Skip to main content
PLOS One logoLink to PLOS One
. 2020 Aug 17;15(8):e0237540. doi: 10.1371/journal.pone.0237540

Hog1-induced transcription of RTC3 and HSP12 is robust and occurs in cells lacking Msn2, Msn4, Hot1 and Sko1

Chen Bai 1,2, Masha Tesker 3, Dganit Melamed-Kadosh 4, David Engelberg 1,2,3,*, Arie Admon 4,*
Editor: Juan Mata5
PMCID: PMC7430751  PMID: 32804965

Abstract

The yeast MAP kinase Hog1 pathway activates transcription of several hundreds genes. Large-scale gene expression and DNA binding assays suggest that most Hog1-induced genes are regulated by the transcriptional activators Msn2/4, Hot1 and Sko1. These studies also revealed the target genes of each activator and the putative binding sites on their promoters. In a previous study we identified a group of genes, which we considered the bona fide targets of Hog1, because they were induced in response to expression of intrinsically active mutant of Hog1, in the absence of any stress. We previously analyzed the promoter of the most highly induced gene, STL1, and noticed that some promoter properties were different from those proposed by large-scale data. We therefore continue to study promoters individually and present here analyses of promoters of more Hog1’s targets, RTC3, HSP12, DAK1 and ALD3. We report that RTC3 and HSP12 promoters are robust and are induced, to different degrees, even in cells lacking all four activators. DAK1 and ALD3 promoters are not robust and fully depend on a single activator, DAK1 on Sko1 and ALD3 on Msn2/4. Most of these observations could not be inferred from the large-scale data. Msn2/4 are involved in regulating all four promoters. It was assumed, therefore, that the promoters are spontaneously active in ras2Δ cells, in which Msn2/4 are known to be de-repressed. Intriguingly, the promoters were not active in BY4741ras2Δ cells, but were de-repressed, as expected, in ras2Δ cells of other genetic backgrounds. This study describes two phenomena. One, some Hog1’s target promoters are most robust, backupped by many activators. Second, in contrast to most laboratory strains, the widely used BY4741 strain does not induce Msn2/4 activity when the Ras/cAMP cascade is downregulated.

Introduction

Regulation of transcription initiation is mediated primarily by transcriptional activators and suppressors that commonly function through specific cis-elements in the enhancers of their target genes [14]. In metazoans, transcription of a given gene may be regulated by a large number of enhancers, some residing hundreds of kilobases away from the promoter (considering the linear sequence) [46]. In the yeast S. cerevisiae, on the other hand, the entire regulatory region, i.e., promoter and enhancer (known in yeast as upstream activating sequences) is commonly contained within several hundreds base-pairs upstream to the transcription start site [7]. In response to changes in the cells’ environment, transcription rate of many genes is modulated. In many cases a few transcriptional activators (sometimes a single factor) are responsible for much of these changes and induces transcription of hundreds of genes. But, although the many target genes of a given activator are co-induced, the rate and kinetics of transcription are specific to each gene. This stems from the number and affinity of cis-elements the enhancer contains, and from other sequences that determine properties such as chromatin organization and binding of other regulators.

When high osmotic pressure is imposed on yeast cells, transcription of 300–600 genes is modified [811]. These changes are controlled by the Mitogen-activated protein (MAP) kinase Hog1 pathway [1215] and are probably not required for coping with the osmotic shock, but rather for the cross-protection machinery, that prepares the cell for the occurance of yet another stress [16, 17]. Hog1 seems to regulate almost all its target genes via the transcriptional activators Msn2, Msn4, Hot1 and Sko1. Large-scale transcriptomic and ChIP-Seq analyses suggested that these four activators are responsible for inducing 88% of the Hog1 target genes, and that most of those are controlled by Msn2/4 [8]. The fact that Msn2/4 are prominent is not surprising, as these factors are part of the ‘general stress response system’, which is activated in response to any stress. Msn2/4 bind hundreds promoters that contain the cis-elements known as Stress Response Elements (STREs; CCCCT or AGGGG). The Msn2/4/STRE system is negatively controlled by several pathways, primarily by the Ras/cAMP system [13]. Msn2/4 are, therefore, constitutively de-repressed and spontaneously activate their target genes (in the absence of any stress) in cells in which the Ras/cAMP/PKA pathway is downregulated (e.g., in ras2Δ cells) [13, 1820]. Sko1 and Hot1 control smaller groups of genes [8, 21, 22]. The large-scale ChIP-seq approach was also used to map the putative binding sites of the 4 transcriptional activators on the Hog1-activated promoters, but just in a handful of cases the putative cis-elements were confirmed on individual promoters by direct binding assays and deletions and mutations analysis. Individual analysis of promoters is required because the large-scale ChIP-seq approaches are often not very precise in pointing at the cis-element and are obviously not informative with respect to the functionality of the DNA binding events. We therefore initiated a systematic effort to analyze, individually, promoters of Hog1 target genes. We focus on genes defined as bona fide targets of Hog1 on the basis of their induction by active Hog1 alone, in the absence of stress. Namely, genes that activation of Hog1 per se (by expression of intrinsically active variants of Hog1 Hog1D170A+F318L; [23, 24]) is sufficient to induce them in cells lacking the Hog1’s upstream activator, known as Pbs2 [21].

We have already analyzed the STL1 promoter, which was most highly induced by Hog1D170A+F318L. This analysis led to the identification of the Hot1 responsive element (HoRE) within this promoter [21]. The observation that the HoRE is different from the binding sites proposed via global ChIP approaches supports the notion that for genuine understanding of their regulation promoters should be analyzed individually. We thus studied 4 more promoters of Hog1-regulated genes, RTC3, HSP12, DAK1 and ALD3. It is reported that all four promoters are regulated by Msn2/4, including DAK1, which does not contain STREs in its promoter. Transcription of RTC3 and HSP12 is robust and is induced even in msn2Δmsn4Δsko1Δhot1Δ cells. DAK1 and ALD3 promoters, on the other hand, are absolutely dependent on a single activator, DAK1 on Sko1 and ALD3 on Msn2/4. A significant difference in promoter regulation is observed between BY4741 and other genetic backgrounds. Specifically, BY4741 cells are incapable of activating Msn2/4 in response to elimination of RAS2.

Materials and methods

Yeast strains, media and growth conditions

The S. cerevisiae strains used in this study were: YPH102 (MATa,ura3-52,lys2-801amber,ade2-101ochre,trp1-Δ63,his3-Δ200,leu2-Δ1) [25]; JBY13, (MATa,ura3-52,lys2-801amber,ade2-101ochre,trp1-Δ63,his3-Δ200,leu2-Δ1,hog1::TRP1), a hog1Δ strain, which shares genetic background with YPH102, and was obtained from M. Gustin (Rice University, Houston, TX); BY4741 (MATa,his3-Δ1,leu2-Δ0,met15Δ0,ura3Δ0); sko1Δ and hot1Δ, which were purchased from EUROSCARF, Bad Homburg, Germany; SP1 (MATα,his3,leu2,ura3,trp1,ade8,Can) [26], and SP1msn2Δmsn4Δ, BY4741msn2Δmsn4Δ, BY4741sko1Δhot1Δ, BY4741sko1Δhot1Δmsn2Δmsn4Δ, and SP1sko1Δhot1Δmsn2Δmsn4Δ, the constructions of which is described below. The SP1msn2Δmsn4Δ strain (MATa,leu2,his3,ura3,ade8,msn2::TRP1msn4::KanMX4) was constructed in our laboratory by inserting the TRP1 gene into MSN2 and KanMX4 into MSN4.

To construct the sko1Δhot1Δ double mutant, the HOT1 gene was deleted from the sko1Δ mutant (of the BY4741 background, MATa,his3,leu2,met15,ura3,sko1::kanMX4, purchased from Euroscarf) in the following way: the HIS3 gene was amplified by PCR using plasmid pRS303 as a template with primers, 5'- TTTGCATCGTACGTACAAAGATTTATAGGATAACCATCAGCTGTGCGGTATTTCACACCG -3' and 5'- CTTCCTATGATTGTAAACGATTATTTACTATCGTACGTGCAGATTGTACTGAGAGTGCAC -3', which harbor the sequence flanking the HOT1 ORF at the 5-prime and 3-prime end respectively. The PCR product was introduced into sko1Δ cells and HIS+ colonies were collected. Deletion of HOT1 gene was confirmed by PCR. To construct the sko1Δ,hot1Δ,msn2Δ,msn4Δ quadruple mutant in the BY4741 background, MSN2 and MSN4 were deleted sequentially from the genome of sko1Δhot1Δ cells by inserting into them the URA3 and LEU2 genes, respectively. The PCR primers used for PCR were: MSN2, 5'- TTTTCTTTGGTTTTATTTGCTTTATTTTTTCTTTCTTTTTTCAACTTTTATTGCTCATAG -3' and 5'- ACAATAAGCCGTAAGCTTCATAAGTCATTGAACAGAATTATCTTATGAAGAAAGATCTAT -3’; MSN4, 5’- GGCTTTTTTTTCTTTTCTTCTTATTAAAAACAATATAATGCTGTGCGGTATTTCACACCG -3' and 5'- GCTTGTCTTGCTTTTATTTGCTTTTGACCTTATTTTTTTCAGATTGTACTGAGAGTGCAC -3'. The template plasmids were pRS306 for URA3 and pRS305 for LEU2.

To construct the sko1Δhot1Δ msn2Δmsn4Δ quadruple mutant in the SP1 background, we started with the SP1msn2Δmsn4Δ strain. HOT1 was deleted with the HIS3 gene. Then, SKO1 was deleted with LEU2, using pRS305 as a template and the primers 5'- CGAGACAACCAAGTACTGTTTCAACTTTCGATTTAGAACCCTGTGCGGTATTTCACACCG -3' and 5'- CAGATAGAAGACTATTTAAGAACCCCGTCGCTATCTCGTCAGATTGTACTGAGAGTGCAC -3'.

Yeast strains harboring two plasmids (i.e., a reporter gene and a plasmid carrying MET3-HOG1) were grown on yeast nitrogen base synthetic medium YNB(-URA; -LEU) (0.17% yeast nitrogen base without amino acids and NH4(SO4)2, 0.5% ammonium sulfate, 2% glucose, and 40 mg/liter adenine, histidine, tryptophan and lysine, and 160 mg/liter methionine). To induce Hog1 expression cells were collected at logarithmic phase and resuspended in same medium lacking methionine. Half of the culture was exposed to 0.7 M NaCl. Cells were collected for β-galactosidase assay or RNA extraction (using RNeasy Plus Mini Kit (Qiagen)) 60 minutes later. Strains harboring only a reporter gene were grown on YNB(-URA). Strains that do not harbor any plasmid were grown on YPD (1% yeast extract, 2% Bacto Peptone, 2% glucose). To monitor β -galactosidase assay or RNA levels cultures were grown to logarithmic phase and split to two halves. One half was exposed to 0.7 M NaCl and cells were collected 60 minutes later.

Plasmids

MET3-HOG1 plasmids were described in [24]. The STRE-LacZ plasmid was described in [20].

Construction of plasmids carrying the β-galactosidase-based reporter system

The pLG669Z plasmid [27] was digested with BamHI and SalI. The promoter regions of HSP12, RTC3, DAK1 and ALD3 were amplified by PCR using genomic DNA of the wild type strain BY4741 as a template. Primers used were: ALD3-Pt-F799: cagactGTCGACttttggcgggtttaaaatg; ALD3-Pt-R: cagactGGATCCggtcatttttcttttggctaattttc; DAK1-Pt-F750: gactGTCGACagctcactttcttcttaa; DAK1-Pt-R: gactGGATCCttaaaatttagtcttagat; HSP12-Pt-F: gactGTCGACgatcccactaacggccca; HSP12-Pt-R: gactGGATCCggtcattgttgtatttagttttttttg; RTC3-Pt-F: gactGTCGACtttattacttccatttac; RTC3-Pt-R: gactGGATCCggtcatgttgattttattttgtgtatg; DAK1-Pt-F418:gactGTCGACagtaaacacctctggtg; DAK1-Pt-F312: gactGTCGACattaagactcgctagac; DAK1-Pt-F215: gactGTCGACcaatttggcttctaagg; DAK1-Pt-F203: gactGTCGACtaagggagaaagatcaa; DAK1-Pt-F188: gactGTCGACaaaccactcccaattgc; DAK1-Pt-F177: gactGTCGACaattgcgtcattttgaaag; DAK1-Pt-F162: gactGTCGACgaaagagtggccacctcg; DAK1-Pt-F146: gactGTCGACgcgagcgtctgtcgaac; RTC3-pt707: gactGTCGACtgtatttgtcgaaaattt; RTC3-pt389: gactGTCGACgaaagcgcaggttgaaac; RTC3-pt329: gactGTCGACgaaagcgcaggttgaaac; RTC3-pt314: gactGTCGACtgacaataagaCCCCTta; RTC3-pt197: gactGTCGACTtatttagtcgaagggat; RTC3-pt157: gactGTCGACGatatttaagtgatgagaa; CYCpt-R: gactGGATCCGGTCATTATTAA; DAK1-E1: gactGTCGACAATTGCGTCATTTTGaaagCAGATCCGCCAGGCGTGTA. PCR products were digested with BamHI and SalI, and ligated with the pLG669Z vector. The resulting plasmid contained the respective promoter fragments with the first ATG fused in frame to the β-galactosidase coding sequence [27, 28]. For promoter element-CYC1 minimal promoter fusion constructs, an oligonucleotide, composed of the desired promoter sequence was synthesized and fused at 5'-end to the forward primer used to amplify by PCR the CYC1 minimal promoter using plasmid pLG669Z-178URA [27, 28] as the template. The PCR product was digested with BamHI and SalI, and ligated with the pLG669Z vector.

Construction of plasmids carrying genes encoding HA-tagged proteins and their integration into the yeast genome

A SalI-SacI fragment containing the C-terminal half of the HOG1 gene in frame with an HA tag at its C-terminus was excised from YCplac111-HOG1WT (a gift from Maralli del Olmo, Universitat de Valencia, Spain) and inserted into pRS306 plasmid cut with SalI and SacI. Then, the HOG1 fragment was excised with SalI and NotI, leaving only the HA tag in the vector. The C-terminal coding sequence of ALD3, HSP12, or RTC3, was amplified by PCR and digested with SalI and NotI, and then ligated into the above pRS306 vector cut with same enzymes, so that the HA tag is at C-terminal and in frame of the coding region of the targeted genes. The plasmid was linearized by a specific enzyme (PacI for ALD3, and HindIII for RTC3 and HSP12), which cuts it in the coding sequence of the targeted genes) and then was transformed into JBY13 cells expressing vector, HOG1D170A or HOG1D170A+F318L.

Cell lysis and western blot analysis

Cell lysis and western blotting were conducted as previously described [24]. The HA-tagged proteins were detected by the anti-HA antibody 3F10 from Roche. Cdc28 was used as a loading control and was detected by anti Cdc2 p34 antibody (SC-54) from Santa Cruz.

Quantitative RT-PCR

Total RNA was extracted from yeast cells using RNeasy Plus Mini Kit (Qiagen). Real-Time-RT-PCR was performed with an Applied Biosystems 7500 Fast Real-time PCR machine. cDNA was amplified by BioRad iScriptTM Reverse Transcription Supermix according to the manufacturer protocol. Primers used were: ACT1-RF: GTGTGGGGAAGCGGGTAAGC; ACT1-RR: GTGGCGGGTAAAGAAGAAAATGGA; HSP12-RF: CTGACGCAGGTAGAAAAGG; HSP12-RR: GAACCTTACCAGCGACCTTG; RTC3-RF: GGGCGCTGCCTCCAA; RTC3-RR: CTTCGATCTTCTTGCCCTTACC; ALD3-RF: GTCGACAAGTTCAATATG; ALD3-RR: GAGCAACAACGCCAAAAG. Real-time PCR was done by the preset 7500 Fast protocol for quantitative comparative CT, SYBR® Green protocol. ACT1 was used as an internal control. The value for each target gene was normalized to the value of ACT1. The results are shown as means ± SD of three independent experiments. p-values of Student’s T-test, comparing RNA levels of treated to that in not treated cells was commonly less than .001. Cases in which p-values were less significant (less then .005) are noted in the text.

β-Galactosidase assay

Cells were grown to mid-log phase and divided into two cultures of 5 ml each. For salt induction, 0.81 ml of 5 M NaCl were added to 5 ml of culture, resulting in a final concentration of 0.7 M. A similar volume of water was added to the other 5 ml of culture. Cells were collected 60 min after NaCl addition, disrupted and assayed as described previously [28]. For the MET3 promoter inducible system, cells were grown to mid-log phase in medium containing 160 mg/l methionine, washed with water and re-suspended in medium lacking methionine and continued to grow for 60 min before they were disrupted and assayed. Results of β-galactosidase assays are shown as means ± SD of three independent experiments.

Results and discussion

To pick promoters for individual analysis we used the list of the bona fide target genes of Hog1 (Table 2A in ref. [21]). A strongly induced gene (~90-fold) in this list is STL1 (encoding a glycerol proton symporter) and its promoter has already been thoroughly studied [21]. Another gene that was very strongly induced (~75-fold) in response to Hog1D170A+F318L expression is RTC3/YHR087w, which encodes a protein with currently unknown function. In a previous study we already cloned the RTC3 promoter and began to analyze it [see Fig 10 in ref. [21]]. Here, we further elaborate on this promoter (see below; Fig 1). We also studied the mechanisms used by Hog1 to elevate the gene encoding the small membrane-associated heat shock protein HSP12. HSP12 mRNA level is induced by ~42-fold [21]. Finally, we looked at the Hog1-regulated induction of the DAK1 and ALD3 genes, as examples of genes that were not strongly induced (~3–3.5-fold) [21]. DAK1 encodes one of the dihydroxyacetone kinase isoforms and ALD3 encodes a cytoplasmic aldehyde dehydrogenase.

Fig 1. The RTC3 promoter is regulated primarily by the Ras/cAMP/Msn2/4 pathway.

Fig 1

A) Confirmation of microarray data by monitoring RTC3 mRNA level directly by qRT-PCR. mRNA levels were monitored in hog1Δ cells harboring the indicated plasmids. B) Hog1-dependent and osmostress-dependent elevation of the RTC3 mRNA levels were mediated via promoter activation. Shown is β-galactosidase activity in hog1Δ cells, harboring the RTC3-LacZ reporter gene and the indicated HOG1 plasmids, under the indicated conditions. C+D) Activity of RTC3 promoter, as reflected in the activity of the RTC3-LacZ reporter (C), and in mRNA levels (D), in the indicated strains. E) The RTC3 promoter contains four STREs (boxed). Also marked in the figure are the points of the 5' deletion constructs. F) The STRE-LacZ reporter gene (upper panel) and the Rtc3-HA protein (lower panel) are spontaneously elevated in SP1ras2Δ cells, but not in BY4741ras2Δ cells. β-galactosidase and western blot analysis (with anti-HA antibodies) were performed on lysates prepared from the indicated strains under the indicated conditions. G) A series of 5'-deletion promoters suggests that the two distal STREs are the most important for promoter activity. H) RTC3 promoter is regulated differently in ras2Δ cells than in wild type cells. Downstream cis-elements that play no role in promoter induction by osmostress are used for promoter activation in ras2Δ cells.

The RTC3/YHR087w promoter

Induction of RTC3 mRNA by active Hog1 per se was revealed through a global transcriptomic assay in pbs2Δ cells expressing Hog1D170A+F318L [21]. To confirm directly that transcription of RTC3 could be induced by activation of Hog1 alone we introduced a RTC3-LacZ reporter to hog1Δ cells together with either an empty vector or plasmids that inducibly express either Hog1WT or Hog1D170A+F318L. In the inducible system used HOG1WT or HOG1D170A+F318L are cloned under the MET3 promoter and are expressed only when methionine is removed from the growth media. The inducibly expressed Hog1WT is not active because no stress is inflicted, while Hog1D170A+F318L is readily active because it spontaneously autophosphorylates [21, 24]. RTC3 mRNA levels (Fig 1A) or activity of the RTC3-LacZ reporter (Fig 1B) were monitored one hour after expression of Hog1WT or Hog1D170A+F318L was induced (by removal of methionine) with or without exposing the cells to osmostress (0.7 M NaCl). In hog1Δ cells harboring an empty vector removal of methionine did not cause elevation in RTC3 mRNA or in RTC3-LacZ reporter activity (Fig 1A and 1B, left bars). On the other hand, induced expression of Hog1WT was sufficient to elevate RTC3 mRNA levels in about 40 fold and RTC3-LacZ activity from 1 to 45 β-galactosidase units (Fig 1A and 1B middle bars). Expression of Hog1D170A+F318L resulted in about 80-fold elevation of RTC3 mRNA levels and in high RTC3-LacZ activity (200 units) (Fig 1A and 1B). The RTC3 promoter (unlike the other 3 promoters studied below) is activated in response to induced expression of Hog1WT (although to much lower levels than in response to Hog1D170A+F318L), suggesting that it is very sensitive to Hog1 activity. The results confirm that activation of Hog1 by itself, in the absence of any stress, is sufficient to elevate RTC3 expression. The induction of the reporter gene shows that the Hog1’s effect on mRNA level is mediated via increasing the transcription rate at the promoter level.

Through which transcriptional activator(s) does Hog1 activate the RTC3 promoter? It has been proposed, mainly on the basis of ChIP analysis, that Hog1 does it via Hot1 and Sko1 [8]. We therefore tested the induction of RTC3-LacZ activity and RTC3 mRNA levels by osmotic stress in yeast mutants lacking the relevant transcriptional activators (Fig 1C & 1D). RTC3 promoter activity was reduced in hot1Δ cells by only 20% and in sko1Δ cells by ~10%, suggesting just partial involvement of these factors (Fig 1C). In hot1Δsko1Δ cells induced RTC3-LacZ activity was lower, in about 2.5 fold, than that in wild type cells (Fig 1C). Similar observations were made at the mRNA level (Fig 1D; p-values of comparison of RNA levels are commonly less than .001; for comparison between wild type levels and hot1Δ and sko1Δ levels p-values are less than .005). Thus, Sko1 and Hot1 do affect RTC3 promoter, but none is critical for its activation as they seem to compensate for each other, and even when both are deleted the promoter is still significantly activated. More factors must be involved.

The RTC3 promoter (Fig 1E) harbors 4 classical STREs, raising the possibility that Msn2 and Msn4 are in fact its main regulators. The RTC3 mRNA levels and RTC3-LacZ activity were indeed lower in msn2Δmsn4Δ cells than in wild type cells (Fig 1C and 1D). Further supporting a role for Msn2/4 in regulating the promoter is a previous analysis that showed that responsiveness of the RTC3 promoter to osmostress was gradually reduced upon systematic 5’ deletions that included its STREs (from -707 to -197; deletion points are marked in promoter’s sequence in Fig 1E). Removal of all STREs completely abolished promoter responsiveness [Fig 10 in ref. [21]].

BY4741 cells do not de-repress Msn2/4 when the Ras/cAMP pathway is downregulated

As the Msn2/4/STRE module is negatively regulated by the Ras/cAMP cascade [13, 20, 29] it is expected that the RTC3 promoter would be induced in ras2Δ cells grown under optimal growth conditions [20, 28]. But, when tested in BY4741ras2Δ cells RTC3 mRNA or RTC3-LacZ activity were not spontaneously elevated (Fig 1C and 1D, left panels). Two possible explanations may account for this observation: i) Although RTC3 promoter is not fully induced in msn2Δmsn4Δ cells, it is not predominantly regulated via the Ras2/Msn2/4/STRE system, or ii) Msn2/4 are not de-repressed, for an unknown reason, in ras2Δ cells of the BY4741 genetic background. To distinguish between the two possibilities we first tested another reporter gene, STRE-LacZ, which was already shown to be spontaneously active in ras2Δ cells of the W303, ∑1278b and SP1 genetic backgrounds [20, 29]. We found that, similar to the RTC3-LacZ reporter, the STRE-LacZ gene was also not active in BY4741ras2Δ cells (Fig 1F, upper panel). Then, we introduced the RTC3-LacZ reporter gene to ras2Δ cells of the SP1 genetic background, which is a reliable strain for studying the Ras/cAMP/Msn2/4 system [20, 26]. In SP1ras2Δ cells, not exposed to any stress, RTC3-LacZ activity and RTC3 mRNA levels were significantly elevated (Fig 1C and 1D, right panels). This elevation was achieved through Msn2/4 activation as it was not observed in SP1ras2Δmsn2Δmsn4Δ cells (Fig 1C and 1D, right panels). To test whether the spontaneously induced transcription of RTC3 in SP1ras2Δ is fruitful and leads to elevation in Rtc3 protein level too, we added the HA coding sequence to the 3’ end of the RTC3 gene and monitored expression of the resulting Rtc3-HA protein in a western blot assay (Fig 1F, lower panel). Rtc3-HA levels were clearly elevated in response to high osmotic pressure in both SP1 and BY4741 cells, but only in SP1ras2Δ cells (not in BY4741ras2Δ cells) the Rtc3-HA protein level was elevated under optimal growth conditions (Fig 1F, lower panel). This analysis strongly suggests that the BY4741 genetic background does not induce Msn2/4 when the Ras/cAMP pathway is downregulated. Notably, this important difference between BY4741 and other commonly used laboratory strains joins another significant deficiency of BY4741 cells, i.e., their inability to properly absorb leucine from the growth medium [30]. As the BY4741 strain in widely used in research, many observations made with this genetic background, mainly with respect to the Ras/cAMP pathway, should perhaps be re-evaluated.

Given this finding all further experiments in this work were performed on the two genetic backgrounds, BY4741 and SP1.

Robustness of the RTC3 promoter—Sko1, Hot1 and more factors backup Msn2/4

The 5’ deletion analysis of the RTC3 promoter [21] and its spontaneous activation in SP1ras2Δ and not in SP1ras2Δmsn2Δmsn4Δ (Fig 1C) point at Msn2/4 as important activators of the promoter. Yet, osmostress-induced activity is still significant in SP1ras2Δmsn2Δmsn4Δ, BY4741msn2Δmsn4Δ and SP1msn2Δmsn4Δ cells (~45–55% of wild type levels; Fig 1C and 1D). Thus, Msn2/4 are critical for high basal activity of the promoter in SP1ras2Δ cells, while in response to stress other activators compensate for their absence. Given that promoter activity is reduced in hot1Δsko1Δ cells (Fig 1C and 1D), it seems plausible that Hot1 and Sko1 function on the RTC3 promoter in msn2Δmsn4Δ cells. Indeed, combining deletion of HOT1 with those of MSN2/4 resulted in a further decrease in reporter activity to about 20% of that measured in wild type SP1 cells (Fig 1C). Thus, although Hot1 by itself plays a minor role in activating the RTC3 promoter in wild type cells, it becomes important in the absence of Msn2/4. As the reporter is still induced by ~10 fold in msn2Δmsn4Δhot1Δ (Fig 1C), yet another factor (or factors) must be involved. To test whether this factor is Sko1 we constructed msn2Δmsn4Δhot1Δsko1Δ. In the BY4741msn2Δmsn4Δsko1Δhot1Δ the RTC3 mRNA levels were extremely low (although still weakly induced), suggesting that Hot1 and Sko1 do play a role in RTC3 expression (Fig 1D). In SP1msn2Δmsn4Δsko1Δhot1Δ, induction of RTC3 mRNA and RTC3-LacZ were low, but still quite significant (mRNA induced by 9-fold, compared to 50-fold in wild type cells; β-galactosidase reached 20 units compared to 100 in wt) (Fig 1C and 1D). It is concluded that the course of evolution equipped the RTC3 promoter with several alternative mechanisms to keep its Hog1-mediated activation robust.

The main transcriptional activators of the RTC3 promoter are Msn2 and Msn4. Sko1 and Hot1 cooperate with Msn2/4, but have just a mild contribution to transcription rate. They become important when each of them is absent or when Msn2/4 are absent. Msn2/4, Sko1 and Hot1 are not dependent on one another and can function when other factors are missing. Still more transcriptional activators induce the promoter, although weakly, when Msn2/4, Sko1 and Hot1 are not present, mainly in the SP1 genetic background. The fact that evolution ensured robustness of RTC3 activation may suggest that it is physiologically important. But, although rtc3Δ cells manifest slow growth and reduced viability under high glucose concentrations [31], the physiological function of Rtc3 is not clear. It is difficult, therefore, to further discuss a possible connection between protein’s function and promoter robustness.

Different cis elements are responsible for induction of the RTC3 promoter in wild type and in ras2Δ cells

Deletion analysis of the RTC3 promoter revealed that the sequence between -707 to -389 possesses the main regulatory cis-elements because deleting it reduces promoter induction from ~250-fold to ~45-fold in BY4741 cells [21]. This sequence harbors two STREs (Fig 1E). Further deletions did not affect promoter activity, but deleting the STRE at position -197 abolished promoter activity (Fig 10 in ref [21]). As Sko1 and Hot1 (and probably more factors) are also involved, to some extent, in regulating the RTC3 promoter, we sought the identification of promoter regions used by those components. The deletion constructs were thus tested in SP1msn2Δmsn4Δ and in SP1msn2Δmsn4Δhot1Δ cells (Fig 1G). It was found that -803RTC3-LacZ and -707RTC3-LacZ genes were responsive to NaCl in these cells, but -389RTC3-LacZ responded very poorly (Fig 1G), suggesting that the -707 to -389 region is used by all factors involved. Also, activity of both -803RTC3-LacZ and -707RTC3-LacZ was lower in SP1msn2Δmsn4Δ cells than in wild type cells, and even further lower SP1msn2Δmsn4Δhot1Δ cells (Fig 1G). It implies that in the absence of Msn2/4 the -707 to -389 fragment is partially used by Hot1.

As the promoter region downstream to -389, which is weakly active in wild type cells and is almost not active in msn2Δmsn4Δ cells, contains two STREs (Fig 1E), we wondered whether it may be active in SP1ras2Δ. Indeed, unlike the situation in wild type cells, in SP1ras2Δ the -389RTC3-LacZ and -314RTC3-LacZ are spontaneously highly active (~200 β-galactosidase units, ~66% of the activity of intact promoter) (Fig 1H). As the activity of the -197RTC3-LacZ reporter is much lower, it seems that the STREs at -302 and -200 are responsible for the activity of the -389RTC3-LacZ and -314RTC3-LacZ reporter genes (Fig 1H). It is clear that Msn2/4 activates these STREs because these reporter genes are not active in SP1msn2Δmsn4Δras2Δ cells (Fig 1H). It is also clear that the “backup” factors cannot function through sequences downstream to -389, because the -389RTC3-LacZ and -314RTC3-LacZ are not induced by osmostress in ras2Δ or SP1msn2Δmsn4Δras2Δ cells (Fig 1H). Importantly, although the activity of the -197RTC3-LacZ reporter is much lower than that of the other reporter genes in SP1ras2Δ cells, it is still 40-fold higher than in wild type cells (Fig 1H). This elevated activity is maintained in SP1msn2Δmsn4Δras2Δ cells (Fig 1H), pointing perhaps at yet another transcriptional activator, which is activated in the absence of Ras2 and binds the promoter’s downstream region (-1 to -197). Thus, the RTC3 promoter is regulated differently in response to osmotic pressure and in response to downregulation of the Ras/cAMP pathway.

The HSP12 promoter

In the microarray assay used to select genes for this study HSP12 was induced by 47-fold in response to expression of Hog1D170A+F318L in pbs2Δ cells [21]. To confirm that HSP12 can be activated by Hog1 alone at the promoter level we used the same MET3-mediated expression system described above for RTC3. mRNA levels of HSP12 were significantly elevated by induced expression of Hog1D170A+F318L (Fig 2A) and the use of an HSP12-LacZ reporter gene showed that active Hog1 increases transcription rate form the HSP12 promoter (Fig 2B). The HSP12 promoter contains seven STREs (Fig 2C), which were shown in previous studies to be the critical cis-elements in this promoter. Msn2/4 are expected therefore to be the major, if not the only activators of HSP12 [32], although large-scale analysis suggested involvement of Sko1 as well [8]. To check the involvement of the 4 main Hog1-activated transcriptional activators in inducing the HSP12 transcription we measured HSP12 mRNA levels and activity of the HSP12-LacZ reporter in cells knocked-out for these factors. Deletion of HOT1, SKO1 or both did not significantly affect osmostress-dependent induction of HSP12 mRNA or HSP12-LacZ reporter activity (Fig 2D and 2E). Although it was expected that in msn2Δmsn4Δ cells HSP12 mRNA level would be low, in the background of BY4741 it was just mildly affected and reached 70% of wild type levels (Fig 2D; p-value <005). HSP12-LacZ reporter activity was also lower in BY4741msn2Δmsn4Δ cells compared to BY4741 cells, but still significantly induced (Fig 2E, left panel). The reporter was much less affected in SP1msn2Δmsn4Δ cells (Fig 2E, right panel).

Fig 2. The HSP12 promoter is regulated primarily by the Ras/cAMP/Msn2/4 pathway.

Fig 2

A) Confirmation of microarray data by specifically monitoring HSP12 mRNA level by qRT-PCR, following induction of expression of the indicated Hog1 molecules, under the indicated conditions. B) Hog1-dependent and osmostress-dependent elevation of the HSP12 mRNA levels were mediated via promoter activation. Shown is β-galactosidase activity in the indicated strains, harboring the HSP12-LacZ reporter gene together with the indicated HOG1 plasmids, under the indicated conditions. C) The HSP12 promoter contains seven STREs (boxed). D+E) Promoter activity (D) and mRNA levels (E) of HSP12 in the indicated strains. F) Hsp12-HA protein is spontaneously expressed in SP1ras2Δ, but not in BY4741ras2Δ cells. Western blot analysis with anti-HA antibodies was performed on lysates prepared from the indicated strains exposed (+) or not exposed (-) to 0.7 M NaCl for one hour.

HSP12 mRNA levels were spontaneously elevated in SP1ras2Δ cells (but not in BY4741ras2Δ cells; Fig 2D). Similarly, the Hsp12 protein was spontaneously expressed in SP1ras2Δ cells (and not in BY4741ras2Δ cells; Fig 2F). This stress-independent elevation is fully dependent on Msn2/4 because it is totally abolished in SP1ras2Δmsn2Δmsn4Δ cells (Fig 2D and 2E, right panels). HSP12 was induced in response to osmostress in BY4741msn2Δmsn4Δ, SP1msn2Δmsn4Δ and SP1ras2Δmsn2Δmsn4Δ, pointing at the involvement of other Hog1-dependnet transcriptional activators (Fig 2D). To check whether these activators are Hot1 and Sko1 we tested HSP12 mRNA levels in msn2Δmsn4Δhot1sko1Δ cells. In BY4741msn2Δmsn4Δhot1Δsko1Δ cells HSP12 mRNA level was very low, although still inducible (2.5-fold; Fig 2D, left panel). It was more strongly induced (20-fold) in SP1msn2Δmsn4Δhot1Δsko1Δ cells (Fig 2D, right panel). Accordingly, HSP12-LacZ reporter activity was also significantly induced in SP1msn2Δmsn4Δhot1Δsko1Δ cells (Fig 2E, right panel).

In summary, similar to the case of the RTC3 promoter, Hot1, Sko1 and probably other factors assist Msn2/4 in activating the HSP12 promoter. Nevertheless, Hot1 and Sko1 are not at all critical. It is difficult to propose a mechanism through which Hot, Sko1 and the other factors cooperate with Msn2/4 given that there are no cis-elements for them on the promoter and that deletion of SKO1 or HOT1 alone did not affect HSP12 expression. In any case, similar to the RTC3 promoter, the HSP12 promoter is robust and is still induced in msn2Δmsn4Δhot1Δsko1Δ cells (Fig 2D and 2E), perhaps pointing at its physiological importance. Indeed, HSP12 is induced in response to many stresses and is involved in maintaining membrane organization and DNA replication under stress [33, 34]. Yet, it is not an essential protein even under stress.

The DAK1 promoter

DAK1 mRNA levels were elevated by 8-fold (Fig 3A) and DAK1-LacZ activity by ~50-fold (Fig 3B) in response to induced expression of Hog1D170A+F318L, confirming that DAK1 transcription is controlled by activation of Hog1 per se. Testing DAK1 mRNA levels and DAK1-LacZ reporter activity in hot1Δ and sko1Δ cells revealed that Sko1 is essential for promoter activation. Namely, in both the BY4741 and SP1 genetic backgrounds, elimination of SKO1 abolished promoter induction (Fig 3C and 3D). But, promoter activity is also reduced (to about 30% of wild type levels) in msn2Δmsn4Δ cells (Fig 3C and 3D). These results suggest that Msn2/4 by themselves cannot activate the promoter, for which Sko1 is essential, but Sko1 requires Msn2/4 for full activation. That Msn2/4 take part in regulating DAK1 promoter is also supported by the observation that DAK1 mRNA level and DAK1-LacZ activity is spontaneously elevated in SP1ras2Δ cells (4-fold; Fig 3C and 3D, right panels). Expression in BY4741ras2Δ cells is similar to that in wild type BY4741 cells (Fig 3C and 3D, left panels). Intriguingly, the promoter does not contain STREs (Fig 3E). We therefore tried to identify the cis-elements through which Sko1 and Msn2/4 may regulate the promoter. Analysis of 5’-deletions suggests that the sequence between positions -203 to -188 suppresses basal promoter activity and that the sequence between -177 and -162, which includes a Sko1 binding site (Fig 3E), harbors a cis-element important for promoter induction (Fig 3F; deletion points are marked in the sequence in Fig 3E). To test whether this sequence is responsible for promoter responsiveness, we inserted the sequence [(-177) 5'CAATTGCGTCATTTTGAAAG3'(-158)] upstream of a minimal promoter of the CYC1 gene, which cannot respond to stress, thereby constructed a DAK1-E1-CYC1-LacZ reporter gene. Activity of this reporter was elevated in response to induced expression of Hog1D170A+F318L or in response to 0.7 M NaCl and was spontaneously elevated in SP1ras2Δ cells (Fig 3H). These results confirm that this E1 is responsive to osmostress. Yet, the DAK1-E1-CYC1-LacZ reporter gene is active, and even manifests high basal activity in sko1Δ cells (Fig 3H) and therefore does not faithfully mimic the activity of the full-length DAK1 promoter. In fact, it seems that Sko1 and Msn2/4 are suppressors of this sequence. Suppressor activity of Sko1 is well documented [35, 36], but Msn2/4 are not known as suppressors. Thus, although the E1 sequence is clearly an important part of the Hog1-responsive machinery on the DAK1 promoter, further studies are required to reveal the mechanistic details.

Fig 3. Induction of the DAK1 promoter is absolutely dependent on Sko1.

Fig 3

A) Confirmation of microarray data by monitoring DAK1 mRNA levels by qRT-PCR. B) Hog1-dependent and osmostress-dependent elevation of the DAK1 mRNA levels were mediated via promoter activation. Shown is β-galactosidase activity in the indicated strains, harboring the DAK1-LacZ reporter gene and the indicated HOG1 plasmids, under the indicated conditions. C+D) DAK1 mRNA levels (C) and activity of DAK1-LacZ reporter gene (D) in the indicated strains. E) The DAK1 promoter does not contain STREs, but contains a potential Sko1 binding site (boxed). Underlined is the element we identified essential to DAK1 induction by osmostress. Also marked are the points of the 5' deletion constructs. F) A series of 5'-deletion promoters suggests that the sequence between -177 and -162 is important for promoter activity. G) The cis-element identified (E1) is responsive to osmostress and to induced expression of active Hog1. Shown is β-galactosidase activity in the indicated strains, harboring the DAK1E1CYC1-LacZ reporter gene, under the indicated conditions. H) Complex regulation of the E1 cis-element. It is inhibited by Sko1 and Msn2/4.

In summary, unlike the promoters of RTC3 and HSP12, Hog1 activation of the DAK1 promoter is not robust, but rather is fully dependent on Sko1. And yet, Msn2/4 are also required for full-scale activation of this promoter. The Dak1 protein seems to assist glycolysis and glycerol metabolism by detoxifying dihydroxyacetone [37, 38], but deeper studies are require to relate promoter regulation to its biological functions.

The ALD3 promoter

The observation, made via the microarray analysis in pbs2Δ cells, that ALD3 is induced by active Hog1 per se [21], was confirmed in hog1Δ cells harboring the MET3-HOG1WT or MET3-HOG1D170A+F318L gene. ALD3 mRNA level was elevated ~10-fold in response to induced expression of Hog1D170A+F318L (Fig 4A). It was also strongly induced in response to 0.7M NaCl in wild type cells of both the BY4741 and SP1 backgrounds (Fig 4B). An ALD3-LacZ reporter gene was also induced in response to NaCl in the two genetic backgrounds (Fig 4C), confirming that mRNA elevation is a result of increased promoter activity. Analysis of the ALD3 promoter sequence revealed the presence of two STREs (marked in Fig 4D). Accordingly, induction of ALD3 mRNA was almost abolished and induction of ALD3-LacZ was totally abolished in BY4741msn2Δmsn4Δ cells (Fig 4B and 4C, left panels). They were also affected, though less dramatically, in the SP1 genetic backgrounds (Fig 4B and 4C, right panels). ALD3 mRNA level and ALD3-LacZ reporter activity were also reduced (by 30%-50%) in cells knocked out for HOT1 or SKO1, pointing at some involvement of these factors (Fig 4B and 4C). In the SP1 genetic background (and not the BY4741 background) mRNA level and reporter activity were spontaneously high in SP1ras2Δ. It was further confirmed that spontaneous elevation is reflected at the protein levels as well (Fig 4E). Notably, in the SP1 genetic background elimination of MSN2/4 caused significant reduction of ALD3 mRNA level, but just partial reduction in ALD3-LacZ reporter activity. Only in SP1msn2Δmsn4Δhot1Δsko1Δ reporter activity was totally abolished. We currently cannot explain the difference in the effect of MSN2/4 knockout on mRNA levels and the reporter.

Fig 4. The ALD3 promoter is absolutely dependent on the Ras/cAMP/Msn2/4 pathway.

Fig 4

A) ALD3 mRNA levels are strongly elevated in response to osmostress or induced expression of Hog1D170A+F318L, confirming results obtained by global microarray. B+C) ALD3 mRNA levels (B) and activity of ALD3-LacZ reporter gene (C) in the indicated strains. D) The ALD3 promoter contains two STREs (boxed). E) Western blot analysis of the Ald3-HA protein in the indicated strains under the indicated conditions.

The ALD3 promoter seems to be absolutely dependent on Msn2/4. This finding supports a previous report that found, using 2D gel electrophoresis, that induction of Ald3 protein under diauxic shift is dependent on Msn2/4 [18, 39]. It’s role in the stress response is unknown. It is very similar to other ALD isoforms and is involved in polyamine catabolism and β-alanine biosynthesis [40, 41].

Of the 4 promoters studies here, those of RTC3 and HSP12 are robust and their induction is supported by many factors that continue to function when some of them, including the four major ones, are missing. The DAK1 and ALD3 promoters, similar to the previously analyzed STL1 promoter, are fully dependent on a single transcription activator, STL1 on Hot1, DAK1 on Sko1 and ALD3 on Msn2/4. Although a single activator is essential for the STL1, DAK1 and ALD3 promoters, other activators are also clearly involved in their regulation. But, those accessory factors cannot function in the absence of the main one.

It was already observed that transcription from some promoters may be more robust than from others. The yeast ARR2 and ARR3 genes, for example, are dependent solely on the transcriptional activator Yap6 and are not transcribed in its absence [42]. The HIS4 gene is not induced in gcn4Δ cells [43, 44]. It is not clear why transcriptional induction of some genes is more robust than others. It is tempting to propose that robustness of a promoter is proportional to the importance of its physiological function; but the genuine explanation is probably more complex.

Msn2/4 are important regulators of all 4 promoters studies, including that of DAK1, which does not possess a classical STRE. The main regulators (in fact suppressors) of Msn2/4 are the PKA, Tor (TORC1 complex) and Snf1 pathways [13]. It is not known how Hog1 integrates into any of those cascades to activate Msn2/4, but their activation under osmostress is clearly Hog1-dependent, as Msn2/4 are not activated in hog1Δ cells in response to osmostress. Intriguingly, Msn2/4 are activated in the same cells in response to other stresses [45]. Unlike the case of Msn2/4, Hot1 and Sko1 were shown to be directly regulated by Hog1 [35, 46]. Sko1 is also controlled, in parallel to Hog1, by PKA [35].

Which transcription factor(s) is responsible for the induction of RTC3 and HSP12 in msn2Δmsn4Δhot1Δsko1Δ cells? Given that Hog1 itself is recruited to many promoters, including those of PNS1, RTC3 and HSP12 [47], and is capable of recruiting chromatin modifying complexes [48, 49] and RNA polII [46, 50], it is possible that Hog1 itself is the factor responsible for this induction. But there might be others yet undiscovered transcriptional activators.

msn2Δmsn4Δhot1Δsko1Δ cells are not sensitive to osmostress

Although some induction is still maintained, the activity of the 4 promoters studied here was significantly reduced in SP1msn2Δmsn4Δhot1Δsko1Δ and BY4741msn2Δmsn4Δhot1Δsko1Δ cells. If we regard these 4 promoters as representatives, it is plausible that the transcription of numerous Hog1 targets is significantly reduced in msn2Δmsn4Δhot1Δsko1Δ cells. Westfall et al. reported that cells in which Hog1 cannot induce its transcription program are still fully resistant to high osmotic pressure [51], suggesting that the msn2Δmsn4Δhot1Δsko1Δ strains should also be osmostress resistant. As Westfall et al. blocked the effect of Hog1 on transcription by tethering it to the membrane, while here the Hog1 transcription program was demolished by elimination of the 4 major activators, we wondered whether the phenotype would indeed be similar. It was found that this is in fact the case and msn2Δmsn4Δhot1Δsko1Δ cells are as resistant to osmostress as wild type cells (Fig 5).

Fig 5. Cells lacking MSN2, MSN4, HOT1 and SKO1 proliferate similar to wild type cells under osmotic pressure.

Fig 5

Cultures of the indicated strains of the BY4741 genetic background (upper panels), or the SP1 genetic background (lower panels) were grown to mid-log phase and cell number was determined. A series of dilutions was performed for each culture allowing plating the indicated numbers of cells on plates containing YPD (left panels) or YPD supplemented with the indicated molecules. Plates were photographed after 5 days of incubation at 30°C.

The analysis described here for the RTC3, HSP12, ALD3 and DAK1 promoters and the previous study of the STL1 promoter emphasize that although a given signal transduction pathway co-activates numerous promoters, each promoter is ultimately controlled in an individual mode. The study also emphasizes that the biochemical wiring between the signaling pathways and the promoters may differ significantly between genetic backgrounds.

Another important conclusion derived from this work is that in spite of the undoubted power of global technologies for studying gene expression, these global approaches could not provide the type of information obtained in this study.

Acknowledgments

We thank Dr. Michal Bell and Dr. Allan Bar-Sinai for useful comments on the manuscript and Dr. Ilona Darlyuk-Saadon for important advice throughout the work.

Data Availability

All relevant data are within the manuscript.

Funding Statement

This study was supported by the Israel Science Foundation (ISF) grants #180/09 and 1772/13 (to AA and DE) and ISF grant #1463/18 (to DE), and by the National Research Fund, Prime Minister Office, Singapore, under its Campus of Research Excellence and Technological Enterprise (CREATE) (to DE).

References

  • 1.Babu MM, Luscombe NM, Aravind L, Gerstein M, Teichmann SA. Structure and evolution of transcriptional regulatory networks. Curr Opin Struct Biol. 2004;14(3):283–91. Epub 2004/06/15. 10.1016/j.sbi.2004.05.004 . [DOI] [PubMed] [Google Scholar]
  • 2.Harbison CT, Gordon DB, Lee TI, Rinaldi NJ, Macisaac KD, Danford TW, et al. Transcriptional regulatory code of a eukaryotic genome. Nature. 2004;431(7004):99–104. Epub 2004/09/03. 10.1038/nature02800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lemon B, Tjian R. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 2000;14(20):2551–69. Epub 2000/10/21. 10.1101/gad.831000 . [DOI] [PubMed] [Google Scholar]
  • 4.Levine M, Cattoglio C, Tjian R. Looping back to leap forward: transcription enters a new era. Cell. 2014;157(1):13–25. Epub 2014/04/01. 10.1016/j.cell.2014.02.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Lagha M, Bothma JP, Levine M. Mechanisms of transcriptional precision in animal development. Trends Genet. 2012;28(8):409–16. 10.1016/j.tig.2012.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.MacQuarrie KL, Fong AP, Morse RH, Tapscott SJ. Genome-wide transcription factor binding: beyond direct target regulation. Trends Genet. 2011;27(4):141–8. 10.1016/j.tig.2011.01.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Struhl K, Kadosh D, Keaveney M, Kuras L, Moqtaderi Z. Activation and repression mechanisms in yeast. Cold Spring Harb Symp Quant Biol. 1998;63:413–21. 10.1101/sqb.1998.63.413 . [DOI] [PubMed] [Google Scholar]
  • 8.Capaldi AP, Kaplan T, Liu Y, Habib N, Regev A, Friedman N, et al. Structure and function of a transcriptional network activated by the MAPK Hog1. Nat Genet. 2008;40(11):1300–6. Epub 2008/10/22. 10.1038/ng.235 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.O'Rourke SM, Herskowitz I. Unique and redundant roles for HOG MAPK pathway components as revealed by whole-genome expression analysis. Mol Biol Cell. 2004;15(2):532–42. Epub 2003/11/05. 10.1091/mbc.e03-07-0521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Posas F, Chambers JR, Heyman JA, Hoeffler JP, de Nadal E, Arino J. The transcriptional response of yeast to saline stress. J Biol Chem. 2000;275(23):17249–55. Epub 2000/04/05. 10.1074/jbc.M910016199 . [DOI] [PubMed] [Google Scholar]
  • 11.Rep M, Krantz M, Thevelein JM, Hohmann S. The transcriptional response of Saccharomyces cerevisiae to osmotic shock. Hot1p and Msn2p/Msn4p are required for the induction of subsets of high osmolarity glycerol pathway-dependent genes. J Biol Chem. 2000;275(12):8290–300. Epub 2000/03/18. 10.1074/jbc.275.12.8290 . [DOI] [PubMed] [Google Scholar]
  • 12.de Nadal E, Ammerer G, Posas F. Controlling gene expression in response to stress. Nat Rev Genet. 2011;12(12):833–45. Epub 2011/11/04. 10.1038/nrg3055 . [DOI] [PubMed] [Google Scholar]
  • 13.Engelberg D, Perlman R, Levitzki A. Transmembrane signaling in Saccharomyces cerevisiae as a model for signaling in metazoans: State of the art after 25years. Cell Signal. 2014;26(12):2865–78. Epub 2014/09/15. 10.1016/j.cellsig.2014.09.003 . [DOI] [PubMed] [Google Scholar]
  • 14.Hohmann S. Osmotic adaptation in yeast—control of the yeast osmolyte system. Int Rev Cytol. 2002;215:149–87. Epub 2002/04/16. 10.1016/s0074-7696(02)15008-x . [DOI] [PubMed] [Google Scholar]
  • 15.Saito H, Posas F. Response to hyperosmotic stress. Genetics. 2012;192(2):289–318. Epub 2012/10/03. 10.1534/genetics.112.140863 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Berry DB, Gasch AP. Stress-activated genomic expression changes serve a preparative role for impending stress in yeast. Mol Biol Cell. 2008;19(11):4580–7. Epub 2008/08/30. 10.1091/mbc.e07-07-0680 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Berry DB, Guan Q, Hose J, Haroon S, Gebbia M, Heisler LE, et al. Multiple means to the same end: the genetic basis of acquired stress resistance in yeast. PLoS Genet. 2011;7(11):e1002353 Epub 2011/11/22. 10.1371/journal.pgen.1002353 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Boy-Marcotte E, Perrot M, Bussereau F, Boucherie H, Jacquet M. Msn2p and Msn4p control a large number of genes induced at the diauxic transition which are repressed by cyclic AMP in Saccharomyces cerevisiae. J Bacteriol. 1998;180(5):1044–52. 10.1128/JB.180.5.1044-1052.1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Smith A, Ward MP, Garrett S. Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. EMBO J. 1998;17(13):3556–64. 10.1093/emboj/17.13.3556 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Stanhill A, Schick N, Engelberg D. The yeast ras/cyclic AMP pathway induces invasive growth by suppressing the cellular stress response. Mol Cell Biol. 1999;19(11):7529–38. Epub 1999/10/19. 10.1128/mcb.19.11.7529 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bai C, Tesker M, Engelberg D. The yeast Hot1 transcription factor is critical for activating a single target gene, STL1. Mol Biol Cell. 2015;26(12):2357–74. 10.1091/mbc.E14-12-1626 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Proft M, Gibbons FD, Copeland M, Roth FP, Struhl K. Genomewide identification of Sko1 target promoters reveals a regulatory network that operates in response to osmotic stress in Saccharomyces cerevisiae. Eukaryot Cell. 2005;4(8):1343–52. 10.1128/EC.4.8.1343-1352.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bell M, Capone R, Pashtan I, Levitzki A, Engelberg D. Isolation of hyperactive mutants of the MAPK p38/Hog1 that are independent of MAPK kinase activation. J Biol Chem. 2001;276(27):25351–8. Epub 2001/04/20. 10.1074/jbc.M101818200 . [DOI] [PubMed] [Google Scholar]
  • 24.Yaakov G, Bell M, Hohmann S, Engelberg D. Combination of two activating mutations in one HOG1 gene forms hyperactive enzymes that induce growth arrest. Mol Cell Biol. 2003;23(14):4826–40. Epub 2003/07/02. 10.1128/mcb.23.14.4826-4840.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. 1989;122(1):19–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Toda T, Uno I, Ishikawa T, Powers S, Kataoka T, Broek D, et al. In yeast, RAS proteins are controlling elements of adenylate cyclase. Cell. 1985;40(1):27–36. 10.1016/0092-8674(85)90305-8 . [DOI] [PubMed] [Google Scholar]
  • 27.Guarente L, Ptashne M. Fusion of Escherichia coli lacZ to the cytochrome c gene of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A. 1981;78(4):2199–203. Epub 1981/04/01. 10.1073/pnas.78.4.2199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Grably MR, Stanhill A, Tell O, Engelberg D. HSF and Msn2/4p can exclusively or cooperatively activate the yeast HSP104 gene. Mol Microbiol. 2002;44(1):21–35. Epub 2002/04/23. 10.1046/j.1365-2958.2002.02860.x . [DOI] [PubMed] [Google Scholar]
  • 29.Marchler G, Schuller C, Adam G, Ruis H. A Saccharomyces cerevisiae UAS element controlled by protein kinase A activates transcription in response to a variety of stress conditions. EMBO J. 1993;12(5):1997–2003. Epub 1993/05/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Cohen R, Engelberg D. Commonly used Saccharomyces cerevisiae strains (e.g. BY4741, W303) are growth sensitive on synthetic complete medium due to poor leucine uptake. FEMS Microbiol Lett. 2007;273(2):239–43. Epub 2007/06/19. 10.1111/j.1574-6968.2007.00798.x . [DOI] [PubMed] [Google Scholar]
  • 31.Jimenez-Marti E, Zuzuarregui A, Gomar-Alba M, Gutierrez D, Gil C, del Olmo M. Molecular response of Saccharomyces cerevisiae wine and laboratory strains to high sugar stress conditions. Int J Food Microbiol. 2011;145(1):211–20. Epub 2011/01/21. 10.1016/j.ijfoodmicro.2010.12.023 . [DOI] [PubMed] [Google Scholar]
  • 32.Varela JC, Praekelt UM, Meacock PA, Planta RJ, Mager WH. The Saccharomyces cerevisiae HSP12 gene is activated by the high-osmolarity glycerol pathway and negatively regulated by protein kinase A. Mol Cell Biol. 1995;15(11):6232–45. 10.1128/mcb.15.11.6232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Tkach JM, Yimit A, Lee AY, Riffle M, Costanzo M, Jaschob D, et al. Dissecting DNA damage response pathways by analysing protein localization and abundance changes during DNA replication stress. Nat Cell Biol. 2012;14(9):966–76. Epub 2012/07/31. 10.1038/ncb2549 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Welker S, Rudolph B, Frenzel E, Hagn F, Liebisch G, Schmitz G, et al. Hsp12 Is an Intrinsically Unstructured Stress Protein that Folds upon Membrane Association and Modulates Membrane Function. Mol Cell. 2010;39(4):507–20. 10.1016/j.molcel.2010.08.001 WOS:000281421100005. [DOI] [PubMed] [Google Scholar]
  • 35.Proft M, Pascual-Ahuir A, de Nadal E, Arino J, Serrano R, Posas F. Regulation of the Sko1 transcriptional repressor by the Hog1 MAP kinase in response to osmotic stress. EMBO J. 2001;20(5):1123–33. Epub 2001/03/07. 10.1093/emboj/20.5.1123 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Proft M, Struhl K. Hog1 kinase converts the Sko1-Cyc8-Tup1 repressor complex into an activator that recruits SAGA and SWI/SNF in response to osmotic stress. Mol Cell. 2002;9(6):1307–17. Epub 2002/06/28. 10.1016/s1097-2765(02)00557-9 . [DOI] [PubMed] [Google Scholar]
  • 37.Molin M, Norbeck J, Blomberg A. Dihydroxyacetone kinases in Saccharomyces cerevisiae are involved in detoxification of dihydroxyacetone. Journal of Biological Chemistry. 2003;278(3):1415–23. 10.1074/jbc.M203030200 WOS:000180462200008. [DOI] [PubMed] [Google Scholar]
  • 38.Norbeck J, Blomberg A. Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl. Evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway. J Biol Chem. 1997;272(9):5544–54. Epub 1997/02/28. 10.1074/jbc.272.9.5544 . [DOI] [PubMed] [Google Scholar]
  • 39.Norbeck J, Blomberg A. The level of cAMP-dependent protein kinase A activity strongly affects osmotolerance and osmo-instigated gene expression changes in Saccharomyces cerevisiae. Yeast. 2000;16(2):121–37. . [DOI] [PubMed] [Google Scholar]
  • 40.White WH, Skatrud PL, Xue Z, Toyn JH. Specialization of function among aldehyde dehydrogenases: the ALD2 and ALD3 genes are required for beta-alanine biosynthesis in Saccharomyces cerevisiae. Genetics. 2003;163(1):69–77. Epub 2003/02/15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Aranda A, del Olmo Ml M. Response to acetaldehyde stress in the yeast Saccharomyces cerevisiae involves a strain-dependent regulation of several ALD genes and is mediated by the general stress response pathway. Yeast. 2003;20(8):747–59. Epub 2003/06/10. 10.1002/yea.991 . [DOI] [PubMed] [Google Scholar]
  • 42.Wysocki R, Fortier PK, Maciaszczyk E, Thorsen M, Leduc A, Odhagen A, et al. Transcriptional activation of metalloid tolerance genes in Saccharomyces cerevisiae requires the AP-1-like proteins Yap1p and Yap8p. Mol Biol Cell. 2004;15(5):2049–60. 10.1091/mbc.e03-04-0236 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Arndt KT, Styles C, Fink GR. Multiple global regulators control HIS4 transcription in yeast. Science. 1987;237(4817):874–80. 10.1126/science.3303332 . [DOI] [PubMed] [Google Scholar]
  • 44.Marbach I, Licht R, Frohnmeyer H, Engelberg D. Gcn2 mediates Gcn4 activation in response to glucose stimulation or UV radiation not via GCN4 translation. J Biol Chem. 2001;276(20):16944–51. 10.1074/jbc.M100383200 . [DOI] [PubMed] [Google Scholar]
  • 45.Schuller C, Brewster JL, Alexander MR, Gustin MC, Ruis H. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene. EMBO J. 1994;13(18):4382–9. Epub 1994/09/15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Alepuz PM, de Nadal E, Zapater M, Ammerer G, Posas F. Osmostress-induced transcription by Hot1 depends on a Hog1-mediated recruitment of the RNA Pol II. EMBO J. 2003;22(10):2433–42. Epub 2003/05/14. 10.1093/emboj/cdg243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Pokholok DK, Zeitlinger J, Hannett NM, Reynolds DB, Young RA. Activated signal transduction kinases frequently occupy target genes. Science. 2006;313(5786):533–6. Epub 2006/07/29. 10.1126/science.1127677 . [DOI] [PubMed] [Google Scholar]
  • 48.De Nadal E, Zapater M, Alepuz PM, Sumoy L, Mas G, Posas F. The MAPK Hog1 recruits Rpd3 histone deacetylase to activate osmoresponsive genes. Nature. 2004;427(6972):370–4. Epub 2004/01/23. 10.1038/nature02258 . [DOI] [PubMed] [Google Scholar]
  • 49.Mas G, de Nadal E, Dechant R, Rodriguez de la Concepcion ML, Logie C, Jimeno-Gonzalez S, et al. Recruitment of a chromatin remodelling complex by the Hog1 MAP kinase to stress genes. EMBO J. 2009;28(4):326–36. Epub 2009/01/21. 10.1038/emboj.2008.299 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Cook KE, O'Shea EK. Hog1 controls global reallocation of RNA Pol II upon osmotic shock in Saccharomyces cerevisiae. G3 (Bethesda). 2012;2(9):1129–36. Epub 2012/09/14. 10.1534/g3.112.003251 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Westfall PJ, Patterson JC, Chen RE, Thorner J. Stress resistance and signal fidelity independent of nuclear MAPK function. Proc Natl Acad Sci U S A. 2008;105(34):12212–7. Epub 2008/08/23. 10.1073/pnas.0805797105 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Juan Mata

21 May 2020

PONE-D-20-12974

Hog1-induced transcription of RTC3 and HSP12 is robust and occurs in cells lacking Msn2, Msn4, Hot1 and Sko1

PLOS ONE

Dear Dr. Engelberg,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The reviewers have a number of comments that should be addressed.  This should be doable by modifying the text and by providing information that you probably already have (i.e., experiments should not be required as long as the qPCR experiments are biological replicates).

Please submit your revised manuscript by Jul 05 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Juan Mata, Ph.D.

