Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Oct 1.
Published in final edited form as: Glia. 2020 Mar 17;68(10):2057–2069. doi: 10.1002/glia.23826

Nurr1Cd11bcre conditional knock-out mice display inflammatory injury to nigrostriatal dopaminergic neurons

Jie Dong 1,2, Xinyao Liu 1, Yuanyuan Wang 1, Huaibin Cai 2, Weidong Le 1,3,*
PMCID: PMC7437964  NIHMSID: NIHMS1613747  PMID: 32181533

Abstract

Nuclear receptor related 1 protein (NURR1) is essential for the development and maintenance of midbrain dopaminergic (DAergic) neurons. NURR1 also protects DAergic neurons against neuroinflammation. However, it remains to be determined to what extent does NURR1 exerts its protective function through acting autonomously in the microglia. Using Cre/lox gene targeting system, we deleted Nurr1 in the microglia of Nurr1Cd11bcre conditional knockout (cKO) mice. The Nurr1Cd11bcre cKO mice displayed age-dependent motor abnormalities and increased microglial activation, but with no obvious DAergic neurodegeneration. To boost the inflammatory injury, we systemically administered endotoxin lipopolysaccharide (LPS) to Nurr1Cd11bcre mice. As expected, LPS treatment exacerbated the motor phenotypes and inflammatory reactions in Nurr1Cd11bcre cKO mice. More importantly, LPS administration caused DAergic neuron loss and α-synuclein aggregation, two pathological hallmarks of Parkinson’s disease (PD). Therefore, our findings provide in vivo evidence supporting a critical protective role of NURR1 in the microglia against inflammation-induced degeneration of DAergic neurons in PD.

Keywords: Nurr1, neuroinflammation, Parkinson’s disease, microglia, neurodegeneration

Introduction

Parkinson’s disease (PD) is the most common neurodegenerative movement disorder affecting millions of elderly people worldwide (Dauer & Przedborski, 2003). Progressive loss of dopaminergic (DAergic) neurons in the substantia nigra pars compacta (SNc) and abnormal accumulation of α-synuclein-containing Lewy bodies/neurites are recognized as the two major pathological hallmarks of PD (Braak et al., 2003). Although the etiopathogenesis of PD remains elusive, both environmental factors and genetic predispositions contribute to the etiology and pathogenesis of PD (Le, Chen, & Jankovic, 2009).

Neuroinflammation is associated with the degeneration of DAergic neurons (Block & Hong, 2007; Hirsch, Vyas, & Hunot, 2012; Nagatsu & Sawada, 2005; Sampson et al., 2016). Studies of cytokines in peripheral serum/plasma and in cerebrospinal fluid demonstrate that proinflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interferon-γ, interleukin-2 and interleukin-10, are significantly increased in PD patients (Rocha, de Miranda, & Teixeira, 2015). As the only residential immune cells in the central nervous system (CNS), microglia undergo ramified morphological change and release a variety of proinflammatory and neurotoxic molecules in response to inflammatory stimulations (Kim & Joh, 2006; Kreutzberg, 1996; Tang & Le, 2016). While it is not clear whether neuroinflammation is the initiating trigger in PD pathogenesis, direct injection of endotoxin lipopolysaccharide (LPS) in the SNc causes robust microglial activation and acute DAergic neuron loss in rodents (Liu, Du, & Hong, 2000; Tomás-Camardiel et al., 2004). In addition, systemic administration of LPS by intraperitoneal injection leads to a progressive and selective degeneration of DAergic neurons in several mouse models (Frank-Cannon et al., 2008; Gao et al., 2011; Qin et al., 2007). Moreover, following LPS administration, PD-related human α-synuclein A53T transgenic mice develop persistent neuroinflammation, resulting in degeneration of DAergic neurons and accumulation of Lewy body-like intracellular protein inclusions (Gao et al., 2011). Parkin-deficient mice, a model of PD-related Parkin recessive mutation, also show behavioral deficiency and DAergic neuron loss after prolonged LPS treatment (Qin et al., 2007). These early studies support a potential interplay between genetic and neuroinflammatory factors in the etiopathogenesis of PD (Tansey, McCoy, & Frank-Cannon, 2007; Vlajinac et al., 2013).

Nuclear receptor related 1 protein (NURR1), also known as NR4A2, is a member of orphan nuclear receptor NR4A subfamily essential for the development and maintenance of midbrain DAergic neurons (Perlmann & Wallén-Mackenzie, 2004). NURR1 expression in the DAergic neurons is reduced during normal aging (Chu, Kompoliti, Cochran, Mufson, & Kordower, 2002) and is further decreased in PD patients’ brains and peripheral blood mononuclear cell (Decressac, Volakakis, Björklund, & Perlmann, 2013; Liu et al., 2012). NURR1 regulates the expression of functional DA genes, such as dopamine (DA) synthase tyrosine hydroxylase (TH), DA transporter, aromatic amino acid carboxylase, and vesicular monoamine transporter 2 (Jankovic, Chen, & Le, 2005). In addition to DAergic neurons, NURR1 is also expressed in microglia and peripheral leukocytes and acts as a transcriptional repressor of neurotoxic factors through mediating the turnover of nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) (Saijo et al., 2009; Li et al., 2018). NURR1 has been shown to suppress LPS-induced neuroinflammation and protect against DAergic neuron loss in vitro (Saijo et al., 2009). However, it remains to determine that what extent NURR1 exert its anti-inflammatory and neuron protective function via acting on microglia and other immune cells.

Previous studies have shown that Nurr1 homozygous germline knockout (KO) mice failed to develop midbrain DAergic neurons and died shortly after birth (Castillo et al., 1998; Saucedo-Cardenas et al., 1998; Zetterström et al., 1997). On the other hand, Nurr1 heterozygous KO mice survive, but display motor impairments associated with reduced DA content in the striatum and increased susceptibility to neurotoxic insults (Jiang et al., 2005; Le, Conneely, He, Jankovic, & Appel, 1999; Le, Conneely, Zou, et al., 1999). Furthermore, Nurr1 conditional KO mice, which deleted Nurr1 selectively in DAergic neurons, recapitulate some PD-related pathological and biochemical features in the nigrostriatal pathway (Kadkhodaei et al., 2009, 2013). While these previous in vivo studies on NURR1 mainly focused on the DAergic neurons and established an essential physiological function of NURR1 in the development and survival of DAergic neurons, the role of NURR1 in microglia in vivo has not been critically evaluated. Whether a conditional deletion of Nurr1 in microglia renders DAergic neurons more susceptible to inflammatory injury remains to be determined. Toward this direction, we generated and characterized Nurr1Cd11bcre conditional KO mice in which Nurr1 was deleted in the microglia. We found that a lack of Nurr1 increased neuroinflammation and made DAergic neurons loss to LPS-induced cytotoxicity.

Materials and Methods

Animals

Cd11b-Cre [Tg(ITGAM-cre)2781Gkl] transgenic mice were generated to manipulate gene expression in the microglia as previously described (Boillée et al., 2006). Cd11b is an integrin expressed exclusively in the myeloid lineage (Wieghofer, Knobeloch, & Prinz, 2015). These mice were crossbred with floxed Nurr1 mice to generate Cre-positive, homozygous floxed Nurr1 mice, referred as Nurr1Cd11bcre mice in this study. Littermates of Cre-negative, homozygous floxed Nurr1 mice were referred as control mice. Mice were housed under standard conditions with controlled 12h light/dark cycles (lights on at 8 AM), room temperature (22 ± 1°C), and humidity (50 ± 10%), with food and water provided ad libitum. All animal care and experimental procedures were performed in compliance with the Animal Ethics Committee guidelines of the First Affiliated Hospital of Dalian Medical University.

Generation of floxed Nurr1 knock-in mice

The floxed Nurr1 knock-in mice were generated by Shanghai Model Organisms Center, Inc (Shanghai, China). The FRT-pGK-Neomycine-polyA-FRT-loxp selection cassette was inserted into intron 2 and another copy of loxp was inserted into the intron 3 of Nurr1 genomic DNA. The gene targeting vector was electroporated into a mouse embryonic stem (ES) cell line CJ7 with 129S1/SvlmJ background. After drug selection, the resistant ES clones were identified by long PCR and confirmed by sequencing. Positive ES cell clones were expanded and injected into C57BL/6J blastocysts to generate the chimeric offspring (Liu, 2003). The chimeric mice were mated with C57BL/6J mice to obtain the floxed Nurr1 heterozygous knock-in mice with the FRT-flanked Neo selection cassette. These mice were then crossbred with FLP mice to remove the FRT-flanked Neo selection cassette and generated the floxed Nurr1 heterozygous knock-in mice.

Genotyping

Cd11b-cre transgenic mice were identified by PCR screening (2×EasyTaq PCR SuperMix, Transgen Biotech) of tail DNA using an antisense primer, CAGGTATGCTCAGAAAACGCCT, and a sense primer TGGGCCAACCCAAGAAACAAGT, of which the transgene band size is 445bp. The floxed Nurr1 knock-in mice were identified using AAACAAAACAGGGCAACAGG, and GCCTGTGCTGTAGTTGTCCA. The PCR product size of wild type allele (Nurr1+/+) is 662bp and homozygous Nurr1 flox allele (Nurr1 fl/fl) is 766bp.

Primary microglia isolation

Primary microglia were isolated from the cortex of postnatal day 1–5 Nurr1Cd11bcre pups and littermate controls. After removing meninges, the brains were minced and digested with trypsin and DNase I (TransGen Biotech). Cells were re-suspended in F12 supplemented with 10% fetal calf serum and seeded in 25 cm2 flasks. After cells grew to confluence (7–10 days), the flasks were shaken at 180 rpm for 18 hrs at 37°C, and the floating cells were collected and allowed to adhere to a flask for 1 hr before gentle shaking. The cells were collected and used for further experiment.

Systemic LPS administration paradigms

Nurr1Cd11bcre mice at 10–12 months of age and their age-matched littermates were injected intraperitoneally with phosphate buffer saline (PBS) or 0.33 mg/kg LPS (E. coli, serotype 0127: B8, Sigma) twice a week for 1 month, followed by a 3-month rest with no additional intraperitoneal injections (n=5 per group). Their body weights were monitored twice a week. After 3-month rest, mice were subjected to behavioral tests and then sacrificed. The brains were isolated and processed for either biochemical or histological studies.

Behavioral tests

Accelerating rotarod test

Mice were placed on an accelerating rotarod (Life Science Inc) to measure their motor coordination and balance abilities. The speed of rotarod was increased from 5 to 45 revolutions per minute over 8 minutes. The latency to fall from the rotarod was recorded. All animals were pretrained for 5 consecutive days and tested three times and the average time was used for data analysis.

Open-field test

Mice were put in a 46×46 cm2 arena with an infrared photo beam activity monitor for 30 min to test their locomotion activity. The arena was illuminated by reflected light and the animal movements were recorded. The arena was cleaned with 75% ethanol after each test.

Y maze

Each mouse was put in the central area of the Y maze and allowed to freely explore the maze for 10 min. The arm entries and total distance travelled by each mouse was recorded by video. The total number of entered arms subtracting 2 was the effective alternative opportunity. Percentage alternation was calculated by dividing the number of trials containing entries into the three arms by the alternation opportunity*100% (Yang, Zhang, Zheng, Shen, & Chen, 2014).

Morris water maze

All animals were trained in a Morris water maze for 4 consecutive days with 3 trials per day. The training goal was to reach the submerged platform within 90s (escape latency). The water was maintained at 26°C and mice were put in a random quadrant to reduce the bias. On the fifth day, we removed the platform and measured the latency in the platform quadrant of each mouse.

Immunostaining

After anesthetizing, mice were transcardially perfused with PBS. The brains were rapidly isolated and post fixed in ice-cold 4% paraformaldehyde and subsequently dehydrated for 24 hrs in 15% and 30% sucrose at 4°C for immunostaining. Brain was sectioned coronally at 10 μm thickness using a cryostat microtome. Frozen slides were preincubated for 1 hr in blocking solution, containing 5% bovine serum albumin, 0.25% Triton X-100, and 0.01% sodium-azide in PBS. Primary antibodies were diluted in blocking solution and incubated overnight at 4°C. After rinsing with PBS, slides were incubated with fluorophore-conjugated secondary antibodies for 1 hr at room temperature and then with Hoechst 33342 (Sigma Aldrich) for 1 minute. Slides were visualized with an Olympus light/fluorescence microscopy. Primary antibodies were as follows: mouse anti-NURR1 (1:1000; R&D systems), rabbit anti-TH (1:1000; Millipore), mouse anti-TH (1:2000; Sigma Aldrich), rabbit anti-IBA1 (1:1000; Wako), rabbit anti-phospho-NFκB-p65 (1:1000; Cell Signaling Technology), rabbit anti-GFAP (1:1000; Sigma Aldrich), rabbit anti-α-synuclein (phospho S129) (1:1000; Abcam). Microglial and astrocytes immunostaining was evaluated in slices within SNc and substantial nigra pas reticulate (SNr) at the same coordinates (at least three non-overlapping areas in each slice). TH-positive cells in SNc were counted in every fifth sections covering the AP-2.7 to AP-4.0 mm at a magnification of 100 by an observer who was blind to animal genotype and treatment. The outline of SNc was delimited according to anatomical landmarks (Baquet, Williams, Brody, & Smeyne, 2009).

Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)

RNA isolation, cDNA synthesis and quantitative real-time polymerase chain reaction were performed according to protocols described previously (Tang et al., 2014). After perfused with ice-cold PBS, the brain was dissected and frozen at −80°C for biochemical detection. Total RNA was extracted with RNAiso Plus (Total RNA extraction reagent; Takara). Real-time PCR (TransStart Top Green qPCR SuperMix; TransGen Biotech) was performed by Applied Biosystems 7500 Real-time PCR Systems. The primer sequences were synthesized by Invitrogen (Table 1).

Table 1.

Primer sequences for quantitative polymerase chain reaction (qPCR).

　 Forward (5’ to 3’) Reverse (5’ to 3’ )
Gapdh TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG
Nurr1 ACGGGCTGGATTCCCAATAG AGGCATGGCTTCAGCAGAGT
Nur77 TGATGTTCCCGCCTTTGC CAATGCGATTCTGCAGCTCTT
Nor1 GAGGTCGTCTGCCTTCCAAA TGGTTCAAAAGCATTCATAGAACT
Tnf-α GACCCCTTTACTCTGACCCC AGGCTCCAGTGAATTCGGAA
IL-1β AAGGGGACATTAGGCAGCAC ATGAAAGACCTCAGTGCGGG
Arg-1 CTTGCGAGACGTAGACCCTG TCCATCACCTTGCCAATCCC
Tgf-β CACTCCCGTGGCTTCTAGTG CTTCGATGCGCTTCCGTTTC
Open in a new tab

Measurement of striatal DA concentration

Brains were rapidly removed, and right striatum were collected using a tissue punch, weighed and kept at −80°C for high-performance liquid chromatography, which was performed as described in detail previously (Xiao, Yang, & Le, 2015).

Experimental design and statistical analysis

The experimental design is provided in Results section for each experiment. Statistical analyses were performed with GraphPad Prism 8 (GraphPad Software Inc., California, USA). All data were reported as the mean ± standard error of mean. Student’s t test was used to compare two groups. Two-way ANOVA with Tukey’s multiple comparisons test was performed for multiple comparisons. Value p < 0.05 was considered as differences. * p < 0.05, ** p < 0.01, *** p < 0.001, **** P < 0.0001. Image J software (https://imagej.nih.gov/ij) was used for quantification of images.

Results

Conditional deletion of Nurr1 in the microglia of Nurr1Cd11bcre mice

To investigate the in vivo function of Nurr1 in microglia, we generated Nurr1Cd11bcre by crossbreeding floxed Nurr1 knock-in (Nurr1fl/fl) mice with Cd11bcre/wt mice (The targeting vector structure of Nurr1fl/fl mice was shown as Fig. 1A). We isolated primary microglia from the cortex of newborn pups to confirm the specific deletion of Nurr1 in microglia by qRT-PCR. As expected, no Nurr1 transcripts were detected in the cultured primary microglia isolated from the Nurr1Cd11bcre pups (Fig. 1B). In addition, a lack of Nurr1 did not alter the expression of other NR4A subfamily members, Nur77 and Nor1, in the microglia (Fig. 1B). It is noteworthy that the microglia transcriptome and morphology can be altered under the culture conditions (Bohlen et al., 2017; L. Lin, R. Desai, X. Wang, E. H. Lo, & C. Xing, 2017). Since the expression of Nurr1 was easily detected in the control Nurr1fl/fl microglia cultures under the same condition, the loss of Nurr1 expression in the cultured Nurr1Cd11bcre microglia cannot be attributed to the experimental manipulations.

Figure 1. Construction and conditional Nurr1 deletion in Nurr1Cd11bcre mice.

Figure 1

Open in a new tab

(A) The strategy to insert loxp into the intron 2 and 3 in Nurr1 genomic DNA. The number shows the exons of Nurr1. (B) qRT-PCR analysis of Nurr1, Nur77 and Nor1 mRNA in primary microglia in Nurr1Cd11bcre mice and control (n=3 per each group). Unpaired t test: Nurr1, p=0.0015; Nur77, p=0.8033; Nor1, p=0.75.

Nurr1Cd11bcre mice display an abnormal locomotor activity and progressive impairments of motor coordination and balance abilities

We conducted series of behavioral tests to assess motor and cognitive performance in three different age groups of Nurr1Cd11bcre and control mice. We assigned the 6- to 10-month-old mice as the young adult mice, the 11- to 15-month-old ones as the adult mice, and the 16- to 20-month-old ones as the aged mice. Our data indicated that Nurr1Cd11bcre mice travelled a longer distance than control mice in all age groups in Open-field tests (Fig. 2A). Noticeably, the abnormal locomotor activity of Nurr1Cd11bcre mice was more profound in the young adult mice compared to the adult and aged groups (Fig. 2A). On the other hand, the performance of mice in rotarod tests was comparable between Nurr1Cd11bcre and control mice in both young adult age and adult age groups (Fig. 2B). However, there was a reduction by 28% of the time on the rotarod in aged Nurr1Cd11bcre mice when comparing with their age-matched control littermates (Fig. 2B).

Figure 2. Behavioral performance in Nurr1Cd11bcre mice.

Figure 2

Open in a new tab

(A) Locomotor test of 6–10 month-old, 11–15 month-old and 16–20 month-old Nurr1Cd11bcre mice and their littermate control (n=10–12). Nurr1Cd11bcre mice perform a significant increased ambulatory distance than control. Two-way AVOVA: age, F (2, 60)=12.85, p<0.0001; genotype, F (1, 60)=68.7, p<0.0001; interaction: p=0.0002. Tukey’s multiple comparison test: 6–10 months Ctrl versus 6–10 months Nurr1Cd11bcre, p<0.0001; 11–15 months Ctrl versus 11–15 months Nurr1Cd11bcre, p=0.0251; 16–20 months Ctrl versus 16–20 months Nurr1Cd11bcre, p=0.0708. (B) Accelerating rotarod performance of 6–10 month-old, 11–15 month-old and 16–20 month-old Nurr1Cd11bcre mice and their littermate control (n=10–12). Two-way AVOVA: age, F (2, 60)=3.591, p=0.0337; genotype, F (1, 60)=4.9, p=0.0307.

Nurr1Cd11bcre mice show an increased microglial activation in the midbrain regions

A previous in vitro study demonstrates that a reduction of Nurr1 expression in microglia exaggerates neuroinflammation, resulting in death of DAergic neurons (Saijo et al., 2009). To investigate the anti-inflammatory and neuro-protective effects of Nurr1 in the microglia in vivo, we examined the activation of microglia and survival of DAergic neurons in the midbrain of aged Nurr1Cd11bcre and control mice. We observed a 19% increase of the number of ionized calcium binding adaptor molecule 1 (IBA1)-positive microglia in the Nurr1Cd11bcre mice (Fig. 3A, B). Consistently, a reduction of Nurr1 expression in the microglia also resulted in increased levels of proinflammatory cytokines Tnf-α and Il-1β in the midbrain regions (Fig. 3C). Meanwhile, we also quantified the expression of anti-inflammatory genes including arginase-1 (Arg-1) and transforming growth factor-β (Tgf-β) in the midbrain, showing that Tgf-β was markedly reduced in the aged Nurr1Cd11bcre mice (Fig. 3C). On the other hand, the number of DAergic neurons in the SNc of Nurr1Cd11bcre mice only showed a modest reduction, which is not statistically significant (Fig. 3A, D). Similarly, we did not find any substantial reduction of DA content in the striatum of Nurr1Cd11bcre mice (Fig. 3E). Taken together, these data suggest that while genetic deletion of Nurr1 in the microglia and other Cre-expressing leukocytes enhances neuroinflammation, but it is not sufficient to induce substantial degeneration of DAergic neurons in vivo.

Figure 3. Nigro-striatal neuropathology and neuroinflammation in the Nurr1Cd11bcre mice.

Figure 3

Open in a new tab

(A) Double-label immunofluorescence of IBA-1 (green) and TH (red) in left SN in Nurr1Cd11bcre mice and control mice of 16 months of old. Microglia in Nurr1Cd11bcre mice showed an active morphology with lager size and increased number. Scale bar = 200μm. (B) Number of IBA-1 positive cells in SNc and SNr of 16-month old Nurr1Cd11bcre mice and control mice (n=3 per each group). Unpaired t test: p=0.0423. (C) qRT-PCR analysis of inflammation related factors mRNA in the midbrain of Nurr1Cd11bcre mice (n=6) and their aged-matched control mice (n=5). Unpaired t test: Il-1β, p=0.0029; Tnf-α, p=0.0223; Arg-1, p=0.1387; Tgf-β, p=0.0411. (D) Number of TH positive neurons in SNc of 16-month old mice. Unpaired t test: p=0.3779. (E) DA levels in the Nurr1Cd11bcre mice and control of 16-months old (n=3 per each group). Unpaired t test: p=0.4224.

Chronic LPS exposure induces motor dysfunction in adult Nurr1Cd11bcre mice

Since environmental toxins are implicated in the etiopathogenesis of PD and LPS exposure triggers neuroinflammation (Goldman, 2014; Qin et al., 2007), we treated 10- to 12-month-old Nurr1Cd11bcre or age-matched control mice with intraperitoneal injection of LPS at 0.33mg/kg body weight or vehicle phosphate-buffered saline (PBS) twice a week for one month. We examined behavioral and pathological abnormalities for three months after LPS treatment. The administration of LPS substantially compromised the performance of Nurr1Cd11bcre mice in rotarod tests compared to the control mice (Fig. 4A). As controls, the injection of PBS did not affect the rotarod performance of Nurr1Cd11bcre mice (Fig. 4A). Additional LPS treatment induced hyperactivity of Nurr1Cd11bcre mice in the Open-field tests (Fig. 4B). On the other hand, LPS treatment did not affect the cognitive performance of Nurr1Cd11bcre mice in Y maze and Morris water maze tests (Fig. 4C–E). These results indicate that chronic LPS exposure specifically induces motor dysfunction in Nurr1Cd11bcre mice.

Figure 4. Behavioral alternations of Nurr1Cd11bcre mice after LPS exposure.

Figure 4

Open in a new tab

(A) Accelerating rotarod performance of each group after 12 weeks. After LPS treatment, Nurr1Cd11bcre mice (n=5) showed a significant decrease of time on the rotarod when compared to controls (n=5). Two-way ANOVA: treatment, F (1,16)=6.049, p=0.0257; genotype, F (1,16)=7.725, p=0.0134. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0305; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0473. (B) Travelled distance of Nurr1Cd11bcre mice and aged-matched control mice in locomotor test after LPS administration. Two-way ANOVA: treatment, F (1,16)=1.363, p=0.2601; genotype, F (1,16)=18.61, p=0.005. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0081. (C) Alteration rate of Nurr1Cd11bcre mice and aged-matched control mice in Y maze test after LPS or PBS administration. Two-way ANOVA: treatment, F (1,16) =0.0054, p=0.9423; genotype, F (1,16)=2.638, p=0.1238. (D) The escape latency of the first 4 days in Water Morris test of Nurr1Cd11bcre and control mice after LPS or PBS administration. (E) Comparison of the swimming time in platform quadrant of each group mice on the fifth day in Morris water maze test. Two-way ANOVA: treatment, F (1,16) =3.045, p=0.1001; genotype, F (1,16)=0.0686, p=0.7968.

Chronic LPS exposure exacerbates neuroinflammation in Nurr1Cd11bcre mice

After behavioral tests, we examined the cytotoxic effects of LPS exposure in the midbrain of Nurr1Cd11bcre mice. We observed an increased microglial activation, manifested with enlarged cell bodies, retracted processes and increased cell numbers in the midbrain of LPS-treated Nurr1Cd11bcre mice compared to those LPS-treated control animals or PBS-treated Nurr1Cd11bcre mice (Fig. 5A–C). Moreover, the transcription of IL-1β was nearly doubled in the LPS-treated Nurr1Cd11bcre mice when compared with PBS-injected Nurr1Cd11bcre mice or LPS-injected control littermates (Fig. 5D). In summary, all these data demonstrate that repeated LPS exposure induces microglial activation and exacerbates neuroinflammation in the midbrain of Nurr1Cd11bcre mice.

Figure 5. Inflammation exaggerated in Nurr1Cd11bcre mice after LPS exposure.

Figure 5

Open in a new tab

(A) Double-label immunofluorescence of IBA-1 (green), TH (red) and Hoechst (blue) in SN showed significant increased of activated microglia in Nurr1Cd11bcre mice after LPS injection. Microglia of control mice with PBS exhibited resting ramified morphology (as arrows showed). Square boxes are the magnificence of microglia that arrows point to. Scale bar = 100μm. (B) There was a significant increase of the number of IBA-1 positive cells in SNc and SNr of Nurr1Cd11bcre mice with LPS injection when compared to the control mice with the same administration (n=3 per each group). Two-way ANOVA: treatment, F(1,8)=15.7, p=0.0042; genotype, F(1,8)=15.31, p=0.0045. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0262; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.025. (C) Fractal dimensions of microglia in each group (n=3 per each group). Two-way ANOVA: treatment, F(1,8)=8.249, p=0.0208; genotype, F(1,8)=8.474, p=0.0196. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0229; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0238. (D) qRT-PCR analysis of Il-1β mRNA in the midbrain of these mice with or without LPS treatment (n=4–5 per each group). Two-way ANOVA: treatment, F(1,15)=7.259, p=0.0167; genotype, F(1,15)=15.41, p=0.0014. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0002; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0010. (E) Double label immunostaining of TH (red) and GFAP (green) in SN of each phenotype mice after LPS or PBS administration. Astrocytes became hypertrophic in mice after LPS stimulation, especially in Nurr1Cd11bcre mice. (F) Comparison of relative fluorescence intensity of GFAP in SNc and SNr of each group (n=3 per each group). Two-way ANOVA: treatment, F(1,8)=63.12, p<0.0001; genotype, F(1,8)=12.26, p=0.0081. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0223; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0006; Ctrl-PBS versus Ctrl-LPS, p=0.011.

Astrocytes are hypertrophic in the midbrain of Nurr1Cd11bcre mice after chronic LPS exposure

Under the hypothesis that astrocytes activation can be induced and modulated by a range of molecules instructions, such as transmitters, microRNAs, cytokines, steroid hormones, serum proteins and β-amyloid, a neurodegeneration associated molecule (Liddelow et al., 2017; Sofroniew, 2014), we further examined the astrocyte marker glial fibrillary acidic protein (GFAP) in the midbrain of LPS or PBS-treated Nurr1Cd11bcre and control mice. We found a substantial increase of GFAP staining intensity particularly in the SNr and SNc regions of Nurr1Cd11bcre mice compared to the control animals (Fig. 5E, F). These data suggest that the deletion of Nurr1 in microglia and peripheral leukocytes enhances LPS-induced astrocyte activation in the Nurr1Cd11bcre mice.

Chronic LPS exposure induces DAergic neuron degeneration in the SNc of Nurr1Cd11bcre mice

We next counted the TH-positive DAergic neurons in the SNc of Nurr1Cd11bcre or control mice treated with LPS or PBS. We found that LPS treatment led to a substantial loss of DAergic neurons in the SNc of Nurr1Cd11bcre mice compared to the LPS-treated control or PBS-treated Nurr1Cd11bcre mice (Fig. 6A, B). In additon, LPS exposure also led to a reduction of DA content in the striatum of Nurr1Cd11bcre mice (Fig. 6C). Together, these results suggest that a lack of Nurr1 in microglia and peripheral leukocytes potentiates LPS-induced inflammatory insults to the nigrostroatal DAergic neurons.

Figure 6. Nurr1Cd11bcre mice were more sensitive to LPS mediated neurotoxicity.

Figure 6

Open in a new tab

(A) Representative brain images with TH immunostaining after LPS injection indicated that prominent DA lesions of SN in Nurr1Cd11bcre mice after LPS stimulation. Scale bar is 200μm. (B) Quantification of TH positive neurons in SNc. A decline of TH positive neurons was detected in Nurr1Cd11bcre mice after LPS treatment when compared to their littermates control mice (n=3 per each group). Two-way ANOVA: treatment, F(1,8)=15.4, p=0.0044; genotype, F(1,8)=10.75, p=0.0112. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.0446; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0237. (C) HPLC analysis of DA level in striatum in mice after LPS or PBS injection (n=5 per each group). Two-way ANOVA: treatment, F(1,16)=5.802, p=00284; genotype, F(1,16)=3.5, p=0.0798. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p=0.1756; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p=0.0904.

NFκB-mediated inflammatory signaling is potentiated in the midbrain of LPS-treated Nurr1Cd11bcre mice

Nurr1 exerts an anti-inflammatory function by docking to the phosphorylated NFκB-p65 (p-NFκB-p65) and then recruiting the CoREST protein complex to inhibit the NFκB-mediated inflammatory pathways (Saijo et al., 2009). We therefore examined the p-NFκB-p65 level in the ventral midbrain of Nurr1Cd11bcre mice after LPS stimulation. Immunostaining showed that the level of p-NFκB-p65 was substantially increased in the LPS-treated Nurr1Cd11bcre mice compared to the LPS-treated control or PBS-treated Nurr1Cd11bcre mice (Fig. 7A, B). These data demonstrate that the deletion of Nurr1 in microglia and other Cre-expressing leukocytes potentiates the activation of NFκB, supporting the notion that NURR1 provides feedback regulation of NFκB signaling against neuroinflammation.

Figure 7. LPS exposure activated NFκB pathway in Nurr1Cd11bcre mice.

Figure 7

Open in a new tab

(A) Double label immunostaining of TH (red) and phospho NFκB p65 (green) in SN of the mice after LPS or PBS administration. Numerous phospho NFκB were found in SN only in LPS-injected Nurr1Cd11bcre mice. Scale bar = 100μm. (B) Relative fluorescence intensity of phospho NFκB p65 in SNc and SNr of each group (n=3 per each group). Two-way ANOVA: treatment, F(1,8)=120.4, p<0.0001; genotype, F(1,8)=104.2, p<0.0001. Tukey’s multiple comparison test: Ctrl-LPS versus Nurr1Cd11bcre-LPS, p<0.0001; Nurr1Cd11bcre-PBS versus Nurr1Cd11bcre-LPS, p<0.0001.

Chronic LPS exposure induces formation of cytoplasmic α-synuclein inclusions in the DAergic neurons of Nurr1Cd11bcre mice

Cytoplasmic inclusion containing abnormal accumulation of α-synuclein are one of main pathological hallmarks of PD (Chu & Kordower, 2007). Previous studies demonstrate that LPS treatment induces aggregation of phosphorylated α-synuclein (pS129) in DAergic neurons of PD-related α-synuclein A53T transgenic mice (Gao et al., 2011). Here we also observed a substantial increase of α-synuclein pS129 in the cytosol of DAergic neurons in SNc of LPS-treated Nurr1Cd11bcre mice compared to the LPS-injected control mice or PBS-treated Nurr1Cd11bcre mice (Fig. 8). These results suggest that a lack of Nurr1 in microglia and other Cre-expressing leukocytes renders DAergic neurons more conducive to LPS-induced α-synuclein aggregation.

Figure 8. Formation of cytoplasmic α-synuclein inclusions in Nurr1Cd11bcre mice after LPS stimulation.

Figure 8

Open in a new tab

Double label immunostaining of phosphorylated α-synuclein (pS129) (green) and TH (red) in the SNc area of the mice after PBS or LPS treatment. Aggregation of phosphorylated α-synuclein (pS129) was found in the cytoplasm of TH positive neurons in SNc area of LPS-injected Nurr1Cd11bcre mice. Scale bar = 25μm.

Discussion

The present study examined the protective function of Nurr1 in microglia and peripheral leukocytes against neuroinflammation and associated nigrostriatal DAergic neuron loss. We chose Cd11b-Cre mice to selectively delete Nurr1 in the microglia and other immune cells by crossbreeding with floxed Nurr1 knock-in mice. Cd11b-Cre [Tg(ITGAM-cre)2781Gkl] transgenic mice have been used successfully to manipulate gene expression in the microglia for studying the impact of neuroinflammation on neurodegenerative diseases (Boillée et al., 2006). Under the control of human CD11b promoter, Cre DNA recombinase is also expressed by peripheral macrophage (Boillée et al., 2006). It has been reported that Nurr1 expresses not only in DAergic neurons and several other phenotypic neurons (Ahn et al., 2018; Castillo et al., 1998; Saucedo-Cardenas et al., 1998; Zetterström et al., 1997; Moon et al., 2019), but also in glia and peripheral leukocytes (Saijo et al., 2009; Li et al., 2018; Jakaria et al., 2019). Therefore, we produced a line of Nurr1 cKO mice that deleted Nurr1 in the microglia and other Cre-expressing peripheral leukocytes by crossbreeding floxed Nurr1 knock-in mice with Cd11b-Cre mice. Most of our work was focused on investigating the link between the microglia-induced neuroinflammation and DAergic neurodegeneration in the brain of Nurr1Cd11bcre mice. Since Cre DNA recombinase is also expressed by macrophages and other leukocytes (Boillée et al., 2006), we cannot exclude the possibility that Nurr1 deletion in peripheral Cre-expressing leukocytes is also involved in the degeneration of DAergic neurons. Interestingly, our previous work demonstrate that Nurr1 expression is decreased in the peripheral monocytes of PD patients, in which the reduction of Nurr1 expression is correlated with the increase of inflammatory cytokines expression, which supports the notion that the reduction of Nurr1 in the peripheral immune cells, such as monocytes, might also play a role in the PD-related degeneration of DAergic neurons (Le et al., 2008; Li et al., 2018). Future experiments will be required to specifically examine the contribution of Nurr1 in either microglia or peripheral immune cells against PD-related neuropathological abnormalities.

In the present study, we found an increased microglia activation and abnormal motor behavior phenotypes in Nurr1Cd11bcre mice. However, these mice did not develop any apparent degeneration of DAergic neurons. By contrast, systemic application of low-dose LPS not only exacerbated neuroinflammation and motor phenotypes, but also caused significant nigrostriatal DAergic neuron loss. Therefore, we provide in vivo evidence to demonstrate that genetic deletion of Nurr1 in microglia exacerbates the environmental toxin-induced inflammatory injury to nigrostriatal DAergic neurons. Our findings thereby establish a critical physiological function of NURR1 in protecting nigrostriatal DAergic neurons against environmental insults, and further support NURR1 as an important molecular target to improve the current treatment of PD.

The Nurr1Cd11bcre mice displayed an abnormal locomotor activity and age-dependent impairment of motor coordination and balance. However, the underlying cell-type and neural circuit mechanism of the motor behavioral abnormalities remain to be determined. While PD is clinically manifested with slowness of movement. However, many mouse models with either toxin-induced lesion of nigrostriatal DAergic neurons or PD-related genetic mutations show hyperactivity in the Open-field tests (Sgobio et al., 2014; Unger et al., 2006). The hyperactivity is likely due to the over-compensation of the impaired DA transmission (Unger et al., 2006), although the detailed circuit mechanisms are not known. Besides Open-field test, rotarod test is another commonly used experimental procedure to evaluate the motor coordination, balance and leaning in PD-related rodent models (Karl, Pabst, & von Hörsten, 2003). Impaired rotarod performance has been observed in MPTP and 6-OHDA-lesioned models (Ayton et al., 2013; Monville, Torres, & Dunnett, 2006), as well as Nurr1 heterozygous KO mice (Jiang et al., 2005). Our recent study also highlights a critical involvement of nigrostriatal DAergic neurons in rotarod motor skill learning (Wu et al., 2019). Consistent with these previous findings, the rotarod performance of Nurr1Cd11bcre mice was decreased in an age-dependent manner. Furthermore, the declined rotarod performance was accelerated by the peripheral injection of LPS. Since it is difficult to correlate behavioral phenotypes with postmortem pathological abnormalities, future studies will need to apply live imaging techniques in behaving mice to investigate how neuroinflammation affects the activity of DAergic neurons in motor control.

A number of studies have demonstrated that systemic LPS stimulation can cause a loss of DAergic neurons and other PD-related pathological abnormalities (Biesmans et al., 2013; Krishna, Dodd, & Filipov, 2016). A single intraperitoneal injection of LPS at 5 mg/kg leads to significant DAergic neuron damage in C57BL/6 mice 7 months after LPS treatment (Qin et al., 2007). When we injected the control mice with 0.33 mg/kg LPS, this low-dose LPS caused only microglia activation, but not DAergic neuron loss. In contrast, the same dosage of LPS treatment exacerbated the microglial and astrocyte activation, which may result in substantial loss of DAergic neurons in the Nurr1Cd11bcre mice. Microglia are usually classified into two subtypes according to their functions, pro-inflammatory M1 and immunosuppressive M2, although this classification remains controversial (Ransohoff, 2016; Tang & Le, 2016). We found the pro-inflammatory factor Il-1β was elevated in LPS-Nurr1Cd11bcre mice, which supports the possibility of M1 microglia activated. Analogically, A1 astrocytes is postulated to be harmful and has been shown to be induced by activated microglia and abundant in many neurodegenerative diseases including PD (Liddelow et al., 2017). NURR1 has been shown to act as a transrepressor of NFκB p50/p65 subunits-mediated transcriptional activation of proinflammatory genes in the glia cells (Saijo et al., 2009). NURR1 activator C-DIM 12 suppresses the LPS-induced binding of NFκB p65 subunit to the promoters of proinflammatory genes and concomitantly enhances NURR1 nuclear translocation (De Miranda et al., 2015). In line with these early findings, an increase of NFκB activity was also detected in LPS-treated Nurr1Cd11bcre mice, which correlates with increased expression of the genes encoding proinflammatory cytokines and activation of A1 astrocytes (Liddelow et al., 2017). Considering the proinflammatory cytokines, such as Il-1β overexpressed and phosphorylated NFκB p65 activation, we suspect the astrocytes in LPS-Nurr1Cd11bcre mice are more likely to be the A1 type.

Previous studies also reveal genetic interplay between NURR1 and α-synuclein. Overexpression or abnormal accumulation of α-synuclein suppresses Nurr1 expression and interrupts NURR1 function, while forced expression of Nurr1 protects DAergic neurons against α-synuclein-induced cytotoxicity (Decressac et al., 2012). Here we found that systemic LPS treatment leads to increased α-synuclein aggregation in the soma of DAergic neurons of Nurr1Cd11bcre mice. Substantial evidence has shown that α-synuclein could induce neuroinflammation in the brain (Couch, Alvarez-Erviti, Sibson, Wood, & Anthony, 2011; Shao et al., 2019). On the other hand, neuroinflammation can also enhance α-synuclein post-translational modification and aggregation in PD mouse models (Gao et al., 2011). However, the exact molecular mechanism of the elevated α-synuclein aggregation in DAergic neurons in Nurr1Cd11bcre mice remains to be determined.

In summary, our findings support an important physiological function of NURR1 in microglia and other leukocytes in protecting DAergic neurons against inflammatory injury. The Nurr1Cd11bcre mice may serve as a useful preclinical model system to further elucidate how neuroinflammation leads to DAergic neuron loss in PD and test potential therapeutics.

Main points.

LPS treatment could exacerbate neuroinflammation and dopaminergic neuron degeneration in Nurr1Cd11bcre conditional knockout mice.

Acknowledgements

Thanks to Prof Yuqiang Ding from Tongji University for providing the Cd11b-cre mice for this research. This work was supported by the National Natural Science Foundation of China (NSFC 81430021 and 81771521), Key Research and Development Plan of Liaoning Science and Technology Department (2018225051), Key Realm R&D Program of Guangdong Province ( 2018B030337001) and is also supported in part by the Intramural Program of National Institute on Aging, National Institutes of Health (AG000944). Ms J. D. is a participant of the NIH Graduate Partnership Program and a graduate student in Dalian Medical University.

Footnotes

Conflict of Interest Statement

The authors declare that they have no competing interests.

Data Available Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Ahn JH, Lee JS, Cho JH, Park JH, Lee TK, Song M, … Lee CH (2018). Age‑dependent decrease of Nurr1 protein expression in the gerbil hippocampus. Biomedical reports, 8(6), 517–522. http://doi:10.3892/br.2018.1094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ayton S, George JL, Adlard PA, Bush AI, Cherny RA, & Finkelstein DI (2013). The effect of dopamine on MPTP-induced rotarod disability. Neuroscience Letters, 543, 105–109. 10.1016/j.neulet.2013.02.066 [DOI] [PubMed] [Google Scholar]
  3. Baquet ZC, Williams D, Brody J, & Smeyne RJ (2009). A comparison of model-based (2D) and design-based (3D) stereological methods for estimating cell number in the substantia nigra pars compacta (SNpc) of the C57BL/6J mouse. Neuroscience, 161(4), 1082–1090. 10.1016/j.neuroscience.2009.04.031 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Biesmans S, Meert TF, Bouwknecht JA, Acton PD, Davoodi N, De Haes P, … Nuydens R (2013). Systemic immune activation leads to neuroinflammation and sickness behavior in mice. Mediators of Inflammation, 2013, 271359 10.1155/2013/271359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Block ML, & Hong J-S (2007). Chronic microglial activation and progressive dopaminergic neurotoxicity. Biochemical Society Transactions, 35(5), 1127–1132. 10.1042/BST0351127 [DOI] [PubMed] [Google Scholar]
  6. Bohlen CJ, Bennett FC, Tucker AF, Collins HY, Mulinyawe SB, & Barres BA (2017). Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. neuron, 94(4), 759–773 e758 http://doi:10.1016/j.neuron.2017.04.043 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Boillée S, Yamanaka K, Lobsiger CS, Copeland NG, Jenkins NA, Kassiotis G, … Cleveland DW (2006). Onset and progression in inherited ALS determined by motor neurons and microglia. Science (New York, N.Y.), 312(5778), 1389–92. 10.1126/science.1123511 [DOI] [PubMed] [Google Scholar]
  8. Braak H, Tredici K. Del, Rüb U, de Vos RA, Jansen Steur EN, & Braak E (2003). Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiology of Aging, 24(2), 197–211. 10.1016/S0197-4580(02)00065-9 [DOI] [PubMed] [Google Scholar]
  9. Castillo SO, Baffi JS, Palkovits M, Goldstein DS, Kopin IJ, Witta J, … Nikodem VM (1998). Dopamine biosynthesis is selectively abolished in substantia nigra/ventral tegmental area but not in hypothalamic neurons in mice with targeted disruption of the Nurr1 gene. Molecular and Cellular Neuroscience, 11(1–2), 36–46. 10.1006/mcne.1998.0673 [DOI] [PubMed] [Google Scholar]
  10. Christensen JE, Andreasen SØ, Christensen JP, & Thomsen AR (2001). CD11b expression as a marker to distinguish between recently activated effector CD8+ T cells and memory cells. International immunology, 13(4), 593–600. [DOI] [PubMed] [Google Scholar]
  11. Chu Y, Kompoliti K, Cochran EJ, Mufson EJ, & Kordower JH (2002). Age-related decreases in Nurr1 immunoreactivity in the human substantia nigra. The Journal of Comparative Neurology, 450(3), 203–14. 10.1002/cne.10261 [DOI] [PubMed] [Google Scholar]
  12. Chu Y, & Kordower JH (2007). Age-associated increases of α-synuclein in monkeys and humans are associated with nigrostriatal dopamine depletion: Is this the target for Parkinson’s disease? Neurobiology of Disease, 25(1), 134–149. 10.1016/j.nbd.2006.08.021 [DOI] [PubMed] [Google Scholar]
  13. Couch Y, Alvarez-Erviti L, Sibson NR, Wood MJ, & Anthony DC (2011). The acute inflammatory response to intranigral α-synuclein differs significantly from intranigral lipopolysaccharide and is exacerbated by peripheral inflammation. Journal of neuroinflammation, 8(1), 166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dauer W, & Przedborski S (2003). Parkinson’s Disease. Neuron, 39(6), 889–909. 10.1016/S0896-6273(03)00568-3 [DOI] [PubMed] [Google Scholar]
  15. De Miranda BR, Popichak KA, Hammond SL, Jorgensen BA, Phillips AT, Safe S, & Tjalkens RB (2015). The Nurr1 activator 1,1-bis(3’-indolyl)-1-(p-chlorophenyl) methane blocks inflammatory gene expression in BV-2 microglial cells by inhibiting nuclear factor κB. Molecular Pharmacology, 87(6), 1021–34. 10.1124/mol.114.095398 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Decressac M, Kadkhodaei B, Mattsson B, Laguna A, Perlmann T, & Bjorklund A (2012). α-synuclein induced down regulation of Nurr1 disrupts GDNF signaling in nigral dopamine neurons. Science Translational Medicine, 4(163), 163ra156 10.1126/scitranslmed.3004676 [DOI] [PubMed] [Google Scholar]
  17. Decressac M, Volakakis N, Björklund A, & Perlmann T (2013). NURR1 in Parkinson disease—from pathogenesis to therapeutic potential. Nature Reviews Neurology, 9(11), 629–636. 10.1038/nrneurol.2013.209 [DOI] [PubMed] [Google Scholar]
  18. Frank-Cannon TC, Tran T, Ruhn KA, Martinez TN, Hong J, Marvin M, … Tansey MG (2008). Parkin deficiency increases vulnerability to inflammation-related nigral degeneration. Journal of Neuroscience, 28(43), 10825–10834. 10.1523/JNEUROSCI.3001-08.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gao H-M, Zhang F, Zhou H, Kam W, Wilson B, & Hong JS (2011). Neuroinflammation and α-synuclein dysfunction potentiate each other, driving chronic progression of neurodegeneration in a mouse model of Parkinson’s Disease. Environmental Health Perspectives, 119(6), 807–814. 10.1289/ehp.1003013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Goldman SM (2014). Environmental toxins and Parkinson’s disease. Annual Review of Pharmacology and Toxicology, 54, 141–64. 10.1146/annurev-pharmtox-011613-135937 [DOI] [PubMed] [Google Scholar]
  21. Hirsch EC, Vyas S, & Hunot S (2012). Neuroinflammation in Parkinson’s disease. Parkinsonism & Related Disorders, 18 Suppl 1, S210–2. 10.1016/S1353-8020(11)70065-7 [DOI] [PubMed] [Google Scholar]
  22. Jakaria M, Haque ME, Cho DY, Azam S, Kim IS, & Choi DK (2019). Molecular Insights into NR4A2(Nurr1): an Emerging Target for Neuroprotective Therapy Against Neuroinflammation and Neuronal Cell Death. Mol Neurobiol, 56(8), 5799–5814. http://doi:10.1007/s12035-019-1487-4 [DOI] [PubMed] [Google Scholar]
  23. Jankovic J, Chen S, & Le WD (2005). The role of Nurr1 in the development of dopaminergic neurons and Parkinson’s disease. Progress in Neurobiology, 77(1–2), 128–38. 10.1016/j.pneurobio.2005.09.001 [DOI] [PubMed] [Google Scholar]
  24. Jiang C, Wan X, He Y, Pan T, Jankovic J, & Le W (2005). Age-dependent dopaminergic dysfunction in Nurr1 knockout mice. Experimental Neurology, 191(1), 154–62. 10.1016/j.expneurol.2004.08.035 [DOI] [PubMed] [Google Scholar]
  25. Kadkhodaei B, Alvarsson A, Schintu N, Ramsköld D, Volakakis N, Joodmardi E, … Perlmann T (2013). Transcription factor Nurr1 maintains fiber integrity and nuclear-encoded mitochondrial gene expression in dopamine neurons. Proceedings of the National Academy of Sciences of the United States of America, 110(6), 2360–5. 10.1073/pnas.1221077110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kadkhodaei B, Ito T, Joodmardi E, Mattsson B, Rouillard C, Carta M, … Perlmann T (2009). Nurr1 is required for maintenance of maturing and adult midbrain dopamine neurons. The Journal of Neuroscience : The Official Journal of the Society for Neuroscience, 29(50), 15923–32. 10.1523/JNEUROSCI.3910-09.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Karl T, Pabst R, & von Hörsten S (2003). Behavioral phenotyping of mice in pharmacological and toxicological research. Experimental and Toxicologic Pathology : Official Journal of the Gesellschaft Fur Toxikologische Pathologie, 55(1), 69–83. 10.1078/0940-2993-00301 [DOI] [PubMed] [Google Scholar]
  28. Kim YS, & Joh TH (2006). Microglia, major player in the brain inflammation: their roles in the pathogenesis of Parkinson’s disease. Experimental & Molecular Medicine, 38(4), 333–47. 10.1038/emm.2006.40 [DOI] [PubMed] [Google Scholar]
  29. Kreutzberg GW (1996). Microglia: a sensor for pathological events in the CNS. Trends in Neurosciences, 19(8), 312–8. [DOI] [PubMed] [Google Scholar]
  30. Krishna S, Dodd CA, & Filipov NM (2016). Behavioral and monoamine perturbations in adult male mice with chronic inflammation induced by repeated peripheral lipopolysaccharide administration. Behavioural Brain Research, 302, 279–290. 10.1016/j.bbr.2016.01.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Le W, Pan T, Huang M, Xu P, Xie W, Zhu W, … Jankovic J (2008). Decreased NURR1 gene expression in patients with Parkinson’s disease. Journal of the neurological sciences, 273(1–2), 29–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Le W, Chen S, & Jankovic J (2009). Etiopathogenesis of Parkinson Disease: A New Beginning? The Neuroscientist, 15(1), 28–35. 10.1177/1073858408319974 [DOI] [PubMed] [Google Scholar]
  33. Le W, Conneely OM, He Y, Jankovic J, & Appel SH (1999). Reduced Nurr1 expression increases the vulnerability of mesencephalic dopamine neurons to MPTP-induced injury. Journal of Neurochemistry, 73(5), 2218–21. [PubMed] [Google Scholar]
  34. Le W, Conneely OM, Zou L, He Y, Saucedo-Cardenas O, Jankovic J, … Appel SH (1999). Selective agenesis of mesencephalic dopaminergic neurons in Nurr1-deficient mice. Experimental Neurology, 159(2), 451–8. 10.1006/exnr.1999.7191 [DOI] [PubMed] [Google Scholar]
  35. Li T, Yang Z, Li S, Cheng C, Shen B, & Le W (2018). Alterations of NURR1 and Cytokines in the Peripheral Blood Mononuclear Cells: Combined Biomarkers for Parkinson’s Disease. Frontiers in Aging Neuroscience, 10 10.3389/fnagi.2018.00392 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Liddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L, … Barres BA (2017). Neurotoxic reactive astrocytes are induced by activated microglia. Nature, 541(7638), 481–487. 10.1038/nature21029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Lin L, Desai R, Wang X, Lo EH, & Xing C (2017). Characteristics of primary rat microglia isolated from mixed cultures using two different methods. J Neuroinflammation, 14(1), 101 http://doi:10.1186/s12974-017-0877-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Liu B, Du L, & Hong JS (2000). Naloxone protects rat dopaminergic neurons against inflammatory damage through inhibition of microglia activation and superoxide generation. The Journal of Pharmacology and Experimental Therapeutics, 293(2), 607–17. [PubMed] [Google Scholar]
  39. Liu H, Wei L, Tao Q, Deng H, Ming M, Xu P, & Le W (2012). Decreased NURR1 and PITX3 gene expression in Chinese patients with Parkinson’s disease. European Journal of Neurology, 19(6), 870–5. 10.1111/j.1468-1331.2011.03644.x [DOI] [PubMed] [Google Scholar]
  40. Liu P (2003). A Highly Efficient Recombineering-Based Method for Generating Conditional Knockout Mutations. Genome Research, 13(3), 476–484. 10.1101/gr.749203 [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Mazzone A, & Ricevuti G (1995). Leukocyte CD11/CD18 integrins: biological and clinical relevance. Haematologica, 80(2), 161–75. [PubMed] [Google Scholar]
  42. Monville C, Torres EM, & Dunnett SB (2006). Comparison of incremental and accelerating protocols of the rotarod test for the assessment of motor deficits in the 6-OHDA model. Journal of Neuroscience Methods, 158(2), 219–223. 10.1016/j.jneumeth.2006.06.001 [DOI] [PubMed] [Google Scholar]
  43. Moon M, Jung ES, Jeon SG, Cha MY, Jang Y, Kim W, … Kim KS (2019). Nurr1 (NR4A2) regulates Alzheimer’s disease-related pathogenesis and cognitive function in the 5XFAD mouse model. Aging Cell, 18(1), e12866 http://doi:10.1111/acel.12866 [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Nagatsu T, & Sawada M (2005). Inflammatory process in Parkinson’s disease: role for cytokines. Current Pharmaceutical Design, 11(8), 999–1016. [DOI] [PubMed] [Google Scholar]
  45. Perlmann T, & Wallén-Mackenzie A (2004). Nurr1, an orphan nuclear receptor with essential functions in developing dopamine cells. Cell and Tissue Research, 318(1), 45–52. 10.1007/s00441-004-0974-7 [DOI] [PubMed] [Google Scholar]
  46. Qin L, Wu X, Block ML, Liu Y, Breese GR, Hong JS, … Crews FT (2007). Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration. Glia, 55(5), 453–62. 10.1002/glia.20467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ransohoff RM (2016). A polarizing question: do M1 and M2 microglia exist? Nat Neurosci, 19(8), 987–991. http://doi:10.1038/nn.4338 [DOI] [PubMed] [Google Scholar]
  48. Rocha NP, de Miranda AS, & Teixeira AL (2015). Insights into Neuroinflammation in Parkinson’s Disease: From Biomarkers to Anti-Inflammatory Based Therapies. BioMed Research International, 2015, 1–12. 10.1155/2015/628192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Saijo K, Winner B, Carson CT, Collier JG, Boyer L, Rosenfeld MG, … Glass CK (2009). A Nurr1/CoREST pathway in microglia and astrocytes protects dopaminergic neurons from inflammation-induced death. Cell, 137(1), 47–59. 10.1016/j.cell.2009.01.038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sampson TR, Debelius JW, Thron T, Janssen S, Shastri GG, Ilhan ZE, … Mazmanian SK (2016). Gut Microbiota Regulate Motor Deficits and Neuroinflammation in a Model of Parkinson’s Disease. Cell, 167(6), 1469–1480.e12. 10.1016/j.cell.2016.11.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Saucedo-Cardenas O, Quintana-Hau JD, Le W, Smidt MP, Cox JJ, De Mayo F, … Conneely OM (1998). Nurr1 is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons. Proceedings of the National Academy of Sciences of the United States of America, 95(7), 4013–4018. 10.1073/pnas.95.7.4013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Sgobio C, Kupferschmidt DA, Cui G, Sun L, Li Z, Cai H, & Lovinger DM (2014). Optogenetic measurement of presynaptic calcium transients using conditional genetically encoded calcium indicator expression in dopaminergic neurons. PloS One, 9(10), e111749 10.1371/journal.pone.0111749 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Shao QH, Yan WF, Zhang Z, Ma KL, Peng SY, Cao YL, … Chen NH (2019). Nurr1: A vital participant in the TLR4-NF-kappaB signal pathway stimulated by alpha-synuclein in BV-2cells. Neuropharmacology, 144, 388–399. http://doi:10.1016/j.neuropharm.2018.04.008 [DOI] [PubMed] [Google Scholar]
  54. Sofroniew MV (2014). Astrogliosis. Cold Spring Harb Perspect Biol, 7(2), a020420 http://doi:10.1101/cshperspect.a020420 [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Tang Y, & Le W (2016). Differential Roles of M1 and M2 Microglia in Neurodegenerative Diseases. Molecular Neurobiology, 53(2), 1181–1194. 10.1007/s12035-014-9070-5 [DOI] [PubMed] [Google Scholar]
  56. Tang Y, Li T, Li J, Yang J, Liu H, Zhang XJ, & Le W (2014). Jmjd3 is essential for the epigenetic modulation of microglia phenotypes in the immune pathogenesis of Parkinson’s disease. Cell Death and Differentiation, 21(3), 369–80. 10.1038/cdd.2013.159 [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Tansey MG, McCoy MK, & Frank-Cannon TC (2007). Neuroinflammatory mechanisms in Parkinson’s disease: potential environmental triggers, pathways, and targets for early therapeutic intervention. Experimental Neurology, 208(1), 1–25. 10.1016/j.expneurol.2007.07.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Tomás-Camardiel M, Rite I, Herrera AJ, de Pablos RM, Cano J, Machado A, & Venero JL (2004). Minocycline reduces the lipopolysaccharide-induced inflammatory reaction, peroxynitrite-mediated nitration of proteins, disruption of the blood-brain barrier, and damage in the nigral dopaminergic system. Neurobiology of Disease, 16(1), 190–201. 10.1016/j.nbd.2004.01.010 [DOI] [PubMed] [Google Scholar]
  59. Unger EL, Eve DJ, Perez XA, Reichenbach DK, Xu Y, Lee MK, & Andrews AM (2006). Locomotor hyperactivity and alterations in dopamine neurotransmission are associated with overexpression of A53T mutant human α-synuclein in mice. Neurobiology of Disease, 21(2), 431–443. 10.1016/j.nbd.2005.08.005 [DOI] [PubMed] [Google Scholar]
  60. Vlajinac H, Dzoljic E, Maksimovic J, Marinkovic J, Sipetic S, & Kostic V (2013). Infections as a risk factor for Parkinson’s disease: a case-control study. The International Journal of Neuroscience, 123(5), 329–32. 10.3109/00207454.2012.760560 [DOI] [PubMed] [Google Scholar]
  61. Wieghofer P, Knobeloch KP, & Prinz M (2015). Genetic targeting of microglia. Glia, 63(1), 1–22. 10.1002/glia.22727 [DOI] [PubMed] [Google Scholar]
  62. Wu J, Kung J, Dong J, Chang L, Xie C, Habib A, … Cai H (2019). Distinct connectivity and functionality of aldehyde dehydrogenase 1a1-positive nigrostriatal dopaminergic neurons in motor learning. Cell Reports, 28(5), 1167–1181.e7. 10.1016/j.celrep.2019.06.095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Xiao Q, Yang S, & Le W (2015). G2019S LRRK2 and aging confer susceptibility to proteasome inhibitor-induced neurotoxicity in nigrostriatal dopaminergic system. Journal of Neural Transmission, 122(12), 1645–1657. 10.1007/s00702-015-1438-9 [DOI] [PubMed] [Google Scholar]
  64. Yang L, Zhang J, Zheng K, Shen H, & Chen X (2014). Long-term ginsenoside Rg1 supplementation improves age-related cognitive decline by promoting synaptic plasticity associated protein expression in C57BL/6J mice. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences, 69(3), 282–94. 10.1093/gerona/glt091 [DOI] [PubMed] [Google Scholar]
  65. Zetterström RH, Solomin L, Jansson L, Hoffer BJ, Olson L, & Perlmann T (1997). Dopamine neuron agenesis in Nurr1-deficient mice. Science (New York, N.Y.), 276(5310), 248–250. 10.1126/science.276.5310.248 [DOI] [PubMed] [Google Scholar]

RESOURCES