Skip to main content
Veterinary World logoLink to Veterinary World
. 2020 Jul 28;13(7):1462–1472. doi: 10.14202/vetworld.2020.1462-1472

Low genetic diversity among Francisella-like endosymbionts within different genotypes of Hyalomma dromedarii ticks infesting camels in Saudi Arabia

Haitham Elbir 1,✉, Faisal Almathen 1,2, Ayman Elnahas 3
PMCID: PMC7429393  PMID: 32848325

Abstract

Background and Aim:

Hyalomma dromedarii ticks are vectors of disease agents and hosts of Francisella-like endosymbionts (FLEs). Knowledge about intraspecific genetic variation among H. dromedarii and its Francisella species is limited. The aims of this study were to investigate whether certain H. dromedarii genotypes are specialized in carrying specific Francisella species genotypes and scrutinize the population structure of H. dromedarii ticks in Saudi Arabia.

Materials and Methods:

We collected 151 H. dromedarii ticks from 33 camels from 13 locations in Saudi Arabia. The second internal transcribed spacer (ITS2), cytochrome c oxidase subunit-1(COI), and 16S rRNA genes were used for single- and multi-locus sequence typing and phylogenetic analyses. H. dromedarii-borne Francisella was screened using the tul4 gene and 16S rRNA Francisella-specific primers followed by amplicon Sanger sequencing.

Results:

Single-locus typing of ticks using ITS2, 16S rRNA, and COI genes yielded 1, 10, and 31 sequence types (ST), respectively, with pairwise sequence similarity of 100% for ITS2, 99.18-99.86% for COI, and 99.50-99.75% for 16S rRNA. COI sequence analysis indicated a lack of strict geographical structuration, as ST15 was found in both Saudi Arabia and Kenya. In contrast, multilocus sequence typing resolved 148 H. dromedarii ticks into 39 genotypes of ticks and three genotypes of FLEs. The ST2-FLE genotype was carried by the tick genotype ST35, while the ST1-FLE genotype and 41.89% of the ST3-FLE genotype were carried by the tick genotype ST32. Accordingly, there appeared to be no specialization of certain tick genotypes to harbor-specific FLE genotypes.

Conclusion:

For the 1st time, we have provided an overview of the population structure of H. dromedarii ticks and FLE strains. We found a low level of genetic diversity among FLEs and non-specialized circulation of FLEs among H. dromedarii ticks.

Keywords: camel, endosymbionts Francisella typing, Hyalomma dromedarii

Introduction

Hyalomma dromedarii are ticks that infest camels and a wide range of other ungulate animals, including cattle and sheep [1,2]. The geographical distribution of H. dromedarii extends from North, Northwest, Central, and East Africa to the Middle East and Central and South Asia [3]. It is the most commonly reported tick seen attached to camels in Saudi Arabia [4]. H. dromedarii harbors several bacterial, viral, and parasitic pathogens that can infect humans and other animals. For example, in Saudi Arabia, H. dromedarii harbors Sindbis virus, Chick Ross virus, Kadam virus, and Alkhurma hemorrhagic fever virus; it is, therefore, suspected to play a role in the epidemiology of these pathogens [5]. In Iran, [6] molecular evidence suggests that Crimean-Congo hemorrhagic fever virus is present in H. dromedarii. Recently, in Pakistan [7], Theileria annulata parasites were found in H. dromedarii ticks. Notably, it is anticipated that new pathogens will emerge. As well as pathogenic microbes, H. dromedarii carries non-pathogenic microbes and probably endosymbiont organisms, such as Francisella-like endosymbionts (FLEs) [8,9]. A recent study of H. aegyptium ticks showed that Francisella spp. were significantly more abundant than other bacteria [10]. Furthermore, many symbiotic bacteria in ticks are known to interact with other microbes, affecting the competence of vectors and the ability of microbes to colonize and persist within ticks [11,12]. Hence, investigating the prevalence and diversity of FLEs in ticks is of great interest.

Intraspecies genetic analyses of H. dromedarii are important for defining its population structure. Different tick genotypes may differ in their pathogen colonization and competence. The veterinary and medical importance of this vector emphasizes the need for global phylogenetic studies to advance our knowledge of the relationship between different tick genotypes and their microbiota. To date, at the global level, few molecular studies have been performed to examine the intraspecies genetic diversity of H. dromedarii; those studies that have been performed were limited either by small sample sizes or the number of loci tested. One of these studies, in Kenya, revealed the presence of cryptic hybridization in H. dromedarii ticks [13]. In another study, H. dromedarii samples from Egypt were genotyped by sequence analysis of 18S rDNA, the cytochrome c oxidase subunit-1 (COI) gene, and 16S rDNA [14,15]. In India, H. dromedarii ticks were identified by the COI gene; further characterization and establishment of their phylogenetic status were achieved by sequencing the calreticulin gene and the second internal transcribed spacer (ITS2) [16]. Despite the importance of Francisella species and H. dromedarii ticks, there is limited information about intraspecies genetic diversity among H. dromedarii and their associated Francisella species globally and in Saudi Arabia specifically.

In this study, we attempted to address these issues by performing sequence analysis of the Francisella 16S rDNA gene, which has been shown to be informative for population analyses of FLEs [17]. For ticks, we selected the most commonly used genetic markers (the COI gene, ITS2, and 16S rDNA sequences) to facilitate global comparisons between geographically distant regions. The aims of this study were to investigate whether certain H. dromedarii genotypes are specialized in carrying specific Francisella species genotypes and scrutinize the population structure of H. dromedarii ticks in Saudi Arabia.

Materials and Methods

Ethical approval

Ethical approval is not necessary for this study.

Tick collection and DNA preparation

One hundred and fifty-one adult ticks, obtained from 33 camels (20 males and 13 females), were collected from 13 locations in Saudi Arabia between April 2017 and January 2020. The locations are indicated on the map shown in Figure-1. It was not possible to collect the same number of samples from each location as sampling was dependent on the availability of ticks in the region. Ticks were removed from camels by hand and stored in sterile 50 ml Falcon™ conical centrifuge tubes. Ticks were placed in separate tubes according to their attachment site on a camel. The tubes were stored at −20°C until whole tick DNA was extracted using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Extracted DNA was stored at −20°C until being used for polymerase chain reaction (PCR) amplification and sequencing.

Figure-1.

Figure-1

Collection sites of Hyalomma ticks in this study indicated by numbers. Map generated using R software version 3.6.2. 1 – Hofuf; 2 – North of Hofuf; 3 – South of Hofuf; 4 – Al Gharbia; 5 – Al Ahsa; 6 – Uqair; 7 – Khurais; 8 – Al Riyadh; 9 – Afif; 10 – Arar; 11 – Dammam; 12 – Buraidah; 13 – Asir.

Tick genotyping

PCR amplification of ITS2 of the rRNA gene and two mitochondrial genes, COI and 16S rRNA, was performed, using both specifically designed primers and previously published primers (Table-1) [18-20]. H. dromedarii DNA (2 μl) and 0.3 μl of each primer (10 pmol) (Macrogen, Seoul, South Korea) were added to the PCR mixture, containing one unit of Max Taq DNA Polymerase (Vivantis Technologies, Malaysia), 5 μl 10× ViBuffer (Vivantis Technologies, Malaysia), and 2 μl dNTPs (10 mM). The volume was adjusted to 25 μl by adding distilled water. Thermal cycling was performed on a TPersonal Thermocycler (BIOMETRA, Germany) with an initial 15 min cycle at 95°C, followed by 35 cycles consisting of 30 s at 94°C, 1 min at 55°C or 60°C depending on the primers, and 1 min at 72°C, followed by a final 10 min extension step at 72°C. To rule out DNA or amplicon contamination, Molecular Grade Water was used as a negative control throughout each step of the protocol. The PCR amplicons were sequenced by Macrogen Inc. (Seoul, South Korea) using BigDye (Applied Biosystems, California, USA) on an ABI3730XL DNA sequencer (Applied Biosystems, California, USA).

Table-1.

List of Primers utilized in PCR amplification and sequencing of genes.

Primers Sequence 5-3 References
16S-F 16S-R CCGGTCTGAACTCAGATCAAGT
GCTCAATGATTTTTTAAATTGCTGT
[18]
Cox1F Cox1R GGAACAATATATTTAATTTTTGG
ATCTATCCCTACTGTAAATATATG
[19]
ITS2-F ITS2-R ACATTGCGGCCTTGGGTCTT
TCGCCTGATCTGAGGTCGAC
[20]
ITS2-450_850 _F ITS2-450_850_R TGT TTG CGC ATG TTG CTA TT
AAT AAA TTA GCG GGG CGA CT
This study
ITS2-720F GGC GTT CCG TCG TAG TCC This study

PCR=Polymerase chain reaction

Francisella detection and genotyping

The detection of Francisella DNA in individual ticks was performed through PCR of the total DNA of individual ticks, using the 16S rRNA Francisella- specific primers Fr153F0.1 (5-GCC CATTTGAGGGGGATACC-3) and Fr1281R0.1 (5-GGACTAAGAGTACCTTTTTGAGT-3) [21], as follows: H. dromedarii DNA (3 μl) and 0.3 μl of each primer (10 pmol) (Macrogen Inc., South Korea) were added to the PCR mixture, which contained one unit of Max Taq DNA Polymerase (Vivantis Technologies, Malaysia), 5 μl 10X ViBuffer (Vivantis Technologies, Malaysia), and 2 μl dNTPs (10 mM). The volume was adjusted to 25 μl by adding distilled water. Thermal cycling was performed on a TPersonal Thermocycler (BIOMETRA, Germany) with an initial 15 min cycle at 95°C, followed by 35 cycles consisting of 30 s at 94°C, 1 min at 55°C, and 1 min at 72°C, followed by a final 10 min extension step at 72°C. Molecular Grade Water was used as a negative control throughout each step of the protocol to rule out DNA or amplicon contamination. PCR product purification and sequencing were performed by Macrogen Inc. using BigDye (Applied Biosystems, California, USA) on an ABI3730XL DNA sequencer (Applied Biosystems, California, USA). The obtained sequences were blasted against the NCBI non-redundant (nr) database to identify the species they were closest to.

PCR amplification of Francisella 17 kDa membrane lipoprotein (tul4) was generated using the primers designed herein: tul4HdF (5-CTAATCCCGAAATAATATTGATAGGT-3) and tul4HdR (5-CAGTTGCCCAAGTCTTATCATTC-3). The PCR parameters used were the same as those used for the 16S rRNA Francisella PCR protocol used in the current study.

Data collection and sequence analysis

Sequences of tul4, ITS2, COI, and 16S rRNA of H. dromedarii were retrieved from GenBank and compared with the sequences obtained in the present study. The nucleotide sequences were assembled and edited in CLC Main Workbench 8 software (CLC bio, Aarhus, Denmark). Sequences of the same gene were aligned using the algorithm in CLC Main Workbench 8 with default parameters. All sequences of the same gene were trimmed to the same length to enable comparisons. The ITS2, COI, and 16S rRNA nucleotide sequences analyzed herein were concatenated. Each particular sequence of COI, ITS2, and the 16S rRNA gene, in addition to the concatenated sequence, was assigned a sequence type (ST) number. The marker discrimination power of the DNA markers, COI, ITS2, and the16S rRNA gene, was calculated using the Hunter–Gaston index [22].

Phylogenetic reconstruction was performed separately for the ITS2, COI, and 16S rRNA gene sequences. In addition, relationships among H. dromedarii ticks sequenced herein and H. dromedarii ITS2, COI, and 16S rRNA sequences of H. dromedarii ticks obtained from GenBank were inferred using Bayesian phylogenetic analyses in MrBayes v3.2.6, as follows: Nucleotide sequences were first aligned using MUSCLE software. Bayesian phylogenetic analyses were then performed using MrBayes v3.2.6 [23] with a Jukes–Cantor model of nucleotide substitution. Sampling was performed using three independent runs (each having one cold chain and three heated chains), which were run for 1,000,000 generations.

Nucleotide sequence accession numbers

All sequences are available through GenBank. For the COI gene sequence, the accession numbers are MH590861 to MH590886; for 16S RNA, the accession numbers are MH569476 to MH569481; and for ITS2, the accession number is MH571755.

Results

Hyalomma species

Of 151 ticks (engorged and non-engorged) collected from 33 camels (20 males and 13 females), 148 (98.01%) were H. dromedarii, 2 (1.32%) were H. impeltatum, and 1 (0.66%) was Hyalomma spp. Tick occurrences per camel were rare due to the use of acaricides. The ticks were mainly found attached to the brisket, axilla, lower eyelid, jaw, base of tail, and perineum region. The two H. impeltatum ticks were removed from the base of the tail of a female camel in Afif (Figure-1), while the single Hyalomma spp. was removed from the base of the tail of a female camel in Riyadh (Figure-1). H. dromedarii ticks were recovered from all attachment sites mentioned above.

Genotyping of ticks

For all PCR experiments, the 148 DNA samples were efficiently amplified by PCR using the three genetic markers, and the negative controls remained negative. The lengths of the assembled sequences after trimming low-quality sequences were 722 bp for CO1 and 401 bp for 16Sr RNA, making it easy to obtain accurate sequences using the primer pairs COX-F/COX-R and 16SrRNA-F/16SrRNA, respectively. However, for ITS2, we failed to assemble high-quality sequences using ITS2-F/ITS-2R primers only. Specific internal primers (480-F, 480-R, and 720-F) were, therefore, designed, enabling assembly of a 1340 bp sequence. The genotyping of 148 H. dromedarii tick isolates based on concatenated sequences of COI and 16S rRNA yielded 39 STs, named ST1–ST39. The genotype ST32 represented 42.57% (63 of 148) of samples (Table-2). Individual DNA sequence analysis of ITS2, 16S rRNA, and the COI gene yielded 1, 10, and 31 genotypes, respectively (Table-3). While the concatenation of 16S rRNA and COI markers yielded a discrimination index of 0.825, this index was 0.6682 for COI, 0.3252 for 16S rRNA, and 0.0 for ITS2. Pairwise sequence comparison of the 148 H. dromedarii tick isolates yielded similarities of 99.18-99.86% and 99.50-99.75 for COI and 16S rRNA sequences, respectively. Alignment of COI sequences revealed a total of 33 single-nucleotide polymorphisms (SNPs); of these 33 SNPs, 27 resulted in amino acid residue changes, without any deletions or insertions. For the 16S rRNA sequences, nine SNPs were found, with no deletions or insertions. Pairwise sequence comparison of ITS2 sequences for H. dromedarii revealed identical sequences.

Table-2.

Prevalence of tick genotypes based on concatenation of COI, 16S RNA gene sequence. Yellow colour indicates that the tick genotype was found in this region. White colour indicates absence of tick genotype in this region.

Genotype Prevalence Site 1-2-3 Site 4 Site 5 Site 6 Site 7 Site 8 Site 9 Site 10 Site 11 Site 12 Site 13
ST32 42.57
ST10 11.49
ST29 8.11
ST8 3.38
ST21 3.38
ST33 3.38
ST13 2.03
ST1 1.35
ST14 1.35
ST15 1.35
ST16 1.35
ST36 1.35
ST39 1.35
ST2 0.68
ST3 0.68
ST4 0.68
ST5 0.68
ST6 0.68
ST7 0.68
ST9 0.68
ST11 0.68
ST12 0.68
ST17 0.68
ST18 0.68
ST19 0.68
ST20 0.68
ST22 0.68
ST23 0.68
ST24 0.68
ST25 0.68
ST26 0.68
ST27 0.68
ST28 0.68
ST30 0.68
ST31 0.68
ST34 0.68
ST35 0.68
ST37 0.68
ST38 0.68

Table-3.

Performance of COI, 16S RNA, and ITS2 DNA marker used for genotyping of 62 H. dromedarii ticks.

DNA marker Genotype Prevalence of genotype % Genotype Prevalence of genotype % Genotype Prevalence of genotype % Genotype Prevalence of genotype % Genotype Prevalence of genotype %





Tick COI Tick 16S rRNA Tick ITS2 Francisella tul4 Francisella 16S rRNA
ST3 0.67 ST2 0.68 ST1 100 ST1 0.67 ST1 100
ST4 0.67 ST3 0.68 ST2 0.67
ST5 0.67 ST5 0.68 ST3 98.66
ST7 0.67 ST8 0.68
ST9 0.67 ST9 0.68
ST10 0.67 ST4 1.35
ST14 0.67 St10 2.03
ST15 0.67 ST7 3.38
ST16 0.67 ST1 8.11
ST17 0.67 ST6 81.76
ST19 0.67
ST20 0.67
ST21 0.67
ST22 0.67
ST23 0.67
ST24 0.67
ST25 0.67
ST28 0.67
ST29 0.67
ST31 0.67
ST1 1.34
ST12 1.34
ST27 1.34
ST30 1.34
ST2 2.01
ST11 2.01
ST13 2.69
ST6 3.36
ST18 3.36
ST8 11.41
ST26 56.38

Francisella 16S rRNA gene sequence analysis

In all PCR experiments, the 148 DNA samples efficiently PCR amplified using Francisella-specific primers and negative controls remained negative. An approximately 1000 bp fragment of Francisella 16S rRNA gene was obtained after trimming low-quality sequences, whereas all 148 16S rRNA gene sequences were identical. A comparison of Francisella 16S rRNA gene sequences with data available in GenBank showed 100% similarity to FLE of H. dromedarii (KY469285), 99.75% similarity to FLE of H. dromedarii (KY274572.1), 98.77% similarity to FLE of Dendrobates auratus (JQ764629.1), and 98.68%, 98.59%, and 98.30% similarity to FLE of Ornithodoros moubata (AB001522.1), FLE of Hyalomma asiaticum (KX852466.1), and Francisella hispaniensis (CP018093.1), respectively. Notably, similarity to Francisella tularensis strains varied from 98.11% to 97.9%. Accordingly, Francisella spp. detected herein was classified as an FLE of H. dromedarii. As for Francisella genotyping, the analysis of the 16S rRNA gene sequences derived from the 148 Francisella DNA samples from ticks yielded one FLE ST, which we named FLE-ST1. Similarly, the FLE of H. dromedarii (KY469285) usually found in Egypt had 16S rRNA gene sequences different from that of FLE-ST1 and was herein named as FLE-ST2.

Francisella tul4 gene sequence analysis

A comparison of Francisella tul4 gene sequences with data available in GenBank showed 97.93% similarity to FLE of Ornitnodoros porcinus (AY375423.1), 97.58% similarity to FLE of Dermacentor albipictus (GU968877.1), 96.89% similarity to FLE of Dermacentor andersoni (AY375412.1), and 95.35% and 87.27% similarity to FLEs of Amblyomma dubitatum (EU441945.1) and F. tularensis subsp. tularensis (CP003049.2), respectively.

Alignment of the tul4 gene sequence showed two SNPs. The genotyping of 148 H. dromedarii tick isolates based on the tul4 gene yielded three STs, named FLE-H. dromedarii ST1-ST3 (Table-4). The genotype FLE-H. dromedarii ST-3 represented 98.6% (146 out of 148 samples), followed by genotype FLE-H. dromedarii ST1 (0.7%), which was found in the Buraidah region, and FLE-H. dromedarii ST2 (0.7%), which was found in the Asir region (Figure-1).

Table-4.

Genotypes of ticks and their associated genotypes of FLEs.

Tick sample Tick genotype FLEs genotype
2 ST18 ST3-FLE
3 ST32 ST3-FLE
4 ST21 ST3-FLE
5 ST32 ST3-FLE
6 ST5 ST3-FLE
7 ST13 ST3-FLE
8 ST26 ST3-FLE
9 ST32 ST3-FLE
10 ST14 ST3-FLE
11 ST13 ST3-FLE
13 ST32 ST3-FLE
14 ST15 ST3-FLE
15 ST32 ST3-FLE
16 ST10 ST3-FLE
17 ST32 ST3-FLE
20 ST17 ST3-FLE
23 ST32 ST3-FLE
24 ST1 ST3-FLE
25 ST10 ST3-FLE
26 ST15 ST3-FLE
27 ST32 ST3-FLE
28 ST14 ST3-FLE
29 ST6 ST3-FLE
30 ST1 ST3-FLE
31 ST32 ST3-FLE
32 ST32 ST3-FLE
33 ST32 ST3-FLE
34 ST11 ST3-FLE
35 ST31 ST3-FLE
36 ST28 ST3-FLE
37 ST8 ST3-FLE
38 ST24 ST3-FLE
39 ST32 ST3-FLE
40 ST19 ST3-FLE
41 ST10 ST3-FLE
43 ST32 ST3-FLE
44 ST30 ST3-FLE
45 ST32 ST3-FLE
46 ST29 ST3-FLE
47 ST12 ST3-FLE
48 ST29 ST3-FLE
49 ST32 ST3-FLE
50 ST2 ST3-FLE
51 ST21 ST3-FLE
52 ST32 ST3-FLE
53 ST13 ST3-FLE
54 ST32 ST3-FLE
55 ST32 ST3-FLE
56 ST7 ST3-FLE
57 ST32 ST3-FLE
59 ST22 ST3-FLE
60 ST9 ST3-FLE
62 ST32 ST3-FLE
63 ST32 ST3-FLE
65 ST27 ST3-FLE
66 ST32 ST3-FLE
67 ST32 ST3-FLE
68 ST23 ST3-FLE
70 ST32 ST3-FLE
71 ST32 ST3-FLE
72 ST3 ST3-FLE
73 ST32 ST3-FLE
100 ST32 ST3-FLE
101 ST29 ST3-FLE
103 ST32 ST3-FLE
104 ST32 ST3-FLE
105 ST10 ST3-FLE
106 ST29 ST3-FLE
109 ST32 ST3-FLE
110 ST32 ST3-FLE
111 ST29 ST3-FLE
112 ST36 ST3-FLE
113 ST36 ST3-FLE
114 ST29 ST3-FLE
115 ST29 ST3-FLE
116 ST29 ST3-FLE
117 ST10 ST3-FLE
118 ST32 ST3-FLE
119 ST33 ST3-FLE
120 ST32 ST3-FLE
121 ST32 ST3-FLE
122 ST32 ST3-FLE
123 ST10 ST3-FLE
124 ST10 ST3-FLE
125 ST33 ST3-FLE
126 ST32 ST3-FLE
127 ST32 ST3-FLE
128 ST32 ST3-FLE
129 ST33 ST3-FLE
130 ST29 ST3-FLE
131 ST32 ST3-FLE
132 ST10 ST3-FLE
133 ST10 ST3-FLE
134 ST10 ST3-FLE
135 ST10 ST3-FLE
136 ST32 ST3-FLE
137 ST10 ST3-FLE
139 ST21 ST3-FLE
140 ST33 ST3-FLE
141 ST21 ST3-FLE
142 ST29 ST3-FLE
143 ST10 ST3-FLE
144 ST10 ST3-FLE
145 ST21 ST3-FLE
146 ST32 ST3-FLE
147 ST33 ST3-FLE
148 ST32 ST3-FLE
149 ST32 ST3-FLE
150 ST32 ST3-FLE
151 ST32 ST3-FLE
152 ST29 ST3-FLE
154 ST37 ST3-FLE
155 ST29 ST3-FLE
156 ST32 ST3-FLE
157 ST10 ST3-FLE
158 ST32 ST3-FLE
159 ST32 ST3-FLE
160 ST4 ST3-FLE
164 ST32 ST3-FLE
165 ST32 ST3-FLE
167 ST20 ST3-FLE
168 ST25 ST3-FLE
170 ST32 ST3-FLE
171 ST32 ST3-FLE
172 ST32 ST3-FLE
173 ST34 ST3-FLE
174 ST16 ST3-FLE
175 ST32 ST3-FLE
176 ST32 ST3-FLE
177 ST32 ST3-FLE
178 ST8 ST3-FLE
179 ST32 ST3-FLE
180 ST8 ST3-FLE
181 ST8 ST3-FLE
182 ST32 ST3-FLE
183 ST8 ST3-FLE
184 ST10 ST3-FLE
185 ST32 ST1-FLE
186 ST10 ST3-FLE
187 ST16 ST3-FLE
188 ST35 ST2-FLE
189 ST38 ST3-FLE
190 ST39 ST3-FLE
191 ST32 ST3-FLE
192 ST39 ST3-FLE
193 ST32 ST3-FLE
194 ST32 ST3-FLE
196 ST32 ST3-FLE

FLE=Francisella-like endosymbionts

Phylogenetic analysis

Consultation of the GenBank database revealed that H. dromedarii sequences comprised 14 16S rRNA nucleotide sequences, from Senegal, Pakistan, Egypt, Saudi Arabia, and Iraq. There were 22 COI nucleotide sequences, from Kenya, India, United Arab Emirates, Ethiopia, Senegal, Pakistan, Egypt, Saudi Arabia, and Iraq. ITS2 comprised 15 nucleotide sequences, from India, Egypt, Pakistan, Iraq, Saudi Arabia, Iran, and Iraq. Not all sequences retrieved from GenBank were included in this analysis; short sequences were excluded. The concatenation of the 16S rDNA and COI sequences of H. dromedarii separated the strains into different clades, as shown in Figure-2.

Figure-2.

Figure-2

Bayesian Markov chain Monte Carlo analysis based on concatenation of 16S rDNA and cytochrome c oxidase subunit-1 sequences for 148 Hyalomma dromedarii. Numbers represent posterior probabilities.

A phylogenetic tree combining the STs of 16S rRNA sequences obtained in this study with GenBank 16S rRNA sequences yielded three clades: Clades A and B, consisting of isolates from Egypt and clade C, consisting of Saudi Arabia H. dromedarii isolates clustered with ticks from Senegal, Iraq, and Pakistan (Figure-3). The phylogenetic analysis combining STs of COI sequences found in ticks in our study with GenBank COI sequences revealed an absence of strict geographical structuration since genotype ST15 was found in both Saudi Arabia and Kenya (Figure-4).

Figure-3.

Figure-3

Bayesian Markov chain Monte Carlo analysis based on combining sequence types of 16S rRNA sequences in this study, with GenBank 16S rRNA sequence. Numbers represent posterior probabilities.

Figure-4.

Figure-4

Bayesian Markov chain Monte Carlo analysis based on combining sequence types of cytochrome c oxidase subunit-1 (COI) sequences found here in ticks, with GenBank COI sequence. Numbers represent posterior probabilities.

For FLEs of H. dromedarii, the phylogenetic tree inferred using the tul4 sequences clearly separated FLEs of Hyalomma strains from the FLEs of other ticks (Figure-5).

Figure-5.

Figure-5

Bayesian Markov chain Monte Carlo analysis based on combining sequence types of tul4 sequences found here in ticks, with GenBank tul4 sequence. Numbers represent posterior probabilities.

Discussion

The multityping approach used in this study revealed a high degree of genetic diversity among H. dromedarii collected from camels in Saudi Arabia. Even though we examined a relatively small set of H. dromedarii, we observed a high diversity index among these ticks, since 148 H. dromedarii ticks yielded 39 genotypes, as determined by the concatenation of COI and 16S rRNA gene sequences. The use of several genetic markers offers better resolution over the use of a single genetic marker, as has been used previously [14,15]. Our results revealed that COI sequences were more variable, in contrast with the low nucleotide variation seen in 16S rRNA and the highly conserved ITS2 sequence. These findings were consistent with those of previous tick studies [24-26]. Consequently, we concluded that COI is a more informative marker than the 16S rRNA gene for studying intraspecific diversity, whereas the ITS2 sequence is not informative but is suitable for H. dromedarii identification.

The tick genotype ST32 represented the dominant genotype prevalent in 11 out of 13 locations, which suggests the circulation of this genotype throughout Saudi Arabia. Plausible explanations for this could be that the ST32 genotype is well adapted to persist in its camel host or the frequent movement of camels between different locations as they seek pasture. Furthermore, ST32 showed no preference for a specific attachment site and was found widely distributed around a camel’s body.

A 16S rRNA phylogenetic tree showed that H. dromedarii ticks of Saudi Arabia were clustered with ticks from Senegal, Iraq, and Pakistan. Moreover, COI phylogenetic analysis revealed an absence of strict geographical structuration, as genotype ST15 was found in both Saudi Arabia and Kenya. A reasonable explanation for this could be the longstanding trade in camels between these countries, which might play a significant role in spreading ticks. More H. dromedarii samples are, therefore, needed to shed light on the global diversity of this species.

In this study, a total of 148 ticks were screened for Francisella species. F. tularensis was not detected in any samples. In contrast, FLEs were highly prevalent (100%) in H. dromedarii. These results indicate some sort of beneficial relationship between FLEs and H. dromedarii. The previous studies into H. dromedarii showed differences in the prevalence rates of FLEs, which varied from 6% to 89.8% [8,9]. A possible explanation for this discrepancy in results could be explained either by FLEs being present but undetectable due to low concentrations of DNA or that certain genotypes of H. dromedarii ticks have no capacity to harbor FLEs.

The presence of different STs of FLEs of D. andersoni and D. variabilis has been reported in Canada following the sequencing of 16S rRNA [17]. In addition, the FLE-ST2 genotype has been reported in Egypt. Here, we observed no intraspecies discrimination among Saudi Arabian FLE strains using 16S rRNA genes, in contrast with the tul4 gene, which grouped the 148 FLEs of H. dromedarii into three genotypes. These findings indicate a low level of genetic diversity among the FLE population of H. dromedarii. Indeed, the diversity of FLEs in H. dromedarii did not overlap with that of H. dromedarii. The ST2-FLE was carried by the tick genotype ST35, while the ST1-FLE genotype and 41.89% of the ST3-FLE genotype were carried by the tick genotype ST32. Accordingly, these results imply that, within H. dromedarii, there is no specialization of a certain tick genotype for their capacity to harbor-specific genotypes of H. dromedarii FLEs.

Conclusion

The tick H. dromedarii is the dominant tick species infesting camels in Saudi Arabia. The high prevalence of FLEs in H. dromedarii suggests that Hyalomma and FLEs have some sort of symbiotic relationship. Although FLEs are spread throughout all H. dromedarii, the low diversity of FLEs did not overlap with the high diversity of H. dromedarii. The ST2-FLE was carried by the tick genotype ST35, while the ST1-FLE genotype and 41.89% of the ST3-FLE genotype were carried by the tick genotype ST32. Accordingly, these results imply that, within H. dromedarii, there is no specialization of certain tick genotypes for their capacity to harbor-specific genotypes of H. dromedarii FLEs. Furthermore, we have increased the number of Hyalomma species reported to carry FLEs from five to six species, by detecting FLEs in H. impeltatum for the 1st time.

Authors’ Contributions

HE conducted the experiment, interpreted the results, and drafted the manuscript. FA designed the experiment and data analysis and revised the manuscript. AE collected the samples and revised the manuscript. All authors have read and approved the final manuscript.

Acknowledgments

This research was supported by a grant from the Deanship of Scientific Research, King Faisal University, Kingdom of Saudi Arabia (No. 183003).

Competing Interests

The authors declare that they have no competing interests.

Publisher’s Note

Veterinary World remains neutral with regard to jurisdictional claims in published map and institutional affiliation.

