. Int. 2016a;65(4):357–361. doi: 10.1016/j.parint.2016.04.011. [DOI] [PubMed] [Google Scholar]
  • 50.Nambooppha B, Rittipornlertrak A, Tattiyapong M, Tangtrongsup S, Tiwananthagorn S, Chung Y.T, Sthitmatee N. Two different genogroups of Ehrlichia canis from dogs in Thailand using immunodominant protein genes. Infect. Genet. Evol. 2018;63(7):116–125. doi: 10.1016/j.meegid.2018.05.027. [DOI] [PubMed] [Google Scholar]
  • 51.Liu M, Cao S, Zhou M, Wang G, Jirapattharasate C, Moumouni P.F.A, Iguchi A, Vudriko P, Suzuki H, Soma T, Xuan X. Genetic variations of four immunodominant antigens of Babesia gibsoni isolated from dogs inSouthwest Japan. Ticks Tick Borne Dis. 2016b;7(2):298–305. [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES