miRNA target prediction might explain the reduced transmission of SARS-CoV-2 in Jordan, Middle East

Abstract

MicroRNAs (miRNAs) are non-coding RNAs that control many functions within the human cells by controlling protein levels through binding to messenger RNA (mRNA) translation process or mRNA abundance. Many pieces of evidence show that miRNAs affect the viral RNA replication and pathogenesis through direct binding to the RNA virus to mediate changes in the host transcriptome. Many previous studies have been studying the interaction between human cells' miRNA and viral RNA to predict many targets along the viral genome. In this work, via the miRDB database, we determined the target scores of predicted human miRNA to bind with the ss-RNA of the severe acute respiratory syndrome coronavirus (SARS-CoV-2) in general and its spike gene in specific. Our predicted miRNA targets of the ss-RNA of SARS-CoV-2 might destabilize the ss-RNA translation of SARS-CoV-2 that has been established by more than 80% of asymptomatic infected cases in Jordan due to host miRNA interactions. In respiratory epithelial cells, the high prediction scoring for miRNAs covers the RNA from 5′ to 3′ that explains successful antiviral defenses against ss-RNA of SARS-CoV-2 and might lead to new nucleotide deletion mechanisms. The exciting findings here that the nucleotide substitution 1841A > G at the viral genomic RNA level, which is an amino acid substation D614G at the spike protein level showed a change in the predicted miRNA sequence from hsa-miR-4793-5p to hsa-miR-3620-3p with an increase in the target score from 91 to 92.

1. Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) caused an outbreak in Wuhan city and characterized as a pandemic by the World Health Organization WHO [1]. The first case of SARS-CoV-2 was reported to the Jordanian Ministry of Health on March 2, 2020, for a Jordanian citizen who was in Italy. To the date of this report, there are 1218 confirmed cases, 1131 recovered and 11 deaths of COVID-19 in Jordan, according to the Jordanian Ministry of Health official web site which has been launched as a unified source of information about the preventive measurements and symptoms of corona virus-2019 (https://corona.moh.gov.jo/en).

In 2003, severe coronavirus acute breathing syndrome (SARS-CoV) appeared in China. It has spread to over 30 countries, infecting around 8000 people, killing young people with 10%, and aging with 50%. There are no approved coronavirus vaccines or antiviral treatments against, for example, such as the Middle East respiratory CoV (MERS-CoV) yet [2]. The molecular mechanisms of viral pathogenesis provide thoughtful help in the search for effective and secure therapeutic strategies against new human SARS-Cov-2.

MicroRNAs (miRNAs) are non-coding RNAs that control many functions within a cell by controlling protein levels through binding to mRNA translation process. Many shreds of evidence show that miRNAs affect the RNA viral replication and, consequently, pathogenesis through direct binding to the RNA virus-mediated changes in the host transcriptome. Host miRNAs can bind to a wide range of RNA viruses, straight adapt their pathogenesis through mimicking cellular mRNAs, and tolerating direct binding of the miRNA to the viral RNA. Theoretically, the abovementioned regulation is analogous to that of the host mRNAs [3,4].

Many miRNA sequences that targeted Influenza viral RNA segments were linked with the activity of host miRNA-induced antiviral defense. This link represents potential treatment with a combination of five miRNAs through Antagomirs delivery to suppress the viral replication and effectively improve protection against lethal challenge with PR8 influenza virus strain in mice [5].

Severe acute coronavirus syndrome (SARS-CoV) caused human fatal disease and reaction and extensive pulmonary disease. The significance of small non-coding RNAs for SARS-CoV pathologies, lung RNAs sequences of infected mice, and three (18–22 nt) small viral RNAs (svRNAs) were discovered. The three svRNAs originated from the SARS-CoV genomic regions nsp3 (svRNA-nsp3.1 and -nsp3.2), and N (svRNA-N). CoV svRNAs were characterized as independent from cell type and host species RNase III, but the extent of the viral replication machinery was a dependent process. In vivo, lung pathology and pro-inflammatory cytokine release, antagomir-mediated inhibition of svRNA-N significantly decreased. This indicates that svRNAs contribute to the pathogenesis of SARS-CoV and demonstrates the potential for antagomirs of svRNA-N as antivirals [6].

To understand the early steps of COVID-19 infection, we predicted miRNAs sequences targeting the submitted 29903bp of viral ss-RNA of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2 complete genomic RNA sequence) from the isolate of Wuhan-Hu-1. A predicted miRNAs targeting region at 3822 bp ss-RNA of the spike glycoprotein of SARS-CoV-2 was revealed. Also, we predicted miRNAs targeting a variable region of the ss-RNA spike glycoprotein of SARS-CoV-2 sequences from 20 positive nasopharyngeal specimens form Jordan. These specimens were collected and sequenced by Biolab Diagnostic Laboratories (Jordan) & Andersen lab at Scripps Research (USA), who deposited the sequences in GISAID, a maintained global database based in Germany. The perception in this work might help scientists to understand the molecular mechanisms of viral pathogenesis. Besides, it might support the research for effective, safe therapeutic strategies against known human coronaviruses and new emergent strains with a focus on miRNA-induced antiviral human body defense, which could be a potential treatment developed for SARS-CoV-2.

2. Methods

The miRDB is an online http://mirdb.org/custom.html database for the target and working annotations of miRNA. All targets in miRDB were anticipated by MirTarget, a bioinformatics tool that was developed through the study of thousands of miRNA target interactions from high-performance research [7,8].

We have utilized the tool in the following link: http://biomodel.uah.es/en/lab/cybertory/analysis/trans.htm to convert submitted sequences from miRNA to DNA to demonstrate genome sequence alignment using ChromosPros Version 2.1.9. The Wuhan-Hu-1 full genome sequence (accession number: NC_045512.2) has been used as a reference sequence against miRNAs targeting the area of 3822 bp ss-RNA of the SARs-CoV-2 Spike gene. We predicted miRNA targets against the full length of 29903 bp ss-RNA (SARS-CoV-2 sequence) from the isolate of Wuhan-Hu-1. In addition, variable miRNAs were predicted to target regions on the SARs-CoV-2 sequences against the reference sequence ss-RNA spike glycoprotein (accession number: YP_009724390) from Jordanian positive nasopharyngeal specimens sequenced by Biolab Diagnostic Laboratories (Jordan) & Andersen lab at Scripps Research (USA) who published sequences retrieved from GISAID (https://corona.moh.gov.jo/en) (https://gisaid.org).

3. Results and discussion

We predicted top ten miRNAs targeting score between (98–99) against the submitted 29903 bp ss-RNA SARS-CoV-2 full length genome correspondingly, hsa-miR-4288, hsa-miR-195-5p, hsa-miR-16-5p, hsa-miR-15b-5p, hsa-miR-15a-5p, hsa-miR-6838-5p, hsa-miR-497-5p, hsa-miR-424-5p, hsa-miR-3133, hsa-miR-21-3p, please see Table 1 (Appendix). These miRNAs are presented in miRDB, along with associated function annotations. As a recent update, miRDB displays expressions of hundreds of cell lines, and the user may limit their search for the cell line of interest miRNA targets. miRDB offers an integrative analysis of the target prediction and ontological gene data found in Tables 2,3,4,5,6,7,8,9,10 and 11 (Appendix), to promote the prediction of miRNA functions. Also, we predicted only three miRNAs (hsa-miR-510-3p, hsa-miR-624-5p, and hsa-miR-497-5p) with targeting scores of (92, 90 and 84) respectively for the submitted 3822 bp of the ss-RNA spike glycoprotein of SARS-CoV-2 sequence of Wuhan-Hu-1 (from the complete genome NCBI reference sequence: NC_045512.2 Region: 21563–25384) as shown in Table 13 (Appendix). These miRNAs, as well as associated functional annotations, presented in miRDB present the expression profiles of hundreds of cell lines. To facilitate the prediction of miRNA functions miRDB offers an integrative analysis of target prediction and Gene Ontology data found in Tables 14 and 15 (Appendix).

Moreover, in our study, we predicted the regions of miRNAs targeting score against many ss-RNA spike glycoprotein of SARS-CoV-2 sequences from Jordanian samples with amino acid substitutions (NCBI reference sequence: NC_045512.2 region: 21563–25384 and nomenclature sequence, Single Amino Acid Variant (SAV) and annotation used the accession number YP_009724390.1) showed in Tables 16–24 (Appendix). The original sequence of the del 432TTA, and the del Y144 have the same miRNA with a target score of 91. The original 1841A target miRNA scored (91, 64 and 56) for (hsa-miR-4793-5p, hsa-miR-143-5p and hsa-miR-3133) respectively. The interesting finding here that the 1841A > G, and D614G showed a change in the predicted miRNA and an increase in the target score from 91 to 92 (hsa-miR-4793-5p to hsa-miR-3620-3p). However, the original and 3415G > T D1139Y showed the same sequence of the miRNA (hsa-miR-548g-3p) and an increase in the target score from 80 to 81. The last substitution of 3499 G > A G1167S showed the same miRNA sequence of (hsa-miR-155-5p) and a decrease in the target score from 73 to 72.

One of the record genomic changes observed in the severe acute respiratory syndrome coronavirus (SARS-CoV-1) isolated from humans after human to human transmission was the acquisition of a specific 29-nucleotide deletion occurred in open reading frame 8 (ORF8). Three top target scores of miRNAs prediction (hsa-miR-497-5p, hsa-miR-195-5p and hsa-miR-21-3p) showed in Table 12, 16 and 24 (Appendix). They had an expression in the respiratory epithelial cells, and effective antiviral defenses against the ss-RNA of SARS-CoV-2 might lead to a new mechanism of interaction binding miRNA to cause nucleotide deletion in SARS-CoV-2 in reflection to previous reports [5,6,9].

4. Conclusion

Over the past few years, some articles reported the target prediction of miRNA and viral RNA interaction. In our forecasts, more than asymptomatic 80% of the COVID-19 diseased persons raised due to the host miRNA interactions, which have identified the target where the genome replication of the ss-RNA of SARS-CoV-2 has changed to probably inhibit the translation of the ss-RNA and hence possible preventing viral replication and stabilization by subsequent generations. The top target scores of miRNAs prediction cover from 5′ to 3’ in the human respiratory epithelial cells that might be the reason for an effective antiviral defense against the ss-RNA of SARS-CoV-2 and lead to a new mechanism of nucleotide deletion in the coding region of a protein. The miRNAs found in all tissues have targeted gene functions, which lead to an identification of novel cellular pathways to block viral RNA replication or even host cell-specific targeting the regulation for the ss-RNA of SARS-CoV-2.

Funding

Any funding body did not fund this work.

CRediT authorship contribution statement

Hazem Haddad: Conceptualization, Methodology, Software, Data curation, Writing - original draft, Visualization, Investigation, Supervision, Software, Validation, Writing - review & editing. Walid Al-Zyoud: Conceptualization, Methodology, Software, Data curation, Writing - original draft, Visualization, Investigation, Supervision, Software, Validation, Writing - review & editing.

Declaration of competing interest

All authors declare no conflict of interest.

Appendix.

Table 1.

Predicted miRNAs targeting the submitted 29903 bp ss-RNA SARS-COV-2 genome, accession number NC_045512.2.

Target Rank	Target Score	miRNA Name
1	99	hsa-miR-4288
2	99	hsa-miR-195-5p
3	99	hsa-miR-16-5p
4	99	hsa-miR-15b-5p
5	99	hsa-miR-15a-5p
6	99	hsa-miR-6838-5p
7	98	hsa-miR-497-5p
8	98	hsa-miR-424-5p
9	98	hsa-miR-3133
10	98	hsa-miR-21-3p

Table 2.

Predicted targets function for hsa-miR-4288 on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	97	hsa-miR-4288	UIMC1	ubiquitin interaction motif containing 1
2	97	hsa-miR-4288	CC2D1A	coiled-coil and C2 domain containing 1A
3	96	hsa-miR-4288	ING3	inhibitor of growth family member 3
4	96	hsa-miR-4288	KCMF1	potassium channel modulatory factor 1
5	96	hsa-miR-4288	CAPZB	capping actin protein of muscle Z-line subunit beta
6	96	hsa-miR-4288	BCL11A	BCL11A, BAF complex component
7	96	hsa-miR-4288	AMELX	amelogenin X-linked
8	96	hsa-miR-4288	NTM	Neurotrimin
9	95	hsa-miR-4288	LRRC4C	leucine rich repeat containing 4C
10	95	hsa-miR-4288	PSIP1	PC4 and SFRS1 interacting protein 1

Table 3.

Predicted targets function for hsa-miR-195-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-195-5p	PAPPA	pappalysin 1
2	100	hsa-miR-195-5p	FASN	fatty acid synthase
3	100	hsa-miR-195-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-195-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-195-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-195-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-195-5p	PHF19	PHD finger protein 19
8	100	hsa-miR-195-5p	DESI1	desumoylating isopeptidase 1
9	99	hsa-miR-195-5p	UBE2Q1	ubiquitin conjugating enzyme E2 Q1
10	99	hsa-miR-195-5p	LSM11	LSM11, U7 small nuclear RNA associated

Table 4.

Predicted targets function for hsa-miR-16-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-16-5p	PAPPA	pappalysin 1
2	100	hsa-miR-16-5p	FASN	fatty acid synthase
3	100	hsa-miR-16-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-16-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-16-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-16-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-16-5p	PHF19	PHD finger protein 19
8	100	hsa-miR-16-5p	DESI1	desumoylating isopeptidase 1
9	99	hsa-miR-16-5p	UBE2Q1	ubiquitin conjugating enzyme E2 Q1
10	99	hsa-miR-16-5p	LSM11	LSM11, U7 small nuclear RNA associated

Table 5.

Predicted targets function for hsa-miR-15b-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-15b-5p	PAPPA	pappalysin 1
2	100	hsa-miR-15b-5p	FASN	fatty acid synthase
3	100	hsa-miR-15b-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-15b-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-15b-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-15b-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-15b-5p	PHF19	PHD finger protein 19
8	100	hsa-miR-15b-5p	DESI1	desumoylating isopeptidase 1
9	99	hsa-miR-15b-5p	UBE2Q1	ubiquitin conjugating enzyme E2 Q1
10	99	hsa-miR-15b-5p	LSM11	LSM11, U7 small nuclear RNA associated

Table 6.

Predicted targets function for hsa-miR-15a-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-15a-5p	PAPPA	pappalysin 1
2	100	hsa-miR-15a-5p	FASN	fatty acid synthase
3	100	hsa-miR-15a-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-15a-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-15a-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-15a-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-15a-5p	PHF19	PHD finger protein 19
8	100	hsa-miR-15a-5p	DESI1	desumoylating isopeptidase 1
9	99	hsa-miR-15a-5p	UBE2Q1	ubiquitin conjugating enzyme E2 Q1
10	99	hsa-miR-15a-5p	LSM11	LSM11, U7 small nuclear RNA associated

Table 7.

Predicted targets function for hsa-miR-6838-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-6838-5p	PAPPA	pappalysin 1
2	100	hsa-miR-6838-5p	FASN	fatty acid synthase
3	100	hsa-miR-6838-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-6838-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-6838-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-6838-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-6838-5p	PHF19	PHD finger protein 19
8	99	hsa-miR-6838-5p	UBE2Q1	ubiquitin-conjugating enzyme E2 Q1
9	99	hsa-miR-6838-5p	LSM11	LSM11, U7 small nuclear RNA associated
10	99	hsa-miR-6838-5p	ANKUB1	ankyrin repeat and ubiquitin domain containing 1

Table 8.

Predicted targets function for hsa-miR-497-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-497-5p	PAPPA	pappalysin 1
2	100	hsa-miR-497-5p	FASN	fatty acid synthase
3	100	hsa-miR-497-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-497-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-497-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-497-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-497-5p	PHF19	PHD finger protein 19
8	99	hsa-miR-497-5p	UBE2Q1	ubiquitin conjugating enzyme E2 Q1
9	99	hsa-miR-497-5p	LSM11	LSM11, U7 small nuclear RNA associated
10	99	hsa-miR-497-5p	ANKUB1	ankyrin repeat and ubiquitin domain containing 1

Table 9.

Predicted targets function for hsa-miR-424-5p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-424-5p	PAPPA	pappalysin 1
2	100	hsa-miR-424-5p	FASN	fatty acid synthase
3	100	hsa-miR-424-5p	UNC80	unc-80 homolog, NALCN channel complex subunit
4	100	hsa-miR-424-5p	FGF2	fibroblast growth factor 2
5	100	hsa-miR-424-5p	TNRC6B	trinucleotide repeat containing 6B
6	100	hsa-miR-424-5p	PTPN4	protein tyrosine phosphatase, non-receptor type 4
7	100	hsa-miR-424-5p	PHF19	PHD finger protein 19
8	99	hsa-miR-424-5p	UBE2Q1	ubiquitin-conjugating enzyme E2 Q1
9	99	hsa-miR-424-5p	LSM11	LSM11, U7 small nuclear RNA associated
10	99	hsa-miR-424-5p	ANKUB1	ankyrin repeat and ubiquitin domain containing 1

Table 10.

Predicted targets function for hsa-miR-3133 on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-3133	HOOK3	hook microtubule tethering protein 3
2	100	hsa-miR-3133	RIMS2	regulating synaptic membrane exocytosis 2
3	100	hsa-miR-3133	TGFBRAP1	transforming growth factor-beta receptor-associated protein 1
4	99	hsa-miR-3133	RPRD1A	regulation of nuclear pre-mRNA domain-containing 1A
5	99	hsa-miR-3133	TFAP2B	transcription factor AP-2 beta
6	99	hsa-miR-3133	PTPRK	protein tyrosine phosphatase, receptor type K
7	99	hsa-miR-3133	MAP2	microtubule-associated protein 2
8	99	hsa-miR-3133	NRF1	nuclear respiratory factor 1
9	99	hsa-miR-3133	KAT6A	lysine acetyltransferase 6A
10	99	hsa-miR-3133	URI1	URI1, prefoldin like chaperone

Table 11.

Predicted targets function for hsa-miR-21-3p on 29903 bp ss-RNA SARS-COV-2 genome.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	99	hsa-miR-21-3p	STK38L	serine/threonine kinase 38 like
2	98	hsa-miR-21-3p	PCDH19	protocadherin 19
3	96	hsa-miR-21-3p	LAMP1	lysosomal associated membrane protein 1
4	96	hsa-miR-21-3p	GRIA2	glutamate ionotropic receptor AMPA type subunit 2
5	96	hsa-miR-21-3p	TOGARAM1	TOG array regulator of axonemal microtubules 1
6	96	hsa-miR-21-3p	ATP1B1	ATPase Na+/K+ transporting subunit beta 1
7	96	hsa-miR-21-3p	TSC22D2	TSC22 domain family member 2
8	96	hsa-miR-21-3p	NAP1L5	Nucleosome assembly protein 1 like 5
9	95	hsa-miR-21-3p	UBE4B	ubiquitination factor E4B
10	95	hsa-miR-21-3p	ZNF326	zinc finger protein 326

Table 12.

Predicted miRNAs targeting region on 29903 nt SARS-COV-2 complete genome.

Severe acute respiratory syndrome coronavirus 2 (SARS-COV-2 sequence) isolate Wuhan-Hu-1, complete genome NCBI Reference Sequence: NC_045512.2	miRNAs targeting the submitted 29903 nt SARS-COV-2 complete genome
181 ttctgcaggc tgcttacggt ttcgtccgtg ttgcagccga tcatcagcac atctaggttt 241 cgtccgggtg tgaccgaaag gtaagatgga gagccttgtc cctggtttca acgagaaaac	miRNA Name hsa-miR-15b-5p Previous Name hsa-miR-15b miRNA Sequence 5′ - uagcagcacaucaugguuuaca - 3' (length = 22) miRNA Name hsa-miR-497-5p Previous Name hsa-miR-497 miRNA Sequence 5′ - cagcagcacacugugguuugu - 3' (length = 21)
4441 tgtggaaact aaagccatag tttcaactat acagcgtaaa tataagggta ttaaaataca	miRNA Name hsa-miR-16-5p Previous Name hsa-miR-16 miRNA Sequence 5′ - uagcagcacguaaauauuggcg - 3' (length = 22)
6361 cgcgcaggga atggataatc ttgcctgcga agatctaaaa ccagtctctg aagaagtagt 6421 ggaaaatcct accatacaga aagacgttct tgagtgtaat gtgaaaacta ccgaagttgt	miRNA Name hsa-miR-6838-5p miRNA Sequence 5′ - aagcagcaguggcaagacuccu - 3' (length = 22)
8821 attgattgct gcagtcataa caagagaagt gggttttgtc gtgcctggtt tgcctggcac	miRNA Name hsa-miR-4288 miRNA Sequence 5′ - uugucugcugaguuucc - 3' (length = 17)
12421 aagagatggt tgtgttccct tgaacataat acctcttaca acagcagcca aactaatggt 12481 tgtcatacca gactataaca catataaaaa tacgtgtgat ggtacaacat ttacttatgc	miRNA Name hsa-miR-497-5p Previous Name hsa-miR-497 miRNA Sequence 5′ - cagcagcacacugugguuugu - 3' (length = 21)
14221 ttaacaaagc cttacattaa gtgggatttg ttaaaatatg acttcacgga agagaggtta 14281 aaactctttg accgttattt taaatattgg gatcagacat accacccaaa ttgtgttaac	miRNA Name hsa-miR-15a-5p Previous Name hsa-miR-15a miRNA Sequence 5′ - uagcagcacauaaugguuugug - 3' (length = 22)
20161 aaagttgatg gtgttgtcca acaattacct gaaacttact ttactcagag tagaaattta 20221 caagaattta aacccaggag tcaaatggaa attgatttct tagaattagc tatggatgaa	miRNA Name hsa-miR-3133 miRNA Sequence 5′ - uaaagaacucuuaaaacccaau - 3' (length = 22)
21301 ccacgcgaac aaatagatgg ttatgtcatg catgcaaatt acatattttg gaggaataca	miRNA Name Hsa-miR-424-5p Previous Name Hsa-miR-424 miRNA Sequence 5′ - cagcagcaauucauguuuugaa - 3' (length = 22)
24841 tgtctttgtt tcaaatggca cacactggtt tgtaacacaa aggaattttt atgaaccaca	miRNA Name Hsa-miR-497-5p Previous Name Hsa-miR-497 miRNA Sequence 5′ - cagcagcacacugugguuugu - 3' (length = 21)
28501 caatagcagt ccagatgacc aaattggcta ctaccgaaga gctaccagac gaattcgtgg	miRNA Name hsa-miR-195-5p Previous Name hsa-miR-195 miRNA Sequence 5′ - uagcagcacagaaauauuggc – 3' (length = 21)
29521 aactcaggcc taaactcatg cagaccacac aaggcagatg ggctatataa acgttttcgc	miRNA Name hsa-miR-21-3p Previous Name hsa-miR-21* miRNA Sequence 5′ - caacaccagucgaugggcugu - 3' (length = 21)

Table 13.

Predicted miRNAs targeting the submitted 3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence, accession number NC_045512.2 REGION: 21563–25384.

Target Rank	Target Score	miRNA Name
1	92	hsa-miR-510-3p
2	90	hsa-miR-624-5p
14	84	hsa-miR-497-5p

Table 14.

Predicted targets function for hsa-miR-510-3p on 3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence, accession number NC_045512.2 REGION: 21563–25384.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	100	hsa-miR-510-3p	CNOT6	CCR4-NOT transcription complex subunit 6
2	99	hsa-miR-510-3p	NEXMIF	neurite extension and migration factor
3	99	hsa-miR-510-3p	RBMS3	RNA binding motif single stranded interacting protein 3
4	99	hsa-miR-510-3p	DENND6A	DENN domain containing 6A
5	99	hsa-miR-510-3p	SNAP91	Synaptosome associated protein 91
6	99	hsa-miR-510-3p	BCLAF1	BCL2 associated transcription factor 1
7	99	hsa-miR-510-3p	LATS2	large tumor suppressor kinase 2
8	99	hsa-miR-510-3p	ELOVL7	ELOVL fatty acid elongase 7
9	98	hsa-miR-510-3p	ZFHX3	zinc finger homeobox 3
10	98	hsa-miR-510-3p	FMR1	fragile X mental retardation 1

Table 15.

Predicted targets function for hsa-miR-624-5p on 3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence, accession number NC_045512.2 REGION: 21563–25384.

Target Rank	Target Score	miRNA Name	Gene Symbol	Gene Description
1	96	hsa-miR-624-5p	ARL4A	ADP ribosylation factor like GTPase 4A
2	96	hsa-miR-624-5p	SOWAHC	sosondowah ankyrin repeat domain family member C
3	95	hsa-miR-624-5p	SYT1	synaptotagmin 1
4	95	hsa-miR-624-5p	CLOCK	clock circadian regulator
5	95	hsa-miR-624-5p	STK38	serine/threonine kinase 38
6	95	hsa-miR-624-5p	LCP1	lymphocyte cytosolic protein 1
7	95	hsa-miR-624-5p	ZNF800	zinc finger protein 800
8	95	hsa-miR-624-5p	DOCK11	dedicator of cytokinesis 11
9	94	hsa-miR-624-5p	UAP1	UDP-N-acetylglucosamine pyrophosphorylase 1
10	94	hsa-miR-624-5p	NFKBIA	NFKB inhibitor alpha

Table 16.

Predicted miRNAs targeting region on 3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence.

3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence isolate Wuhan-Hu-1, complete genome NCBI Reference Sequence: NC_045512.2	miRNAs targeting the submitted 3822 bp ss-RNA spike glycoprotein of SARS-COV-2 sequence
1 atgtttgttt ttcttgtttt attgccacta gtctctagtc agtgtgttaa tcttacaacc	miRNA Name hsa-miR-624-5p Previous Name hsa-miR-624; hsa-miR-624* miRNA Sequence 5′ - uaguaccaguaccuuguguuca - 3' (length = 22)
2821 acagcaagtg cacttggaaa acttcaagat gtggtcaacc aaaatgcaca agctttaaac	miRNA Name hsa-miR-510-3p miRNA Sequence 5′ - auugaaaccucuaagagugga - 3' (length = 21)
3241 atttgtcatg atggaaaagc acactttcct cgtgaaggtg tctttgtttc aaatggcaca 3301 cactggtttg taacacaaag gaatttttat gaaccacaaa tcattactac agacaacaca	miRNA Name hsa-miR-497-5p Previous Name hsa-miR-497 miRNA Sequence 5′ - cagcagcacacugugguuugu - 3' (length = 21)
3661 atagctggct tgattgccat agtaatggtg acaattatgc tttgctgtat gaccagttgc 3721 tgtagttgtc tcaagggctg ttgttcttgt ggatcctgct gcaaatttga tgaagacgac	miRNA Name hsa-miR-624-5p Previous Name hsa-miR-624; hsa-miR-624* miRNA Sequence 5′ - uaguaccaguaccuuguguuca - 3' (length = 22)

Table 17.

Original and del 432 TTA (del.Y144) have the same miRNA and target score.

Target Rank	Target Score	miRNA Name
1	91	hsa-miR-196a-1-3p

Table 18.

Original 1841 A target miRNA score.

Target Rank	Target Score	miRNA Name
1	91	hsa-miR-4793-5p
2	64	hsa-miR-143-5p
3	56	hsa-miR-3133

Table 19.

1841A > G D614G showed a change in the sequence of the miRNA and increased in the target score from 90 to 91 on variable ss-RNA spike glycoprotein of SARS-COV-2 sequence from Jordanian samples.

Target Rank	Target Score	miRNA Name
1	92	hsa-miR-3620-3p
2	55	hsa-miR-3133
3	54	hsa-miR-21-3p

Table 20.

Original 3415G target miRNA score.

Target Rank	Target Score	miRNA Name
1	80	hsa-miR-548g-3p
2	72	hsa-miR-627-5p
3	61	hsa-miR-506-5p

Table 21.

3415G > T D1139Y showed the same the miRNA and increased the target score from 80 to 81 on variable ss-RNA spike glycoprotein of SARS-COV-2 sequence from Jordanian samples.

Target Rank	Target Score	miRNA Name
1	81	hsa-miR-548g-3p
2	72	hsa-miR-627-5p
3	61	hsa-miR-506-5p

Table 22.

Original 3499 G target miRNA score.

Target Rank	Target Score	miRNA Name
1	73	hsa-miR-155-5p
2	62	hsa-miR-6765-5p
3	53	hsa-miR-551b-5p

Table 23.

3499 G > A G1167S showed the same the miRNA and decreased the target score from 73 to 72 on the variable ss-RNA spike glycoprotein of SARS-COV-2 sequence from Jordanian samples.

Target Rank	Target Score	miRNA Name
1	72	hsa-miR-155-5p
2	62	hsa-miR-6765-5p
3	51	hsa-miR-668-3p

Table 24.

Predicted miRNAs targeting region on variable ss-RNA spike glycoprotein of SARS-COV-2 sequence from Jordanian samples.

Sample number with accision on GISAID	Sequence variation ss-RNA spike glycoprotein of SARS-COV-2 sequence	Single Amino Acid Variation	miRNAs targeting the submitted variation ss-RNA spike glycoprotein of SARS-COV-2 sequence
NCBI Reference Sequence: NC_045512.2	AATAACGCTACTAATGTTGTTATTAAATCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAAAAAACAACAAAAGTTGGATGGAAAGT	original	miRNA Name hsa-miR-196a-1-3p miRNA Sequence 5′ - caacaacauuaaaccacccga - 3' (length = 21)
Sample 23: hCoV-19/Jordan/SR-042/2020|EPI_ISL_430000|2020-03-30	AATAACGCTACTAATGTTGTTATTAAATCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTACCAAAAAACAACAAAAGTTGGATGGAAAGT	del 432 TTA del. Y144	miRNA Name hsa-miR-196a-1-3p miRNA Sequence 5′ - caacaacauuaaaccacccga - 3' (length = 21)
NCBI Reference Sequence: NC_045512.2	GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGT	Original 1841A	miRNA Name hsa-miR-4793-5p miRNA Sequence 5′ - acauccugcuccacagggcagagg - 3' (length = 24)
Sample 3,5,7,8,9,10,11,12,13,15,18,20 and21 Example: hCoV-19/Jordan/SR-036/2020|EPI_ISL_429996|2020-03-23	GGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGGTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGT	1841A > G D614G	miRNA Name hsa-miR-3620-3p Previous Name hsa-miR-3620 miRNA Sequence 5′ - ucacccugcaucccgcacccag - 3' (length = 22)
NCBI Reference Sequence: NC_045512.2	ACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACA	Original 3415G	miRNA Name hsa-miR-548g-3p Previous Name hsa-miR-548g miRNA Sequence 5′ - aaaacuguaauuacuuuuguac - 3' (length = 22)
Sample 21: hCoV-19/Jordan/SR-033/2020|EPI_ISL_429993|2020-03-16	ACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATTATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACA	3415G > T D1139Y	miRNA Name hsa-miR-548g-3p Previous Name hsa-miR-548g miRNA Sequence 5′ - aaaacuguaauuacuuuuguac - 3' (length = 22)
NCBI Reference Sequence: NC_045512.2	TCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATG	Original 3499 G	miRNA Name hsa-miR-155-5p Previous Name hsa-miR-155 miRNA Sequence 5′ - uuaaugcuaaucgugauagggguu - 3' (length = 24)
Sample 16: hCoV-19/Jordan/SR-039/2020|EPI_ISL_429998|2020-03-28	TCACCAGATGTTGATTTAAGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTGCCAAGAATTTAAATG	3499 G > A G1167S	miRNA Name hsa-miR-155-5p Previous Name hsa-miR-155 miRNA Sequence 5′ - uuaaugcuaaucgugauagggguu - 3' (length = 24)