References

  • 1.Salih D.A, Hassan S.M, El Hussein A.M, Jongejan F. Preliminary survey of ticks (Acari Ixodidae) on cattle in northern Sudan. Onderstepoort. J. Vet. Res. 2004;71(4):319–326. doi: 10.4102/ojvr.v71i4.252. [DOI] [PubMed] [Google Scholar]
  • 2.Ahmed B.M, El-Hussein A.M, El-Khider A.O. Some observations on ticks (Acari Ixodidae) infesting sheep in river Nile Province of Northern Sudan. Onderstepoort. J. Vet. Res. 2005;72(3):239–243. doi: 10.4102/ojvr.v72i3.201. [DOI] [PubMed] [Google Scholar]
  • 3.Apanaskevich D.A, Schuster A.L, Horak I.G. The genus Hyalomma:VII. Redescription of all parasitic stages of H(Euhyalomma)dromedarii and H(E.)schulzei(Acari Ixodidae) J. Med. Entomol. 2008;45(5):817–831. doi: 10.1603/0022-2585(2008)45[817:tghvro]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  • 4.El-Azazy O.M, Scrimgeour E.M. Crimean-Congo haemorrhagic fever virus infection in the western province of Saudi Arabia. Trans. R. Soc. Trop. Med. Hyg. 1997;91(3):275–278. doi: 10.1016/s0035-9203(97)90072-9. [DOI] [PubMed] [Google Scholar]
  • 5.Mahdi M, Erickson B.R, Comer J.A, Nichol S.T, Rollin P.E, AlMazroa M.A, Memish Z.A. Kyasanur forest disease virus alkhurma subtype in ticks, Najran Province, Saudi Arabia. Emerg. Infect. Dis. 2011;17(5):945–947. doi: 10.3201/eid1705.101824. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Champour M, Chinikar S, Mohammadi G, Razmi G, Shah-Hosseini N, Khakifirouz S, Mostafavi E, Jalali T. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus detected from ticks of one-humped camel (Camelus dromedarius) population in northeastern Iran. J. Parasit. Dis. 2016;40(1):110–115. doi: 10.1007/s12639-014-0458-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Karim S, Budachetri K, Mukherjee N, Williams J, Kausar A, Hassan M.J, Adamson S, Dowd S.E, Apanskevich D, Arijo A, Sindhu Z.U, Kakar M.A, Khan R.M.D, Ullah S, Sajid M.S, Ali A, Iqbal Z. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017;11(6):e0005681. doi: 10.1371/journal.pntd.0005681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ghoneim N.H, Abdel-Moein K.A, Zaher H.M. Molecular detection of Francisella spp among ticks attached to camels in Egypt. Vector Borne Zoonotic. Dis. 2017;17(6):384–387. doi: 10.1089/vbz.2016.2100. [DOI] [PubMed] [Google Scholar]
  • 9.Azagi T, Klement E, Perlman G, Lustig Y, Mumcuoglu K.Y, Apanaskevich D.A, Gottieb Y. Francisella-like endosymbionts and Rickettsia species in local and imported Hyalomma ticks. Appl. Environ. Microbiol. 2017;83(18):1302–1317. doi: 10.1128/AEM.01302-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Keskin A, Bursali A, Snow D.E, Dowd S.E, Tekin S. Assessment of bacterial diversity in Hyalomma aegyptium, H marginatum and H. excavatum ticks through tag-encoded pyrosequencing. Exp. Appl. Acarol. 2017;73(3-4):461–475. doi: 10.1007/s10493-017-0186-y. [DOI] [PubMed] [Google Scholar]
  • 11.Gall C.A, Reif K.E, Scoles G.A, Mason K.L, Mousel M, Noh S.M, Brayton K.A. The bacterial microbiome of Dermacentor andersoni ticks influences pathogen susceptibility. ISME J. 2016;10(8):1846–1855. doi: 10.1038/ismej.2015.266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Narasimhan S, Rajeevan N, Liu L, Zhao Y.O, Heisig J, Pan J, Eppler-Epstein R, Deponte K, Fish D, Fikrig E. Gut microbiota of the tick vector Ixodes scapularis modulate colonization of the Lyme disease spirochete. Cell Host Microbe. 2014;15(1):58–71. doi: 10.1016/j.chom.2013.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Rees D.J, Dioli M, Kirkendall L.R. Molecules and morphology:Evidence for cryptic hybridization in African Hyalomma(Acari Ixodidae) Mol. Phylogenet. Evol. 2003;27(1):131–142. doi: 10.1016/s1055-7903(02)00374-3. [DOI] [PubMed] [Google Scholar]
  • 14.Alsarraf M, Mierzejewska E.J, Mohallal E.M.E, Behnke J.M, Bajer A. Genetic and phylogenetic analysis of the ticks from the Sinai Massif, Egypt, and their possible role in the transmission of Babesia behnkei. Exp. Appl. Acarol. 2017;72(4):415–427. doi: 10.1007/s10493-017-0164-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Abdullah H.H.A, El-Shanawany E.E, Abdel-Shafy S, Abou-Zeina H.A, Abdel-Rahman E.H. Molecular and immunological characterization of Hyalomma dromedarii and Hyalomma excavatum(Acari Ixodidae) vectors of Q fever in camels. Vet. World. 2018;11(8):1109–1119. doi: 10.14202/vetworld.2018.1109-1119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sivakumar G, Swami S.K, Nagarajan G, Mehta S.C, Tuteja F.C, Ashraf M, Patil N.V. Molecular characterization of Hyalomma dromedarii from North Western Region of India based on the gene sequences encoding calreticulin and internally transcribed spacer region 2. Gene Rep. 2018;10:141–148. [Google Scholar]
  • 17.Dergousoff S.J, Chilton N.B. Association of different genetic types of Francisella-like organisms with the rocky mountain wood tick (Dermacentor andersoni) and the American dog tick (Dermacentor variabilis) in localities near their Northern distributional limits. Appl. Environ. Microbiol. 2012;78(4):965–971. doi: 10.1128/AEM.05762-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Mangold A.J, Bargues M.D, Mas-Coma S. Mitochondrial 16S rDNA sequences and phylogenetic relationships of species of Rhipicephalus and other tick genera among Metastriata (Acari:Ixodidae) Parasitol. Res. 1998;84(6):478–484. doi: 10.1007/s004360050433. [DOI] [PubMed] [Google Scholar]
  • 19.Chitimia L, Lin R.Q, Cosoroaba I, Wu X.Y, Song H.Q, Yuan Z.G, Zhu X.Q. Genetic characterization of ticks from Southwestern Romania by sequences of mitochondrial cox1 and nad5 genes. Exp. Appl. Acarol. 2010;52(3):305–311. doi: 10.1007/s10493-010-9365-9. [DOI] [PubMed] [Google Scholar]
  • 20.Lv J, Wu S, Zhang Y, Chen Y, Feng C, Yuan X, Jia G, Deng J, Wang C, Wang Q, Mei L, Lin X. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida(Acari Ixodida) Parasit. Vectors. 2014;7(1):93. doi: 10.1186/1756-3305-7-93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Barns S.M, Grow C.C, Okinaka R.T, Keim P, Kuske C.R. Detection of diverse new Francisella like bacteria in environmental samples. Appl. Environ. Microbiol. 2005;71(9):5494–5500. doi: 10.1128/AEM.71.9.5494-5500.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hunter P.R, Gaston M.A. Numerical index of the discriminatory ability of typing systems:An application of Simpson's index of diversity. J. Clin. Microbiol. 1988;26(11):2465–2466. doi: 10.1128/jcm.26.11.2465-2466.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ronquist F, Huelsenbeck J.P. MrBayes Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12):1572–1574. doi: 10.1093/bioinformatics/btg180. [DOI] [PubMed] [Google Scholar]
  • 24.Kanduma E.G, Mwacharo J.M, Githaka N.W, Kinyanjui P.W, Njuguna J.N, Kamau L.M, Kariuki E, Mwaura S, Skilton R.A, Bishop R.P. Analyses of mitochondrial genes reveal two sympatric but genetically divergent lineages of Rhipicephalus appendiculatus in Kenya. Parasit. Vectors. 2016;9(1):353. doi: 10.1186/s13071-016-1631-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Burger T.D, Shao R, Barker S.C. Phylogenetic analysis of mitochondrial genome sequences indicates that the cattle tick Rhipicephalus(Boophilus)microplus contains a cryptic species. Mol. Phylogenet. Evol. 2014;76:241–253. doi: 10.1016/j.ympev.2014.03.017. [DOI] [PubMed] [Google Scholar]
  • 26.Low V.L, Tay S.T, Kho K.L, Koh F.X, Tan T.K, Lim Y.A, Ong B.L, Panchadcharam C, Norma-Rashid Y, Sofian-Azirun M. Molecular characterisation of the tick Rhipicephalus microplus in Malaysia:New insights into the cryptic diversity and distinct genetic assemblages throughout the world. Parasit. Vectors. 2015;8(1):341. doi: 10.1186/s13071-015-0956-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Veterinary World are provided here courtesy of Veterinary World

RESOURCES