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements:

1.    Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

 

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this manuscript, Bai et al describe a detailed analysis in which the individual contributions of different transcriptional activators was determined in the induction of four Hog1-regulated genes in budding yeast. Hot1, Sko1, and Msn2/4 are known to respond to osmotic stress, through activated Hog1, in order to induce expression of osmoresponse genes. Here, the specific contribution of each of these factors, at four specific target genes, is determined by transcription factor gene knock-out and promoter deletion analyses.

The study is largely technically sound, well-controlled, and convincing. However, the following points should be addressed.

1. Starting on line 244, the authors refer to an analysis of a STRE-LacZ reporter that is not active in BY4741ras2Δ cells. Can they show this data? This is important for supporting the claim that Msn2/4 is not de-repressed in BY4741 cells.

2. Lines 305 – 309 refers to two Hot1-binding sites underlined in Fig. 1E between -707 to -389, but nothing is underlined in this region. Consequently, it’s not clear how this promoter region is used primarily by Hot1, as stated. Can the authors address this?

3. The authors indicate that the beta-gal assays were done in triplicate, but it’s not explicitly indicated that the qRT-PCR were also performed as independent replicates. Can the authors confirm this? Also, no statistical analysis (e.g. Students’ T-Test) is used. Although many of the differences are obvious as judged by eye, to be rigorous, p-values can be included, particularly where differences are not dramatic.

4. The authors refer to Table 1 containing primer sequences, but I did not find this table in the PDF package.

5. There’s a verb missing in the sentence starting on line 189: “In a previous study we already the RTC3 promoter …”

6. On line 250 “Figs 1D and D” should be “1C and D”.

7. On lines 308 and 312 “Fig 1D” should be “Fig 1E.”

8. On line 319, “backupping factors” is a bit awkward. “Backup factors” might be more appropriate.

Reviewer #2: All the comments to the manuscripto have been uploaded in the attached file. A major revision, including manuscript structure, contents, graphics and statistical analysis, is required before publication in Plos One.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Peer review for PLOS ONE.pdf

PLoS One. 2020 Aug 17;15(8):e0237540. doi: 10.1371/journal.pone.0237540.r002

Author response to Decision Letter 0


30 Jun 2020

A point-by-point list of response to reviewers’ comments

Reviewer 1:

1. The reviewer asks to show the data regarding STRE-LacZ activity – we thus added this data as an upper panel in Figure 1F.

2. The reviewer comments about sequences, which were underlined in Fig. 1E, and were not referred to properly in the text – we agree with the reviewer that the text in these lines and its relatedness to the figure were confusing. We now removed all lines from the sequence in Figure 1E and simplified the explanation in lines 316-325 (in the new version).

3. The reviewer asks whether qRT-PCR analysis was performed in three repeats just as β-galactosidase assays were – in the new version we more explicitly state this matter (lines 180-181) and explain the related statistical analysis (lines 181-183).

4. The reviewer noted that the primers Table is missing. This must have been a technical problem. In any case, as only 8 primers appeared in the Table we now simply added them as a list in Materials and Methods (lines 174-177).

5. The verb was added: cloned. Now in line 199.

6. The letter D was changed to E. We thank the reviewer for his/her so rigorous reading.

7. 1D was changed to 1E. Thanks again.

8. The word backupping was changed to backup factors (now line 334).

Reviewer 2:

1. The reviewer suggests to add more information on the physiological functions of the genes studied – although the study deal with transcription of these genes, we accepted the recommendation and added: 1) information on the enzymatic activity of each of the gene products (in lines 195-205). Some information on the physiological functions of each gene products is provided now in lines 306-308, 404-406, 454-456, 496-498.

2. Figure legend and titles of legends were shortened.

3. Figures resolutions were improved.

4. Legends of graphs were shortened.

5. Many more references were added, including the one recommended by the reviewers.

Added references are: 31, 33, 34, 38, 40, 41.

6. The order of authors is determined by the website – corrected now.

7. The letter s was added.

8. The word background is now spelled correctly.

Attachment

Submitted filename: Response to Reviewers.docx

Decision Letter 1

Juan Mata

23 Jul 2020

PONE-D-20-12974R1

Hog1-induced transcription of RTC3 and HSP12 is robust and occurs in cells lacking Msn2, Msn4, Hot1 and Sko1

PLOS ONE

Dear Dr. Engelberg,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the minor points raised by reviewer 2.

Please submit your revised manuscript by Sep 06 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Juan Mata, Ph.D.

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this revised manuscript, the authors have now addressed all my comments to my satisfaction. I believe it is now suitable for publication in PLoS ONE.

Reviewer #2: Authors addressed most of the points raised in the first round of revision.

I still have some concerns on figures’ resolution, at least the ones I can see in the file PONE-D-20-12974_R1. Figs.1,2,3,4, including graphs, sequences and immunoblot analysis, continue to appear with poor resolution, especially when enlarged, and, in my personal opinion, could be further improved.

Also the text of figures’legend requires a further improvement. Here follow some suggestions for a typical legend:

-This title could be enough, other info are provided in the text: RTC3 promoter is regulated primarily by the Ras/cAMP/Msn2/4 pathway;

-Cell growth conditions should be indicated;

-RNA extraction should be mentioned since it precedes the quantification of mRNA levels by qRT-PCR, as in the case of Fig.1A, for example.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2020 Aug 17;15(8):e0237540. doi: 10.1371/journal.pone.0237540.r004

Author response to Decision Letter 1


24 Jul 2020

Dr. Juan Mata

Academic Editor, PLOS ONE

Re: PONE-D-20-12974

Dear Dr. Mata,

Many thanks for your e-mail of July 23rd that included the reviewers’ comments to our revised manuscript. We have prepared a revised version in which we addressed all comments and hope that this version will merit publication in PLoS One. A point-by-point list of answers to reviewers’ comments is appended below.

Sincerely,

David Engelberg

A point-by-point list of response to reviewers’ comments

Reviewer 2:

1. The reviewer raises the issue of figures resolution. I fully agree with the reviewer’s comment that was also raised in the first reviewing round. We must note that we upload high quality figures that passed all tests of the PLoS One submission system. The reduction in quality occurs when the PDF file in created. I noticed this problem even before the reviewer’s comment and approached PLoS One assistance system. Here is the correspondence that clearly suggest that the issue is in the hands of PLoS One editorial staff:

Dear Dr. Engelberg,

Thank you for your email.

I'm sorry to hear that you're upset about the quality of your figures in the submission PDF. However, please be assured that the submission PDF is for reviewing purposes only and does not reflect the appearance of the final publication, should your manuscript be accepted. Instead, the figures will be typeset at the resolution of your original submitted figures.

Please also note that editors and reviewers will have access to the original source files you’ve provided via the blue download link in the top right corner of the PDF rendering of your figure.

For more information about our figure requirements, please see (https://journals.plos.org/plosone/s/figures).

Thanks for considering PLOS ONE for your work. Please feel free to contact us if you have other questions.

Best,

Eoin O'Connor

Editorial Office

PLOS | plos.org

Empowering researchers to transform science

1160 Battery Street, Suite 225, San Francisco, CA 94111

Case Number: 06690049

ref:_00DU0Ifis._5004P1Bd6nK:ref

--------------- Original Message ---------------

From: David Engelberg [engelber@mail.huji.ac.il]

Sent: 29/06/2020 15:42

To: plosone@plos.org

Subject: Re: PLOS ONE Decision: Revision required [PONE-D-20-12974] - [EMID:501e99ac72418e0f]

Hello,

I have just uploaded the revised manuscript at the website.

Two matters bother me:

A. The list of authors as appears in the submission manager (with me as the first author) is not the correct one - the correct one is as appears in the manuscript title page with Bai Chen as the first author [one of the reviewers commented on it]. I hope that if the paper is accepted the proper order of authors will appear on it.

B. Although I ran all figures through the Apex.PACE system, as requested, and although the quality is quite high as appears in the files, figures look less good on the final PDF file. I hope that, if the paper is accepted, this will not be the quality of the final publication.

Thanks for dealing with our manuscript.

Sincerely,

David Engelberg

2. The reviewer suggest to further shorten the titles of figure legends and to add description of growth conditions and RNA extraction. We accepted the comments. All figure legend titles have been shortened: lines 337, 438, 490 and 535. Growth conditions are now added (lines 141-151) and the kit used for RNA extraction is mentioned now in line 147.

Attachment

Submitted filename: Response to Reviewers2.docx

Decision Letter 2

Juan Mata

29 Jul 2020

Hog1-induced transcription of RTC3 and HSP12 is robust and occurs in cells lacking Msn2, Msn4, Hot1 and Sko1

PONE-D-20-12974R2

Dear Dr. Engelberg,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Juan Mata, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Acceptance letter

Juan Mata

3 Aug 2020

PONE-D-20-12974R2

Hog1-induced transcription of RTC3 and HSP12 is robust and occurs in cells lacking Msn2, Msn4, Hot1 and Sko1

Dear Dr. Engelberg:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Juan Mata

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Peer review for PLOS ONE.pdf

    Attachment

    Submitted filename: Response to Reviewers.docx

    Attachment

    Submitted filename: Response to Reviewers2.docx

    Data Availability Statement

    All relevant data are within the manuscript.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES