Skip to main content
NCBI home page
ACS Pharmacology & Translational Science logoLink to ACS Pharmacology & Translational Science
. 2020 Apr 9;3(4):644–654. doi: 10.1021/acsptsci.9b00107

Auranofin-Based Analogues Are Effective Against Clear Cell Renal Carcinoma In Vivo and Display No Significant Systemic Toxicity

Benelita T Elie †,‡, Karen Hubbard ‡,⊥, Buddhadev Layek #, Won Seok Yang ∇, Swayam Prabha #, Joe W Ramos ∇,*, Maria Contel †,‡,§,∥,∇,*
PMCID: PMC7432669  PMID: 32832867

Abstract

graphic file with name pt9b00107_0010.jpg

Effective pharmacological treatments for patients with advanced clear cell renal carcinoma (ccRCC) are limited. Bimetallic titanium–gold containing compounds exhibit significant cytotoxicity against ccRCC in vitro and in vivo and inhibit invasion and angiogenisis in vitro and markers driving these phenomena. However, in vivo preclinical evaluations of such compounds have not examined their pharmacokinetics, pathology, and hematology. Here we use NOD.CB17-Prkdc SCID/J mice bearing xenograft ccRCC Caki-1 tumors to evaluate the in vivo efficacies of two titanium–gold compounds Titanocref and Titanofin (based on auranofin analogue scaffolds) accompanied by pharmacokinetic and pathology studies. A therapeutic trial was performed over 21 days at 5 mg/kg/72h of Titanocref and 10 mg/kg/72h of Titanofin tracking changes in tumor size. We observed a significant reduction of 51% and 60%, respectively (p < 0.01) in tumor size in the Titanocref- and Titanofin-treated mice compared to the starting size, while the vehicle-treated mice exhibited a tumor size increase of 138% (p < 0.01). Importantly, no signs of pathological complication as a result of treatment were found. In addition, Titanocref and Titanofin treatment reduced angiogenesis by 38% and 54%, respectively. Microarray and qRT-PCR analysis of ccRCC Caki-1 cells treated with Titanocref revealed that the compound alters apoptosis, JNK MAP kinase, and ROS pathways within 3 h of treatment. We further show activation of apoptosis by Titanocref and Titanofin in vivo by caspase 3 assay. Titanocref is active against additional kidney cancer cells. Titanocref and Titanofin are therefore promising candidates for further evaluation toward clinical application in the treatment of ccRCC.

Keywords: clear cell renal carcinoma, kidney metastasis, mice xenograft model, pharmacokinetics, histopathology, unconventional chemotherapeutics

Kidney cancer is among the 10 most common cancers for both men and women (affecting them in a ratio 2:1).1 It was estimated that in the US about 73 820 new cases of kidney cancer will be diagnosed and that about 14 770 people will die of this disease in 2019.2 A number of risk factors such as age (being over 64), obesity, hypertension, inherited genetic syndromes, occupational exposure, smoking, treatments for kidney failure (dialysis and kidney transplant), and misuse of painkillers, are found for most individuals diagnosed with kidney cancer.1 For almost 85% of adults with kidney cancer, renal cell carcinoma (RCC) constitutes the most common type they experience;3 70% of these patients will present the clear cell renal cell carcinoma (ccRCC) disease.4 Effective treatment options for advanced stage and metastatic RCC are lacking with very low disease-free survival rates of only a few years in the advanced stages of ccRCC.5 In these stages, treatments based on targeted therapy and immunotherapy are the preferred options. Chemotherapies such as 5-FU and capecitabine are also used but only modest responses (20%) and survival (15 months) are obtained.6 During the past decade, the historic first-line therapies used were Interleukin-2 (IL2) and interferon alfa 2b (INFa2b) but they were only successful in high-doses for a limited number of patients (5–7%).7 The standard of care for first-line treatment is based on targeted therapies involving drugs such as sunitinib, pazopanib, axitinib, lenvatinib, or temsirolimus.5,8 The combination of chemotherapy with targeted therapies has recently shown promising results in clinical trials providing 20 months of survival on average.9 More recently, immunotherapies based on checkpoint inhibitors are revolutionizing the RCC landscape.10 Several of these checkpoint inhibitors have been effective for remission in a meaningful subset of patients while improving survival and having a manageable toxicity profile (as demonstrated in clinical trials for RCC). They are mostly PD-1, PD-L1, and CTLA-4 inhibitors such as Nivolumab, Ipimunab, aand Atezolimumab (to mention some) and have been reviewed recently.10 Nivulumab is now FDA-approved and used in the clinic, and several additional checkpoint inhibitors are in-line to be approved. The future success of these treatments for a higher number of patients seems to lie in combination therapy (either with VEGF or Tyrosine kinase inhibitors) and applying them in neoadjuvant and adjuvant settings.10 To improve patient outcomes, the development of new therapies for ccRCC (including chemotherapeutics) or therapies that can be used in combination with others, is warranted.

Despite the wide use in cancer chemotherapy of cisplatin,11 very few other metal-based drugs have received FDA approval or have progressed to clinical trials. This is due to a combination of factors which includes a distorted perception of the toxicity and selectivity of metal-based drugs, and the idea that all drugs containing metals have a mechanism and cancer-spectrum activity similar to that of cisplatin and its derivatives.12 While many efforts have been made to improve the delivery of platinum-based drugs (especially in nanomedicine)13 some of the research on unconventional metal-based compounds has been overlooked. There is good evidence that a number of metal-based compounds with metals other than platinum or nonconventional platinum derivatives are highly effective against cisplatin resistant cancers.14−16 In this context, compounds containing more than one metal in the same molecule (heterometallic) are emerging as attractive potential chemotherapeutics.17 These molecules are hypothesized to have an enhanced pharmacological profile due to a cooperative effect of the different metals (acting on distinct biological targets). In addition, a synergistic effect resulting from a change of the chemico-physical properties of the heterometallic compound, can also provide improved pharmacological properties. Since 2011, our lab has focused on gold-based compounds containing a second metal (titanium or ruthenium). Bimetallic compounds from these families have shown high efficacy against different cancers (ovarian, prostate, and colon).18,19 A number of titanium–gold20−24 and ruthenium–gold25−27 complexes have been very efficacious against renal cancer both in vitro(20−27) and in vivo.21,27

We report here on two bimetallic titanium–gold compounds, Titanocref and Titanofin (structure in Chart 1) which contain a scaffold similar to Auranofin (a gold(I) derivative coordinated to a triethylphosphane moiety and a thiolate, see Chart 1). We demonstrate their high efficacy in reducing tumor size and inhibiting angiogenesis in a subcutaneous ccRCC Caki-1 xenograft mouse model. We further show the pharmacokinetic and pathology studies and provide preliminary mechanistic evaluations. We previously reported that Auranofin has a similar efficacy to Titanocref and Titanofin in killing and hindering migration in Caki-1 cells,22 However, we found that unlike Titanocref and Titanofin, Auranofin also killed normal kidney cells. We therefore did not test it in the mouse model.

Chart 1. Compounds Used in This Studya.

Chart 1

Open in a new tab

a For in vivo efficacy trials bimetallic [(η5-C5H5)Ti(mba)Au(PR3)], R = Ph Titanocref; Et Titanofin; mba, mercaptobenzoate were studied.21,22 The structure of Auranofin (mentioned in the text) is also provided.

Results and Discussion

Toxicity Studies

Maximum tolerated dose (MTD) experiments indicated that male and female mice tolerated three intraperitoneal (IP) injections at doses of 15 mg/kg/48h of Titanocref and of 40 mg/kg/48h of Titanofin without notable signs of toxicity or changes to pathological parameters in the treated animals. There were, upon gross-necropsy, no signs of local toxicity in the peritoneal cavity.

At the lethal dose, mice had pronounced arched backs and presented heavy urination and defecation. At the maximum tolerated dose for the mice dosed with Titanocref, it was found that mice had heavy defecation and pronounced discolored liver dark red spleen. 50% of mice had mild arching on the day of the dosing and heavy defecation, but it redressed on days 2 and 3. For the mice dosed with Titanofin, it was found that mice presented redness around the eyes and heavy defecation. According to the veterinarian, all these effects at MTD were mild and within acceptable norm.

These findings informed the rationale for selecting the doses of 5 mg/kg for Titanocref and 10 mg/kg Titanofin for the subsequent in vivo efficacy, pharmacokinetic (Pk), and pathology analyses.

Pharmacokinetics and Biodistribution

The plasma concentration over time of Titanocref and Titanofin in mice is shown in Figure 1.

Figure 1.

Figure 1

Open in a new tab

Plasma concentration of the Ti metal of Titanocref and Titanofin at various intervals after single IP injection. Data represent mean ± SD (n = 4).

The pharmacokinetic parameters of Titanocref and Titanofin are indicated after single IP injection, which included the maximum plasma drug concentration (Cmax), the time to reach Cmax, (Tmax), the area under the plasma concentration–time curve from 0 h to last measurable concentration (AUClast), elimination rate constant (ke), plasma half-life (t1/2), apparent total clearance of the drug from plasma (Cl/F), and apparent volume of distribution (Vd/F) (Table 1).

Table 1. Pharmacokinetica Parameters of Titanocref and Titanofin after Single Intraperitoneal Injection in Tumor-Bearing Mice.

pharmacokinetic parameters Titanocref Titanofin
dose (mg/kg), ip 5 10
Cmax (μg/mL) 57.2 ± 1.8 29.7 ± 7.6
Tmax (h) 10.5 ± 3.0 21.0 ± 6.0
AUC0–72h (μg·h/mL) 2473.9 ± 223.4 1346.6 ± 76.8
ke (h–1) 0.022 ± 0.003 0.014 ± 0.006
t1/2 (h) 32.7 ± 4.4 56.0 ± 21.6
Vd/F (mL/kg) 72.7 ± 4.6 298.8 ± 71.4
Cl/F (mL/h/kg) 1.6 ± 0.2 3.9 ± 0.9
Cmin ss (μg/mL) 20.8 ± 3.5 25.6 ± 9.4
time to steady state (h) 163.6 ± 22.2 280.1 ± 107.9
Open in a new tab
a

Pharmacokinetic parameters determined include the maximum observed plasma concentration (Cmax), the time to reach Cmax (Tmax), area under the plasma concentration–time curve from time zero to 72 h post dose (AUC0–72h), elimination rate constant (ke), terminal elimination half-life (t1/2), apparent total clearance from plasma (Cl/F), and apparent volume of distribution (Vd/F).

Both Titanocref and Titanofin were absorbed slowly and the peak plasma concentration was reached after 12 h for Titanocref, and 24 h for Titanofin after dosing. Compounds were eliminated slowly from the blood compartment with an elimination half-life (t1/2) of 32.38 h (Titanocref), and 47.16 h (Titanofin). At the end of the pharmacokinetic and efficacy studies, the concentration of each compound in liver, kidney, and tumor was determined (Figure 2). Titanocref had a higher concentration in the liver followed by tumor and kidney. Titanofin also exhibited higher accumulation in liver and similar concentration in kidney and tumor. Concentrations in liver and kidney significantly decreased after the efficacy study. Importantly, after a single administration, an abundant amount of each compound was found in the tumor tissue. It is relevant to note that both metals (titanium and gold) are found in an approximate ratio of 1:1 in organs and tumor which indicates the potential stability in vivo of the bimetallic compounds.

Figure 2.

Figure 2

Open in a new tab

Tissue distribution profile of Titanocref (A) and Titanofin (B) at the end of the pharmacokinetic study (72 h postinjection). Data represent mean ± SD (n = 4). Tissue distribution of Titanocref (C) and Titanofin (D) at the end of the efficacy study. Data represent mean ± SD (n = 5 for tumor and liver samples of Titanocref and n = 4 for all other samples). Below the X-axis (C and D), Ti/Au represents the ratio of the two metals in each tissue.

Efficacy

The in vivo anticancer efficacy of Titanocref and Titanofin was determined in xenograft Caki-1 tumor bearing NOD.CB17-Prkdc SCID/J mice following IP administration of seven doses spaced by 72h followed by a 72h recovery period before sacrifice. In mice treated with Titanocref and Titanofin, we observed significant reduction in tumor burden by 51% and 60%, respectively, after 21 days of treatment (a total of seven doses) (Figure 3). No significant change in weight or decline in the well-being of the Titanocref- and Titanofin-treated mice was observed during this trial. These results indicate that Titanocref and Titanofin have very strong tumor reducing properties.

Figure 3.

Figure 3

Open in a new tab

Titanocref and Titanofin treatment significantly inhibit tumor growth in a xenograft renal cancer model. Percent change in tumor burden is shown in a cohort of 3 females and 3 males NOD.CB17-Prkdc scid/J mice inoculated subcutaneously with 5 × 106 Caki-1 cells. The treatment started when tumors were palpable (∼5 mm diameter). Six mice were treated with Titanocref (orange line) and Titanofin (green line) administered in the amount of 5 mg/kg/72h or 10 mg/kg/72h respectively IP. Six mice were treated with the 100 μL of the vehicle (0.5% DMSO + 99.5% normal saline) (black line) administered once/72h IP for 21 days, and tumor burden was measured by caliper twice a week. (A) Representative tumors resected from each treatment group. (B) The average tumor volume after 21 days of treatment in Titanocref- and Titanofin-treated mice had an average tumor shrinkage of 51% and 60%, respectively (p < 0.01) compared to the vehicle (Veh) control-treated group for which tumor volume increased by 138%, p < 0.01. Titanocref: n = 6 mice, Titanofin: n = 6 mice, Veh: n = 6 mice.

Mechanism of Action

Because tumor growth can also reflect changes in cell death, we compared the proliferation rate to apoptotic rates using the proliferation marker ki-67 and apoptotic marker cleaved caspase 3. The average of proliferating cells in tumors of the vehicle-treated mice control group was 36%, which was reduced to 16.2% in and 17.3% in tumors treated with Titanocref and Titanofin, respectively, while the average of apoptotic cells in individual tumors of the vehicle- treated control mice was 2%, which was increased to 6.2% and 7.9% in tumors treated with Titanocref and Titanofin, respectively (Figure 4). Thus, Titanocref and Titanofin affected the proliferation to apoptosis cell ratio in the xenograft model.

Figure 4.

Figure 4

Open in a new tab

Effects of Titanocref and Titanofin treatment on the balance between cell proliferation and apoptosis in Caki-1 xenograft tumors. Titanocref and Titanofin treatment affects the proliferation and apoptosis ratio/equilibrium at the 21-day trial end point. (A) Proliferating cells were detected by Ki67 staining (red) and apoptotic cells were detected by cleaved caspase 3 staining (red). Representative images are shown for vehicle-treated tumors (left panel) and Titanocref- and Titanofin-treated tumors (right panels) at the 21-day trial end point. (B) Graph on the bottom shows the percentage of proliferating cells (Ki67 positive, green bars) and the percentage of apoptotic cells (cleaved caspase 3 positive, red bars) over the total number of DAPI-positive cells in the tumor. Titanocref and Titanofin treatment reduces tumor cell proliferation by 47% and 38%, respectively, and increases apoptosis by 2.7-fold and 3.1-fold, respectively. ***P < 0.001. The mean and SD are indicated in both graphs, n = 5 mice per group.

Angiogenesis Analysis

We previously determined in vitro that both Titanocref and Titanofin disrupt vascular assembly and noted that they were potent inhibitors of IL-6 and VEGF.22 It has been shown that inhibition or deletion of IL-6 and VEGF in mice induced a significant decrease in tumor invasion and angiogenesis.32 Thus, we sought to determine if the use of our compounds disrupted angiogenesis in vivo. By staining tumors extracted from mice following the efficacy study, we observed that indeed, Titanocref and Titanofin treatment resulted in a 38% and 54% reduction of vascular distribution, respectively, as indicated by the decrease in lectin positive staining, while also increasing vascular integrity as evidenced by the reduction of the dextran positive surface correlated to vessel leakiness (Figure 5).

Figure 5.

Figure 5

Open in a new tab

Titanocref and Titanofin treatment affects tumor angiogenesis at the 21-day end point. (A) The tumor vasculature was analyzed by intravenous perfusion with Dextran (Texas Red) and endothelial specific cell surface marker Lectin (n = 2 mice per group). (B) The percentage of Lectin-labeled blood vessels over the total tumor area is graphed in green, showing a significant decrease in blood vessel coverage between the Titanocref-, Titanofin-, and vehicle-treated tumors ***P < 0.001. The percentage of dextran-stained surface over the total tumor area is graphed in red, showing a significant difference in vessel leakiness (measured by dextran dispersion from blood vessels) between Titanocref-, Titanofin-, and vehicle-treated tumors. **P < 0.01, ***P < 0.001.

Pathology

A complete pathology study was performed and revealed that no significant adverse effects were observed after histological evaluation related to the Titanocref and Titanocref treatment (Table 2, Figure 6). A total of 47 organ and tissue types were analyzed (heart, lungs, thymus, kidneys, liver, gallbladder, stomach, duodenum, jejunum, ileum, cecum, colon, mesenteric lymph node, salivary glands, submandibular lymph node, uterus, cervix, vagina, testes/epididymis, prostate, seminal vesicles, urinary bladder, spleen, pancreas, adrenals, ovaries, oviducts, trachea, esophagus, thyroid, parathyroid, skin (trunk), mammary glands, bones (femur, tibia, sternum, vertebrae), bone marrow (femur, tibia, sternum, vertebrae), stifle joint, skeletal muscles (hind limb, spine), nerves (hind limb, spine), spinal cord, oral cavity, teeth, nasal cavity, eyes, harderian gland, bones (skull), pituitary, brain, ears, other organs) and indicated no pathological adverse-consequences from Titanocref or Titanofin.

Table 2. Summary of Histological Dataa.

  DMSO Titanocref Titanofin
body weight (g) 22.82 ± 2.14 23.78 ± 3.58 22.96 ± 2.48
liver weight (g) 1.17 ± 0.28 1.24 ± 0.21 1.26 ± 0.17
spleen weight (g) 0.05 ± 0.01 0.042 ± 0.004 0.05 ± 0.003
heart weight (g) 0.13 ± 0.02 0.17 ± 0.05 0.14 ± 0.02
average kidney weight (g) 0.17 ± 0.05 0.19 ± 0.04 0.19 ± 0.04
Open in a new tab
a

Following a 21-day course of treatment with Titanocref, Titanofin, or Vehicle Control once every 72 h, mice were euthanized, and organs were collected via necropsy and weighed immediately after collection. The mean and SEM are indicated in the table, n = 3 mice per group.

Figure 6.

Figure 6

Open in a new tab

Titanocref and Titanofin treatment does not induce histological changes in liver, spleen, or kidney tissue of mice at the end of the 21 day efficacy trial. Histopathology on H&E staining of paraffin sections magnification 20×. Sections are representative of three mice of each treatment.

In addition, the physicochemical study and complete blood count demonstrated no significant changes as a result of treatment with these bimetallic titanium–gold compounds. We found no notable difference in total body weight or organ weight between the control mice and those treated with Titanocref and Titanofin at the end of the trial. The data also suggest that there were no enlargements or atrophy as a result of treatment. All kidney health indicators were within normal values. Finally, we found no differences in the clinical chemistry of the control animals and those treated with Titanocref and Titanofin (Table S1), indicating normal production and excretion of physiological fluids and metabolic markers whose deregulation are indicators of pathology or drug side effects.

Microarray Analysis

Microarray analysis to examine changes in transcription in cells treated with various compounds can provide insight into the mechanism by which the compound affects cell functions and cell survival.28 Previously, we reported that Titanocref induces apoptosis in Caki-1 cells beginning within 6 h (10 μM).21,22 At sublethal doses (IC20) we further found that Titanocref can block proangiogenic factors and induce cytokine secretion at 72 h. To further understand the mechanism by which these bimetallic compounds induce apoptosis at doses which activate cell death, we here used microarray analysis to evaluate Titanocref. To capture the early transcriptional response to treatment, we treated Caki-1 cells with Titanocref (500 nM) for 3 h, which is prior to the cells undergoing apoptosis, and collected mRNA for analysis. We detected 15 altered transcripts (mRNAs; Table 3) after Titanocref treatment with 12 mRNAs up-regulated and 3 mRNAs down-regulated (>2.0-fold, P < 0.05). The 15 mRNAs were identified using Transcriptome Analysis Console (TAC) software for gene expression. We further validated these findings using qRT-PCR on three independent replicates (Figure 7A). Wiki pathway analysis (Figure 7B) showed that these genes are part of 17 significant pathways (P < 0.05). The primary ones are the Parkin-Ubiquitin proteasomal system, MAPK signaling, NRF2, Nuclear Receptors Meta, IL-10 anti-inflammatory signaling, and Apoptosis modulation pathways. Gene Ontology (GO) analysis of these 15 genes using Database for Annotation Visualization and Integrated Discovery (DAVID) revealed Titanocref alteration of biological processes (Figure 7C) related to cellular response to heat, regulation of cell death, regulation of ubiquitination, inactivation of MAPK activity, negative regulation of GTPase activity and cellular response to oxidative stress (P < 0.05). The indicated pathways and biological processes are highly overlapping and together indicate strong evidence of Titanocref dependent apoptosis by alteration of MAPK pathways and/or inducing oxidative stress pathways.

Table 3. Titanocref Altered mRNAs in Caki-1 Kidney Cancer Cellsa.

gene symbol description fold change P-value
HMOX1 heme oxygenase 1 56.3 1.39 × 10–12
HSPA6 heat shock 70 kDa protein 6 (HSP70B) 5.9 1.45 × 10–05
HSPA1A heat shock 70 kDa protein 1A 5.05 1.13 × 10–06
HSPA1B heat shock 70 kDa protein 1B 4.79 3.48 × 10–06
KIF5B Kinesin-1 heavy chain 2.8 0.013
DUSP5 dual specificity phosphatase 5 2.73 2.11 × 10–08
LRRC28 Leucine rich repeat containing 28 2.49 0.0323
DUSP1 dual specificity phosphatase 1 2.43 1.04 × 10–05
FAM151B family with sequence similarity 151 member B 2.4 0.0139
BAG3 BCL2-associated athanogene 3 2.25 0.0005
ZFAND2A zinc finger, AN1-type domain 2A 2.15 5.90 × 10–07
DNAJB1 DnaJ (Hsp40) homologue, subfamily B, member 1 2.09 7.42 × 10–05
MAATS1 MYCBP-associated, testis expressed 1 –2.01 0.0153
KLRC4 killer cell lectin-like receptor subfamily C, member 4 –2.12 0.0006
MYRFL Myelin regulatory factor-like –2.35 0.0045
Open in a new tab
a

12 up-regulated and 3 down-regulated differentially expressed genes list after Titanocref treatment. Transcripts from nontreated and Titanocref treated were aligned and considered as differentially expressed genes with at least 2-fold change difference and p < 0.05.

Figure 7.

Figure 7

Open in a new tab

Validation of transcript changes by qRT-PCR and bioinformatics analysis of 15 mRNA genes altered by Titanocref treatment in Caki-1 cells. (A) Expression of BAG3, DNAJB1, HMOX1, HSPA1A, and HSPA6 genes were determined by quantitative Real Time PCR (qRT-PCR). Transcript expression was normalized relative to the expression of the GAPDH (graph shows result representative of 3 independent experiments, p < 0.05). (B) Wiki pathway analysis from TAC software is shown. The top six pathways based on significant scores were identified (p < 0.05). (C) Gene ontology enrichment analysis of differentially expressed genes in Titanocref treated cells. The GO terms of biological process were from the DAVID database (p < 0.05).

The analysis of transcripts upregulated by Titanocref indicates that it likely induces cell death through effects on reactive oxygen species (ROS). The HMOX1 gene was the most up-regulated gene among 15 genes and is associated with ROS driven oxidative stress responses.29 Furthermore, downstream of ROS, nuclear factor-like 2 (Nrf-2) pathway target genes DNAJB1 and HSAP1A also were increased by Titanocref. The wiki pathway results are consistent with those of GO term analysis, supporting increased oxidative stress by Titanocref. Oxidative stress is well established to activate apoptosis.30 Similarly, platinum-based chemotherapy induces oxidative stress which is linked to the effectiveness of these treatments.31 We also observed increased DUSP1 and HSPA6 genes. These can inhibit p38-MAPK or JNK pathways and may represent a failsafe mechanism for cell survival and do not easily explain the induced apoptosis. Thus, Titanocref likely works through ROS related mechanisms.

Discussion

While other metal-based drugs have been tested in vivo in renal cancer mice xenograft models (see selected compounds in Chart 2)27,33−37 all these compounds were able to only decrease tumor growth. These studies did not include histopathology and only a few reports contained some preliminary mechanistic data.

Chart 2. Most Relevant Metal-Based Compounds Studied In Vivo in RCC Mice Xenograft Models27,33,37.

Chart 2

Open in a new tab

For one titanium compound Titanocene Y*, the decrease in growth was accompanied by a decrease in the proliferation marker ki-67.33 For an organometallic iridium compound ([Ir(tpy)(dnbpy)] there was inhibition of H-Ras/Raf-1 interaction accompanying the tumor growth inhibition observed.37 Most recently our group reported on the effects of a Au(I)–Ru(II) bimetallic derivative [Cl2(p-cymene)Ru(μ-dppm)Au(IMes)]ClO4 (RANCE-1) in the same renal cancer mice xenograft models.27 The inhibition of tumor growth for this compound coincided with a significant decrease in proliferation, and a reduction in the expression of growth factors known to drive malignant tumor progression phenotypes including angiogenesis such as VEGF and hyperproliferation such as, PDGF, FGF, EGFR, and HGRF. Like for the two titanium–gold compounds described here (Titanocref and Titanofin), there were no signs of grave clinical side effects. As for Titanocref and Titanofin, there was a similar decrease in the proliferation marker ki-67 of 36% for RANCE-1 (versus a decrease of 47% for Titanocref and 38% for Titanofin). What differentiates these two unconventional metal-based titanium–gold compounds from the compounds reported previously (including ruthenium–gold RANCE-1) is that they display a dramatic tumor size decrease (not only a reduction of tumor growth). We had previously reported on the in vivo activity of Titanocref in the same mouse xenograft model, but the dosage employed (5 mg every 48 h) prevented us from getting reliable and meaningful PK data (the drug had not cleared from the body in this short period). In addition, we did not perform pathology studies at that time.21 We demonstrate here that Titanocref and Titanofin increase apoptosis in vivo and affect tumor angiogenesis. This is in agreement with our previous findings that at sublethal doses (IC20) the compounds impair secretion of proangiogenic factors including VEGF at 72 h incubation.22 Subcutaneous models were used for the purposes of showing efficacy against the tumor line in vivo and to determine any toxicity associated with treatment. Additional tests of mouse kidney cancer models where the tumor is genetically induced in situ in the kidney are required to determine if the compounds can reach the tumors and are effective against these tumors as well. The microarray analysis of ccRCC Caki-1 cells treated with Titanocref provides a glimpse into the possible mode of action of these bimetallic titanium–gold compounds at doses that induce cell death. The study revealed that Titanocref alters apoptosis and ROS pathways within 3 h of treatment at 500 nM. JNK Map kinase pathways were also affected. As mentioned before, platinum-based chemotherapy induces oxidative stress which is linked to the effectiveness of these treatments.29 It is also well-known that a number of gold(I) compounds (including Auranofin) activate apoptosis through production on ROS.38−40 It has been shown recently that the modulation of ROS and glycolysis by Auranofin can cause elimination of stem-like cancer cell side population.41 These findings are in alignment with our previous report showing induction of apoptosis and increased HIF-1 protein expression at sublethal doses (IC20 over 72 h).22 This study extends those findings by revealing a very early effect on transcription related to ROS and suggests this may be a primary mediator of the effects. We further find here that Titanocref is also active in killing other kidney cancer lines in addition to Caki-1.

Conclusions

Heterobimetallic titanium–gold complexes Titanocref and Titanofin drastically shrink tumors in mice bearing xenografted metastasis-derived ccRCC tumors without any detectable side effects. The pathology study concluded that there is no evidence of systemic adverse effects resulting from 21 days of treatment with either Titanocref or Titanofin. The reduction in tumor burden coincided with a significant decrease in proliferation, an increase of apoptosis, and considerable tumor angiogenesis disruption. Our previous experiments showed that sublethal doses of Titanocref and Titanofin (IC20 at 72 h) markedly impaired secretion of proangiogenic factors VEGF and TrxR which likely explains the disruption of angiogenesis in the mice. To determine potential mechanisms of the induction of cell death, a microarray analysis of Titanocref shows that this compound alters apoptosis, ROS, and JNK kinase pathways. We previously found that these compounds increased HIF-1 protein levels by 72 h22 which is likely the result of the increased ROS. These data provide a mechanism for early induction of apoptosis through titanocref mediated changes in JNK activation and concurrent increases in ROS. We further found that Titanocref was active against additional kidney cancer cell lines (A498 and UO-31), (results not shown) suggesting its activity in kidney cancer is broadly effective.

These very promising results demonstrate the potential of some unconventional metal-based drugs (such heterometallic complexes) as efficacious anticancer agents without systemic toxicity. Titanofin and Titanocref are therefore ideal candidates for further preclinical evaluation and development in the treatment of advanced clear cell renal carcinoma (ccRCC) for which options are extremely limited.

Methods

Cell Culture

Caki-1, a human epithelial clear cell renal cell carcinoma (ccRCC) line derived from a metastasis to the skin was newly obtained for these studies from the National Cancer Institute Developmental Therapeutics Program (Bethesda, MD) and cultured in Roswell Park Memorial Institute (RPMI-1640) (Mediatech Inc., Manassas, VA) media containing 10% fetal bovine serum (FBS, Life Technologies, Grand Island, NY), 1% Minimum Essential Media (MEM) nonessential amino acids (NEAA, Mediatech), and 1% penicillin-streptomycin (PenStrep, Mediatech) and incubated at 37 °C and 5% CO2 in a humidified incubator.

Determination of Maximum Tolerated Dose (MTD) of Titanocref and Titanofin

Naïve NOD.CB17-Prkdc SCID/J mice were used to determine the MTD of Titanocref and Titanofin. Following 6 IP doses between 15 mg/kg/48h and 50 mg/kg/48h followed by a two-week recovery period. Vehicle solution (0.5% DMSO + 99.5% normal saline) treated mice were used as controls. Lung, liver, kidney, spleen, and heart were collected, weighed, and visually evaluated during a gross necropsy. Parameters such physical distress and mortality were monitored.

In Vivo Biodistribution Analysis of Titanocref and Titanofin

Female and male NOD.CB17-Prkdc scid/J mice bearing subcutaneous (subcu) Caki-1 tumors and treated with Titanocref (5 mg/kg) and Titanofin (10 mg/kg) intraperitoneally were used for pharmacokinetic and biodistribution studies. Blood was collected from submandibular vein using a heparin-coated glass capillary into heparinized blood collection tubes on ice at time intervals of 1, 2, 6, 24, and 48 h postinjection. Plasma was harvested by centrifuging blood samples at 2800 rpm/97 RCF for 15 min at 4 °C and stored frozen at −80 °C until analysis. Similarly, kidney, liver, and tumor were harvested after final time point, weighed, and stored in glass vials. One milliliter of deionized water was added to each tissue sample, subjected to ultrasonic homogenization at 15 W power for 1 min, followed by lyophilization.

Plasma and tissue concentrations of titanium and gold were measured using inductively coupled plasma-mass spectrometry (ICP-MS). Plasma (10 μL) or tissue samples were transferred into glass vials, and 1 mL of a 75:25 mixture of nitric acid (16 N) and hydrochloric acid (12 N) was added to each vial. The mixture was then heated at 90 °C for 5 h. After cooling to room temperature, the samples were centrifuged to remove debris if any. All samples were then mixed with 40 ppb of indium internal standard and analyzed using a Thermo Scientific XSERIES 2 ICP-MS coupled with ESI PC3 Peltier cooled spray chamber, SC-FAST injection loop, and SC-4 autosampler. All the elements were measured using a He/H2 collision-reaction mode. Plasma and tissue samples from control mice were spiked with known concentrations of Titanocref and Titanofin to determine its extraction efficiency.

Postintervention Trial Biodistribution

Female and male NOD.CB17-Prkdc scid/J mice bearing subcutaneous Caki-1 tumors were treated with 5 mg/kg/72h of Titanocref or 10 mg/kg/72h of Titanofin IP over 21 days. Subsequently the liver, kidney, and tumor tissue of the animals were harvested, weighed, and transferred into glass vials. Tissue samples were processed as described above and analyzed for ruthenium and gold content using ICP-MS.

Pharmacokinetic parameters were obtained from the plasma concentration–time profiles by noncompartmental analysis using Phoenix WinNonlin 6.4 version 6.4 (Pharsight Corporation, Mountain View, CA). The pharmacokinetic parameters quantified were the maximum plasma drug concentration (Cmax), the time to reach Cmax (Tmax), the area under the plasma concentration–time curve from 0 h to last measurable concentration (AUClast), elimination rate constant (ke), plasma half-life (t1/2), apparent total clearance of the drug from plasma (Cl/F), and apparent volume of distribution (Vd/F). Concentrations of ruthenium and gold in liver, kidney, and tumors were also determined.

Preparation of Histological Samples and Immunohistochemistry

Tissue sections were prepared by embedding in OCT (Thermo Fisher Scientific, Waltham, MA) followed by freezing at −80 °C. Vessel leakiness was evaluated following tail-vein injection of 100 μL of Dextran Texas Red (Invitrogen). Vessel integrity was assessed after tail-vein injection of 50 μL of lectin labeled with FITC (Vector Laboratories, Burlingame, CA). Apoptotic cells were visualized using an antirabbit cleaved caspase 3 primary antibody (Cell Signaling Technology, Danvers, MA) and a goat-antirabbit Alexa Fluor 594 secondary antibody (Cell Signaling Technology); proliferating cells were visualized using an antimouse Ki67 primary antibody (Cell Signaling Technology) and a goat-antimouse Alexa Fluor 488 secondary antibody (Cell Signaling Technology); DAPI containing ProLong Gold Antifade Mounting Medium (Cell Signaling Technology) was used to visualize the nuclei and mount the slide.

Analysis of Cell Proliferation, Apoptosis, Angiogenic Coverage

For all histological analyses, tumors from treated mice were compared to those of the vehicle control. Samples from four mice per treatment group were analyzed. Stained samples were imaged at 20× magnification (ZEISS LSM 700). Cell proliferation and apoptosis were quantified one channel at a time using ImageJ and were calculated as the percentage of Ki67 positive or cleaved caspase 3 positive cells per DAPI positive cells per field of view. Vessel area as defined by lectin-covered area and vessel leakiness was determined by dextran-covered area and was determined using ImageJ imaging software (NIH, open access software). All the image analyses were performed treatment-blind.

Preparation of Samples for Pathology

At the end of the intervention trial, female and male NOD.CB17-Prkdc scid/J mice bearing subcutaneous Caki-1 tumors were euthanized, blood was collected by intracardiac perfusion, and the carcasses were perfused with 4% PFA. Lung, kidney, heart, spleen, lymphatic tissue were collected, mounted in paraffin, sectioned, and stained by Hemotoxilyn & Eosin. Samples were imaged at 20× under a lighted microscope for analysis.

Expression Profiling by Microarray Chip Assay

Processing of the RNA samples (three biological replicates from WT and clone 7 cells) was performed at the Genomics and Bioinformatics Shared Resource, Cancer Center, University of Hawaii.

RNA samples integrity was checked on Agilent 2100 Bioanalyzer using an RNA Nano chip. Samples were prepared for microarray hybridization as described in the Thermo Fisher Scientific GeneChip Whole Transcript (WT) Expression manual. Double-stranded cDNA was generated from 100 ng of total RNA. Subsequently, cRNA was synthesized using the WT cDNA Synthesis and Amplification Kit (Thermo Fisher Scientific). cRNA was purified and reverse transcribed into single-stranded (ss) DNA. Subsequently a combination of uracil DNA glycosylase (UDG) and apurinic/apyrimidinic endonuclease 1 (APE 1) was used to fragment ssDNA, which was afterward labeled with biotin (WT Terminal Labeling Kit, Thermo Fisher Scientific). In a rotating chamber, 2.3 μg of DNA were hybridized to the Clariom S Human Array for 16 h at 45 °C. After washing and staining on Affymetrix Fluidics Station FS450 using preformulated solutions (Hyb, Wash & Stain Kit, Thermo Fisher Scientific), the hybridized arrays were scanned on the Affymetrix GeneChip Array Scanner 3000-7G. The expression intensity data were extracted from the scanned images and stored as CEL files. Generated CEL files were normalized using the SST-RMA-GENE-FULL algorithm in the Transcriptome Analysis Console (TAC) software.

RNA Extraction, RT-PCR, and Real-Time PCR

Total RNA was extracted using DNA/RNA AllPrep Mini Kit (Qiagen) according to the manufacturer’s instructions. The RNA integrity was analyzed on Bioanalyzer RNA Nano chip (Agilent). One microgram of total RNA was used for cDNA synthesis with random hexamers using High-Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). Real-time-PCR amplification was carried out using QuantStudio 12k Flex instrument (ThermoFisher Scientific) with 40 cycles of amplification and primer annealing temperature of 60 °C. Reactions were run in technical triplicates. The primer sequences for BAG3; FWD-TGCCAGAAACCACTCAGCCAGA, REV-TGAGGATGAGCAGTCAGAGGCA, DNAJB1; FWD-AGTTCAAGGAGATCGCTGAGGC, REV-GCTGAAAGAGGTACCATTGGCAC, HMOX1; FWD-CCAGGCAGAGAATGCTGAGTTC, REV-AAGACTGGGCTCTCCTTGTTGC, HSPA1A; FWD- ACCTTCGACGTGTCCATCCTGA, REV-TCCTCCACGAAGTGGTTCACCA, HSPA6; FWD-GCTGAGCAAGATGAAGGAGACG, REV-GATGATCCGCAACACGTTGAGC. Expression data were normalized to the geometric mean of housekeeping gene GAPDH to control the variability in expression levels and were analyzed using the 2-ΔΔCT method.

Data Collection and Statistical Analysis

Results for all experiments were expressed as mean ± Standard Error of the Mean. Experiments were conducted in duplicate or triplicate. For all other parameters, statistical significance was determined using an independent two-tailed Student t test and one-way ANOVA for independent data. p < 0.05 was considered as significant for all statistical analyses. All statistical analysis was done using GraphPad Prism software (La Jolla, CA).

Acknowledgments

We gratefully acknowledge the support by the National Institutes of Health (NIH). We thank the National Cancer Institute (NCI) and the National Institute for General Medical Sciences (NIGMS) for Grants 1SC1CA182844 and 2SC1GM127278-05A1 (M.C.). K.H. was supported by NIH/NCI Grants U54CA132378/U54 CA137788 and NIH/RCMI Grant 5G12MD007603, and S.P. was supported by NIH Grant EB022558. The genomics and Bioinformatics Core at the University of Hawaii Cancer Center (supported by P30 P30CA071789) assisted with the microarray analysis. The Laboratory of Comparative Pathology from Memorial Sloan Kettering Cancer Center (supported by Grant MSKCC NCI Cancer Center Support Grant P30 CA008748) is gratefully acknowledged. We especially want to thank Dr. Adam O. Michel from this laboratory. We thank Dr. Jacob Fernández-Gallardo and Dr. Natalia Curado for the preparation of the gold–titanium compounds used in this work. We thank Dr. Virginia del Solar for her help in producing updated figures for the final accepted version of the manuscript.

Supporting Information Available

. (PDF). The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsptsci.9b00107.

  • Tables S1, S2, and S3 related to the pathology study: summary of plasma metabolic analytes, summary of hematology values, and summary of histopathological findings (PDF)

Author Present Address

∫ Swayam Prabha: Cancer Research & Molecular Biology and Department of Pharmacology, Lewis Katz School of Medicine, Temple University, Philadelphia, PA 19140, USA

Author Contributions

B.T.E. designed and executed the intervention trial and mechanism of action, and participated in the production of some tables and figures. B.L. executed the pharmacokinetic experiments and contributed to writing the pharmacokinetic section of the manuscript. S.P. oversaw the execution of both the pharmacokinetic study and writing of the report of the pharmacokinetic study. M.C. and K.H.P. contributed to the design of the intervention trial and the interpretation of the results. W.S.K. and J.W.R. contributed to the design of the RNA microarray analysis, and qRT-PCR assays, and cowrote parts of the manuscript. M.C. performed the overall supervision of the research and writing of the manuscript.

The authors declare no competing financial interest.

Supplementary Material

pt9b00107_si_001.pdf (190.7KB, pdf)

References

  1. Cancer.Net.https://www.cancer.net/cancer-types/kidney-cancer/statistics (accessed November 1, 2019).
  2. Siegel R. L.; Miller K. D.; Jemal A. (2017) Cancer statistics 2017. CA Cancer J. Clin. 67, 7–30. 10.3322/caac.21387. [DOI] [PubMed] [Google Scholar]
  3. Creighton C. J.; Morgan M.; Gunaratne P. H.; et al. (2013) Cancer Genome Atlas Research Network Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature 499, 43–49. 10.1038/nature12222. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Margulis V.; Tamboli P.; Matin S. F. (2007) Redefining pT3 renal cell carcinoma in the modern era: a proposal for a revision of the current TNM primary tumor classification system. Cancer 109, 2439–2444. 10.1002/cncr.22713. [DOI] [PubMed] [Google Scholar]
  5. Grimm M. O.; Wolff I.; Zastrow S.; et al. (2010) Advances in renal cell carcinoma treatment. Ther. Adv. Urol. 2, 11–17. 10.1177/1756287210364959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Stadler W. M.; Halabi S.; Rini B.; Ernstoff M. S.; Davila E.; Picus J.; Barrier R.; Small E. J. (2006) A phase II study of gemcitabine and capecitabine in metastatic renal cancer. Cancer 107, 1273–1279. 10.1002/cncr.22117. [DOI] [PubMed] [Google Scholar]
  7. Fisher R. I.; Rosenberg S. A.; Fyfe G. (2000) Long-term survival update for high-dose recombinant interleukin-2 in patients with renal cell carcinoma. Cancer J. Sci. Am. 6 (Suppl 1), S55–57. [PubMed] [Google Scholar]
  8. Dutcher J. P. (2002) Current Status of Interleukin-2 Therapy for Metastatic Renal Cell Carcinoma and Metastatic Melanoma. Oncology 16 (Suppl 13), 11. [PubMed] [Google Scholar]
  9. Thomas J. S.; Kabbinavar F. (2015) Metastatic clear cell renal cell carcinoma: A review of current therapies and novel immunotherapies. Crit. Rev. Oncol. Hematol. 96, 527–533. 10.1016/j.critrevonc.2015.07.009. [DOI] [PubMed] [Google Scholar]
  10. Ghatalia P.; Zibelman M.; Geynisman D. M.; Plimack E. R. (2017) Checkpoint inhibitors for the treatment of renal cell carcinoma. Curr. Treat. Options in Oncol. 18, 7. 10.1007/s11864-017-0458-0. [DOI] [PubMed] [Google Scholar]
  11. Cheff D. M.; Hall M. D. (2017) A drug of such damned nature. Challenges and opportunities in translational platinum research. J. Med. Chem. 60, 4517–4532. 10.1021/acs.jmedchem.6b01351. [DOI] [PubMed] [Google Scholar]
  12. Casini A., Vessières A., and Meier-Menches S. M. (Eds.) (2019) in Metal-based Anticancer Agents, Book Series Metallobiology, Royal Society of Chemistry, 10.1039/9781788016452. [DOI] [Google Scholar]
  13. Browning R. J.; Reardon P. J. T.; Parhizkar M.; et al. (2017) Drug delivery strategies for platinum-based chemotherapy. ACS Nano 11, 8560–8578. 10.1021/acsnano.7b04092. [DOI] [PubMed] [Google Scholar]
  14. Monro S.; Colon K. L.; Yin H.; Roque J.; Konda P.; Gujar S.; Thummel R. P.; Lilge L.; Cameron C. G.; McFarland S. A. (2019) Transition Metal Complexes and Photodynamic Therapy from a Tumor-Centered Approach: Challenges, Opportunities, and Highlights from the Development of TLD1433. Chem. Rev. 119, 797–828. 10.1021/acs.chemrev.8b00211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. PKCi & mTOR Inhibition With Auranofin+Sirolimus for Squamous Cell Lung Cancer. https://clinicaltrials.gov/ct2/show/NCT01737502 (accessed November 1, 2019).
  16. ‘Auranofin and sirolimus in Treating Participants With Cancer’. https://clinicaltrials.gov/ct2/show/NCT03456700 (accessed November 1, 2019).
  17. Curado N., and Contel M. (2019) Heterometallic Compounds as Anticancer Agents, Chapter 6, in Metal Based Anticancer Agents (Casini A., Vessieres A., and Meier-Menches S. M., Ed.) Metalobiology Series, Royal Society of Chemistry, 10.1039/9781788016452-00143. [DOI] [Google Scholar]
  18. González-Pantoja J. F.; Stern M.; Jarzecki A. A.; et al. (2011) Titanocene-Phosphine Derivatives as Precursors to Cytotoxic Heterometallic TiAu 2 and TiM (M = Pd, Pt) Compounds. Studies of Their Interactions with DNA. Inorg. Chem. 50, 11099–11110. 10.1021/ic201647h. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Massai L.; Fernández-Gallardo J.; Guerri A.; et al. (2015) Design, Synthesis and Characterisation of New Chimeric Ruthenium(II)-gold(I) Complexes as Improved Cytotoxic Agents. Dalton Trans. 44, 11067–11076. 10.1039/C5DT01614B. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fernández-Gallardo J.; Elie B. T.; Sulzmaier F. J.; et al. (2014) Organometallic Titanocene-Gold Compounds as Potential Chemotherapeutics in Renal Cancer. Study of Their Protein Kinase Inhibitory Properties. Organometallics 33, 6669–6681. 10.1021/om500965k. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. a Fernández-Gallardo J.; Elie B. T.; Sadhukha T.; et al. (2015) Heterometallic Titanium-gold Complexes Inhibit Renal Cancer Cells in Vitro and in Vivo. Chem. Sci. 6, 5269–5283. 10.1039/C5SC01753J. [DOI] [PMC free article] [PubMed] [Google Scholar]; b Contel M., Fernández-Gallardo J., Elie B. T., and Ramos J. W. (2016) US Patent 9,315,531, (04/19/2016).
  22. Elie B. T.; Fernández-Gallardo J.; Curado N.; et al. (2019) Bimetallic titanocene-gold phosphane complexes inhibit invasion, metastasis, and angiogenesis-associated signaling molecules in renal cancer. Eur. J. Med. Chem. 161, 310–322. 10.1016/j.ejmech.2018.10.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mui Y. F.; Fernández-Gallardo J.; Elie B. T.; et al. (2016) Titanocene-Gold Complexes Containing N-Heterocyclic Carbene Ligands Inhibit Growth of Prostate, Renal, and Colon Cancers in Vitro. Organometallics 35, 1218–1227. 10.1021/acs.organomet.6b00051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Curado N.; Gimenez N.; Miachin K.; et al. (2019) Preparation of Titanocene-Gold Compounds Based on Highly Active Gold(I)-N-Heterocyclic Carbene Anticancer Agents: Preliminary in vitro Studies in Renal and Prostate Cancer Cell Lines. ChemMedChem 14, 1086–1095. 10.1002/cmdc.201800796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Fernández-Gallardo J.; Elie B. T.; Sanaú M.; et al. (2016) Versatile Synthesis of Cationic N-Heterocyclic Carbene-gold(I) Complexes Containing a Second Ancillary Ligand. Design of Heterobimetallic Ruthenium-gold Anticancer Agents. Chem. Commun. 52, 3155–3158. 10.1039/C5CC09718E. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Elie B. T.; Pechenyy Y.; Uddin F.; Contel M. (2018) A heterometallic ruthenium-gold complex displays antiproliferative, antimigratory and antiangiogenic properties and inhibits metastasis and angiogenesis-associated proteases in renal cancer. JBIC, J. Biol. Inorg. Chem. 23, 399–411. 10.1007/s00775-018-1546-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Elie B. T.; Hubbard K.; Pechenyy Y.; et al. (2019) Preclinical evaluation of an unconventional ruthenium-gold-based chemotherapeutic: RANCE-1, in clear cell renal cell carcinoma. Cancer Med. 4304–4314. 10.1002/cam4.2322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Yang M.; Chitambar C. R. (2008) Role of Oxidative Stress in the Induction of Metallothionein-2A and Heme Oxygenase-1 Gene Expression by the Antineoplastic Agent Gallium Nitrate in Human Lymphoma Cells. Free Radical Biol. Med. 45 (6), 763–772. 10.1016/j.freeradbiomed.2008.05.031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Loboda A.; Damulewicz M.; Pyza E.; et al. (2016) Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cell. Mol. Life Sci. 73, 3221–32. 10.1007/s00018-016-2223-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zou Z.; Chang H.; Li H.; et al. (2017) Induction of reactive oxygen species: an emerging approach for cancer therapy. Apoptosis 22, 1321–1335. 10.1007/s10495-017-1424-9. [DOI] [PubMed] [Google Scholar]
  31. Bock K. I. (2004) Antioxidants and Cancer Therapy: Furthering the Debate. Integr. Cancer Ther. 3, 342–348. 10.1177/1534735404272152. [DOI] [PubMed] [Google Scholar]
  32. Wei L.-H.; Kuo M.-L.; Chen C.-A.; et al. (2003) Interleukin-6 promotes cervical tumor growth by VEGF-dependent angiogenesis via a STAT3 pathway. Oncogene 22, 1517–1527. 10.1038/sj.onc.1206226. [DOI] [PubMed] [Google Scholar]
  33. Fichtner I.; Behrens D.; Claffey J.; et al. (2011) The antiangiogenic and antitumoral activity of Titanocene Y* In vivo. Lett. Drug Design & Discovery. 8, 302–307. 10.2174/157018011794839367. [DOI] [Google Scholar]
  34. Fichtner I.; Claffey J.; Deally A.; Gleeson B.; Hogan M.; Markelova M. R.; Muller-Bunz H.; Weber H.; Tacke M. (2010) Antitumor activity of Vanadocene Y and its selenocyanate derivative in xenografted CAKI-1 tumors in mice. J. Organomet. Chem. 695, 1175–1181. 10.1016/j.jorganchem.2010.01.026. [DOI] [Google Scholar]
  35. Walther W.; Fichtner I.; Deally A.; Hogan M.; Tacke M. (2013) The activity of Titanocene T against xenografted Caki-1 tumors. Lett. Drug Design & Discovery. 10, 375–381. 10.2174/1570180811310050002. [DOI] [Google Scholar]
  36. Walther W.; Dada O.; O’Beirne C.; Ott I.; Sanchez-Sanz G.; Schmidt C.; Werner C.; Zhu X.; Tacke M. (2016) In vitro and in vivo investigations into the carbene gold chloride and thioglucoside anticancer drug candidates NHC-Au-Cl and NHC-AuSR. Lett. Drug Design & Discovery. 14, 125–134. 10.2174/1570180813666160826100158. [DOI] [Google Scholar]
  37. Liu J.-J.; Wang W.; Huang S.-Y.; et al. (2017) Inhibition of the Ras/Raf interaction and repression of renal cancer xenografts in vivo by an enantiomeric iridium (III) metal-based compound. Chem. Sci. 8, 4756–4763. 10.1039/C7SC00311K. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Vela L.; Contel M.; Palomera L.; et al. (2011) Iminophosphorane-organogold(III) complexes induce cell death through mitochondrial ROS production. J. Inorg. Biochem. 105, 1306–1313. and references therein. 10.1016/j.jinorgbio.2011.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hwang-Bo H.; Jeong J. W.; Han M. H.; et al. (2017) Auranofin, an inhibitor of thioredoxin reductase, induces apoptosis in hepatocellular carcinoma Hep3B cells by generation of reactive oxygen species. Gen. Physiol. Biophys. 36, 117–128. 10.4149/gpb_2016043. [DOI] [PubMed] [Google Scholar]
  40. Kim J.-H.; Reeder E.; Parkin S.; et al. (2019) Gold(I/III)-Phosphine Complexes as Potent Antiproliferative Agents. Sci. Rep. 9, 12335.and references therein. 10.1038/s41598-019-48584-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Hou G.; Liu P.; Zhang S.; et al. (2018) Elimination of stem-like cancer cell side-population by auranofin through modulation of ROS and glycolysis. Cell Death Dis. 9, 89. 10.1038/s41419-017-0159-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

pt9b00107_si_001.pdf (190.7KB, pdf)

Articles from ACS Pharmacology & Translational Science are provided here courtesy of American Chemical Society

RESOURCES