Skip to main content
ACS Omega logoLink to ACS Omega
. 2020 Aug 5;5(32):20599–20608. doi: 10.1021/acsomega.0c02878

Zizyphus mauritiana Fruit Extract-Mediated Synthesized Silver/Silver Chloride Nanoparticles Retain Antimicrobial Activity and Induce Apoptosis in MCF-7 Cells through the Fas Pathway

Syed Rashel Kabir †,*, AKM Asaduzzaman †, Ruhul Amin ‡, ASM Tanbirul Haque §, Rita Ghose †, Md Musfikur Rahman †, Jahanur Islam †, Md Boni Amin †, Imtiaj Hasan †, Tapas Debnath ∥, Byung-Soo Chun §, XuDong Zhao ⊥, M Khalilur Rahman Khan #, Mohammad Taufiq Alam
PMCID: PMC7439699  PMID: 32832813

Abstract

graphic file with name ao0c02878_0010.jpg

Recently, green synthesis of silver/silver chloride nanoparticles (Ag/AgCl-NPs) has gained a lot of interest because of the usage of natural resources, rapidness, eco-friendliness, and benignancy. Several researchers reported that silver-based biogenic NPs have both antimicrobial and anticancer properties. In the present study, Ag/AgCl-NPs were synthesized from Zizyphus mauritiana fruit extract, and their antibacterial, antifungal, and antiproliferative mechanisms against human MCF-7 cell lines were evaluated. Synthesis of Ag/AgCl-NPs from the Z. mauritiana fruit extract was confirmed by the changes of color and a peak of the UV–visible spectrum at 428 nm. The nanoparticles were characterized by transmission electron microscopy, energy dispersive X-ray, X-ray powder diffraction, thermal gravimetric analysis, atomic force microscope, and Fourier transform infrared. Antibacterial activity was checked against four pathogenic bacteria and two fungi. Cytotoxicity was checked against human breast cancer cell line (MCF-7) and mice Ehrlich ascites carcinoma (EAC) cells by MTS assay and clonogenicity assay. Cell morphology of the control and nanoparticle-treated MCF-7 cells were checked by Hoechst 33342, YF488-Annexin V, and caspase-3 substrates. The level of reactive oxygen species (ROS) was studied by using 2′,7′-dichlorofluorescein-diacetate staining. Real-time polymerase chain reaction was used for gene expression. Synthesized nanoparticles were heat stable cubic crystals with an average size of 16 nm that contain silver and chlorine with various functional groups. The synthesized Ag/AgCl-NPs inhibited the growth of three pathogenic bacteria (Bacillus subtilis, Shigella boydii, and Escherichia coli) and two fungi (Aspergillus niger and Trichoderma spp.). Ag/AgCl-NPs inhibited the growth of MCF-7 and EAC cells with the IC50 values of 28 and 84 μg/mL, respectively. No colony was formed in MCF-7 cells in the presence of these nanoparticles as compared with control. Ag/AgCl-NPs induced apoptosis and generated ROS in MCF-7 cells. The expression level of FAS, FADD, and caspase-8 genes increased several folds with the decrease of PARP gene expression. These results demonstrated that the anti-proliferation activity of Ag/AgCl-NPs against MCF-7 cells resulted through ROS generation and induction of apoptosis through the Fas-mediated pathway.

Introduction

Cancer and microbial infections are serious problems worldwide. To solve these problems, researchers are trying to use nanoparticles in biomedical and pharmaceutical sectors as alternative anti-microbial and anti-cancer agents. Various metals, for example, silver, gold, and platinum, are being used for the preparation of effective nanoparticles. Recently, it was reported that silver has disinfecting nature and shows anticancer effects against different cancer cell lines.1,2 Synthesis of biogenic silver nanoparticles is a faster and cheaper process as compared with physical and chemical processes. Moreover, large-scale synthesis of nanoparticles is now possible without producing any toxic byproduct. For the synthesis of plant-mediated silver nanoparticles, different parts of plants, such as fruits, barks, roots, seeds, rhizomes, and leaves, are used, and the biomolecules such as proteins, enzymes, terpenoids, cofactors, and flavonoids present in the extract act as reducing and capping agents of silver in the nanoparticles.3−12 Different fruits were reported as sources of synthesized silver nanoparticles, but Zizyphus mauritiana fruit extract-mediated silver nanoparticles had not been reported in the literature so far.

Z. mauritiana Lam. is an important medicinal plant that belongs to the family of Rhamnaceae. Anticancer effects of different parts of Z. mauritiana against HeLa and MCF-7 cell line in vitro had been reported.13,14 Different varieties of Z. mauritiana are cultivated in different parts of Bangladesh among which BAU Kul was reported to contain polyphenols, flavonoids, tannin, steroids, saponin, triterpenoids, ascorbic acid, protein, alkaloids, glycosides, and reducing sugars.15−17 In this work, Ag/AgCl-NPs were biosynthesized by using Z. mauritiana fruit extract. The biogenic Ag/AgCl-NPs were characterized by UV–visible spectroscopy, X-ray powder diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy, energy dispersive X-ray (EDX), transmission electron microscopy (TEM), and atomic force microscopy (AFM), whereas thermal characterization was performed by thermal gravimetric analysis (TGA). Antibacterial and antifungal activities were checked against four pathogenic bacteria and two fungi. Cytotoxicity was checked against human breast cancer cell line (MCF-7) and mice Ehrlich ascites carcinoma (EAC) cells. The anticancer mechanism of Ag/AgCl-NPs against the MCF-7 cell was elucidated in the present investigation.

Results

Ag/AgCl-NP Synthesis and Morphological Characterization

AgNO3 was added at different concentrations to the Z. mauritiana fruit extract prepared with Tris-HCl, and the brown color was developed gradually with the increase of AgNO3 concentrations indicating the formation of Ag/AgCl-NPs, as shown in Figure 1A. The deepest brown color was monitored at 5 mM of AgNO3, and the maximum absorbance peak was measured at 428 nm (Figure 1A). Around 700 mg (7 mg/mL) of silver/silver chloride nanoparticles was obtained from 1 kg of fruits. Most of the solution was dried to perform various characterizations. Highly monodispersed and spherical particles were determined by TEM, and the average diameter was calculated to be around 16 nm, as presented in Figure 1B. The result of EDX analysis was shown in Figure 1C where strong signals for silver and chlorine ions were detected.

Figure 1.

Figure 1

Synthesis of Ag/AgCl-NPs by treating AgNO3, TEM, and EDX. (A) UV–visible spectra of the reaction mixture at different concentrations of AgNO3 during the synthesis of Z. mauritiana fruit extract-mediated Ag/AgCl-NPs. Inset: color formation after treatment of Z. mauritiana fruit extracts with 0 to 5 mM of AgNO3. (B) TEM micrograph showing the formation of Ag/AgCl-NPs by Z. mauritiana fruit extract. Inset: black solid bar indicates 50 nm. (C) Energy dispersive X-ray spectrum of Ag/AgCl-NPs.

Structural and Thermal Characterization of Ag/AgCl-NPs

The reflection peaks of the XRD pattern were at 27.88, 32.32, 46.28, 54.82, 57.54, and 67.42° corresponding to the crystallographic planes (111), (200), (220), (311), (222), and (400), respectively, which indicates the formation of AgCl-NPs (card no. 00-901-1666) formation. On the other hand, peaks at 38.21, 44.28, and 64.71° that correspond to the planes (111), (200), and (220), respectively, were designated for AgNPs (card no. 00-150-9146) (Figure 2A). The crystal systems for both cases were cubic. Three weight loss steps of Ag/AgCl-NPs depicted in the TGA plot/profile (Figure 2B) occurred in the temperature range from 30 to 100 °C, 101 to 718 °C and 719 to 843 °C corresponding to 3, 36.2, and 4.08% weight loss, respectively.

Figure 2.

Figure 2

(A) XRD pattern of Z. mauritiana fruit extract-mediated Ag/AgCl-NPs. (+) and (*) indicating Ag-NPs and Ag/AgCl-NPs, respectively. (B) TGA micrograph showing the weight loss of Ag/AgCl-NPs with temperature.

Surface Properties of Ag/AgCl-NPs

An atomic force microscope was used to determine the dimensions (including size, shape, and dispersion) of the nanoparticles. The presence of bright spots on the surface as found in AFM is indicating the presence of Ag/AgCl-NPs, and the inverse showed the dark spots indicating size and dispersion of the nanoparticles. The 3D image showed the sharp peaks with lower to higher sizes of nanoparticles (Figure 3).

Figure 3.

Figure 3

AFM topography of Z. mauritiana pulp extract-mediated Ag/AgCl-NPs. (A) View in 2-dimension and (B) 3-dimension.

Functional Characterization of Ag/AgCl-NPs

FTIR spectra of crude extract and synthesized nanoparticles are presented in Figure 4. The major peaks obtained for crude extract were at 3399.25, 2923.72, 1635.45, 1384.23, and 1077 cm–1, and major peaks obtained for synthesized Ag/AgCl-NPs were at 2921.24, 1614.35, 1384.48, and 1059.29 cm–1.

Figure 4.

Figure 4

FTIR spectrum of Z. mauritiana fruit extract- and fruit extract-mediated Ag/AgCl-NPs.

Bacterial Growth Inhibition

Bacterial growth inhibition was studied by the zone inhibition method, and results demonstrated that the growth inhibition of Bacillus subtilis, Shigella boydii and Escherichia coli were in dose-dependent manner as summarized in Table 1. Among four bacteria, B. subtilis was the most sensitive toward Ag/AgCl-NPs.

Table 1. Zone of Bacterial Growth Inhibition by Z. mauritiana Fruit Extract-Mediated Ag/AgCl-NPs.

  Ag/AgCl-NPs (μg/mL) streptomycin (unit)
  40 20 10 20
name of bacteria zone of bacterial growth inhibition (mm)
B. subtilis 14 13 9 18
S. enteritidis 8 8 8 12
S. boydii 10 9.5 8 16
E. coli 9 7.5 7 12

Antifungal Activity

Antifungal activities were checked against Aspergillus niger and Trichoderma spp. at the concentrations of 7.5, 15, 30, and 60 μg/mL of Ag/AgCl-NPs. A. niger growth was not affected at 7.5 μg/mL concentration of Ag/AgCl-NPs, whereas 9.6% growth of Trichoderma spp. was inhibited at the same concentration. Growth inhibition was increased with the rise of concentration of nanoparticles, and finally, 100% growth inhibition of Trichoderma spp. and A. niger growth inhibition was observed at a concentration of 30 and 60 μg/mL of Ag/AgCl-NPs, respectively, as shown in Figure 5.

Figure 5.

Figure 5

Antifungal activity of Ag/AgCl-NPs against Trichoderma spp. and A. niger.

Determination of Antiproliferative Activity by MTS Assay

To assess the cytotoxicity of Ag/AgCl-NPs and 5-fluorouracil against MCF-7 cell line, MTS assay was employed. Ag/AgCl-NPs and 5-fluorouracil induced the death of MCF-7 cells in a dose-dependent way, as shown in Figure 6A,B, and the IC50 value was 28 and 290 μg/mL, respectively. Ag/AgCl-NP-induced EAC cell death was in a dose-dependent manner, as shown in Figure 6C, and the IC50 value was calculated to be 84 μg/mL.

Figure 6.

Figure 6

MTS assay and colony formation assay. Effect of (A) synthesized Ag/AgCl-NPs and (B) 5-fluorouracil on MCF-7 cell line. Effect of (C) synthesized Ag/AgCl-NPs on EAC cells growth in vitro. In figure (D), “C” and “T” denoted colonies of MCF7 cells without Ag/AgCl-NPs and “T” no colony after treatment with Ag/AgCl-NPs, respectively. Inhibition ratios were measured by MTS assay (n = 3, mean ± S.D.).

Effects of Ag/AgCl-NPs on the Colony Formation of MCF-7 Cells

It was found that Ag/AgCl-NPs completely inhibited the formation of colonies of MCF-7 cells. After two weeks, 120 ± 20 colonies were counted in control wells, while Ag/AgCl-NP-treated wells were colony less (Figure 6D).

Induction of Apoptosis by Different Fluorometric Assays

Ag/AgCl-NP-treated and -untreated MCF-7 cells were labeled with YF488-Annexin V. Regular shape was observed for untreated MCF-7 cells (Figure 7A1) which was compared to the irregular shapes of treated cells, as shown in bright field microscopic images (Figure 7B1). Induction of apoptosis in Ag/AgCl-NP-treated cells were confirmed after incubation with annexin V (Figure 7B2), whereas no change was observed in control MCF-7 cells (Figure 7A2). Expression of caspase-3 in the MCF-7 cell was observed using a fluorescence microscope after staining with the FITC-labeled caspase-3 substrate. The substrate bound to caspase-3 and green color of FITC was clearly visible in the Ag/AgCl-NP-treated MCF-7 cells (Figure 7B3), whereas no expression was observed in control MCF-7 cells (Figure 7A3). The expression of caspase-3 might be an indication of apoptosis in the treated MCF-7 cells. Bright field microscopic images of untreated and treated MCF-7 after staining with Hoechst 33342 are shown in Figure 7A4,B4, respectively. Condensed nucleus was observed in Ag/AgCl-NP-treated cells after incubation with Hoechst 33342 (Figure 7B5). On the other hand, condensed nucleus was absent in control cells (Figure 7A5). Intracellular reactive oxygen species (ROS) generation was evaluated using the fluorescent probe dichlorodihydrofluorescein diacetate (DCFH-DA). After treatment of MCF-7 cells, ROS was generated, as shown in Figure 7B6. No ROS generation was observed in control MCF-7 cells (Figure 7A6).

Figure 7.

Figure 7

Induction of apoptosis by different fluorometric assays. Ag/AgCl-NPs untreated and treated MCF7 cells were represented by A and B, respectively. Number 1 and 2 showed bright field and fluorometric images after staining with YF488-Annexin V, respectively; number 3 represented images after staining with SuperView 488 caspase-3 substrate; 4 and 5 represented bright and fluorometric images, stained with Hoechst 33342 dye; and 6 represented images after incubating with DCFH-DA. The images were captured at 20× magnification.

Gene Expression

To observe the expression level of apoptosis-related genes, MCF-7 cells were treated with Z. mauritiana fruit extract-mediated Ag/AgCl-NPs for 48 h, RNAs were purified, cDNAs were synthesized, and finally expressions levels of eight genes were examined by real-time polymerase chain reaction (PCR). Human 18s gene was used as references to normalize the real time PCR data. Several folds increase in the expression of FAS, caspase-8, and FADD were observed, while the expression level of PARP was decreased (Figure 8). Expressions of BID, p53, MLKL, and TNFα genes were not observed in control cells and after treatment with nanoparticles (data not shown).

Figure 8.

Figure 8

Percentages of relative mRNA expression after treatment of MCF7 cells with Ag/AgCl-NPs. Dashed line indicates 1.0 expression level.

Discussion

In the present study, Z. mauritiana fruit extract-mediated Ag/AgCl-NPs was biologically synthesized that was preliminarily verified by the change of color from transparent to deep brown. The extract contains various biomolecules which reduced Ag+ to Ag0 causing the color change. Because of the surface plasmon resonance, the absorbance peak between 400 and 450 nm is another indicator for the formation of silver nanoparticles. The maximum absorbance peak was observed at 428 nm.

The size of nanoparticles was found to be highly monodispersed and spherical with an average diameter approximately of 16 nm as determined by TEM. Most of the plant-mediated Ag/AgCl-NPs were found to be spherical, and several nanoparticles were reported to be around the size of 16 nm.4 The EDX spectrum exhibited the presence of elemental silver and chlorine ions along with signals of carbon and copper from the carbon-coated copper (Cu) grid.18 Because of the binding of biomolecules to the surface of Ag/AgCl-NPs, weak signals were formed.19 The first weight loss (3%) that appeared within temperature 100 °C, indicated the removal of water, and the second and third weight loss (40.28%) suggested the elimination or decomposition of the capping biomolecules as observed by TGA.20 This result indicated that the synthesized nanoparticles possessed high thermal stability. Crystalline character of the synthesized nanoparticles was proved by XRD, and the presence of Ag ions in the form of silver chloride was also found. A peak of silver chloride (AgCl) in the biologically synthesized AgCl-NPs was also reported.21 During biosynthesis, chlorine ions of the Cissus quadrangularis Linn leaf extract reacted with AgNO3 to form AgCl-NPs.22 It was observed that the synthesis of AgCl-NPs from oligomeric chitosan was a two-step process where Ag ions reacted with Cl ions in the first step and then AgCl-NPs became stabilized with amino and hydroxyl groups.23 In the present study, silver ions reacted with chlorine ions of the Tris-HCl buffer to form AgCl and finally stabilized as AgCl-NPs with different materials of the extract.

Many researchers determined the size and shape of the nanoparticles by using the AFM image.24,25 In the present study, we were unable to determine the size of the single Ag/AgCl-NPs by using the AFM image because of the particle’s agglutinating nature on the glass surface, but we observed the topography of the agglutinated Ag/AgCl-NPs. Such type of agglutination is common and was previously reported by other researchers.26

Various functional groups those presented in the extract and also in the synthesized nanoparticles were determined by FTIR. The peaks at 3399.25 cm–1 might be due to the bending and stretching of hydrogen-bonded alcohols or phenols or −OH stretching of alcohols and phenols, or bending and stretching of hydrogen-bonded alcohols or phenols27 or could be due to the stretching of −OH in proteins, enzymes, or polysaccharides present in the extract.28 Peaks at 2923.72 and 2921.24 cm–1 were present because of the −H stretching of alkanes, whereas 1635.45 and 1614.35 for the bending vibration of the amide 1 group, 1384.23 and 1384.48 for N–O groups,29 and 1077.33 and 1059.29 cm–1 were present for the stretching of esters.27 The comparative analysis suggested that Z. mauritiana fruit extract and the Ag/AgCl-NPs shared certain common functional groups, and −OH groups were probably utilized in the reduction of Ag+ to Ag0.29

Antibacterial activities of green AgNPs was reported at a very low dose.4,30 AgNPs were found to be more effective toward Gram negative bacteria than Gram positive bacteria because of the presence of their thinner outer membrane, the peptidoglycan layer.29 In the present study, we have checked the antibacterial activities of the newly synthesized Ag/AgCl-NPs against pathogenic bacteria. The nanoparticles inhibited both Gram positive (B. subtilis) and Gram-negative bacteria (S. boydii and E. coli). Among the bacteria, B. subtilis (+) was the most sensitive. The result is different to that reported earlier.29 The mechanism of action of Ag/AgCl-NPs against different bacteria is still unknown. It has been reported that AgNPs cause the formation of pores/pits in the bacterial cell wall31,32 that might depend on their particle size. Smaller-sized nanoparticles on bacterial surfaces increase the permeability33 and bind the functional groups of DNA and proteins to destroy the cells.32 The synthesized nanoparticles were found less effective when compared to commercial antibiotics.

Although several experiments were done on antibacterial potential of green AgNPs against bacteria, only a few were reported against fungi. Turnip (Brassica rapa L.) leaf extract-mediated AgNPs inhibited the growth of wood-degrading fungi Gloeophyllum abietinum, Gloeophyllum trabeum, Chaetomium globosum, and Phanerochaete sordida.34 A AgNP-incorporated reverse osmosis membrane exhibited good antifungal activities against pathogenic fungal strains such as Candida tropicalis, Candida krusei, Candida glabrata, and Candida albicans.35 Antifungal activity against C. albicans was also reported for reishi mushroom (Ganoderma lucidum) extract-mediated silver nanoparticles.36 The silver nanoparticles prepared by the modified Tollens process also showed antifungal activities against pathogenic Candida sp.37 In our present study, we found that Ag/AgCl-NPs inhibited the growth of A. niger and Trichoderma spp. Mode of action of silver nanoparticles against C. albicans was reported by Kim et al.,38 and the results suggested that AgNPs exert antifungal activity by disrupting the structure of the cell membrane and inhibiting the normal budding process through the destruction of the membrane integrity.

Cancer is one of the main causes of death in the world, and more than 70% of total cancer deaths occur in Asia, America, and South and Central Africa.39 There are several kinds of cancer worldwide; one of the commonest and most frequent ones is the breast cancer which ranks fifth among the causes of death from cancers.40 Chemotherapy and radiotherapy are commonly used for the treatment of breast cancer. These treatment methods not only are costly but also have side effects on normal cells.41 Many natural resources have already been used as chemotherapeutic agents.42 Medicinal herbal extracts have been widely used in traditional medicine since a long time ago. Recently, several plant-mediated biogenic AgNPs demonstrated antiproliferative activity toward MCF-7 breast cancer cell line,43−47 but the mechanisms of their anti-cancer activity were reported only in a few literatures.47−53

The synthesized Ag/AgCl-NPs and 5-fluorouracil inhibited the proliferation of MCF-7 cell line with an IC50 value of 28 and 290 μg/mL. Cytotoxicity of Ag/AgCl-NPs was also checked against EAC cells, and the IC50 value was 84 μg/mL. These results indicated Ag/AgCl-NPs to be more effective against MCF-7 cell line compared to 5-fluorouracil. The cytotoxicity of AgNPs against MCF-7 cells was also reported in several articles.1,41,44,48,51,52,54 However, the long-term effect of Ag/AgCl-NPs on MCF-7 cell line was not reported. In the present study, the colony of MCF-7 cells was not observed in the synthesized Ag/AgCl-NP-treated wells after two weeks as compared with the non-treated wells. To find the molecular mechanism of the antiproliferative activity of Ag/AgCl-NPs, MCF-7 cells were stained with YF488-Annexin V. Treated cells exhibited the induction of apoptosis in MCF-7 cells which was also confirmed by monitoring of the binding of the SuperView 488 caspase-3 substrate inside the cells. This result was further verified by the staining with Hoechst 33342 where irregular shaped and condensed nuclei were observed. Induction of apoptosis in MCF-7 cell was reported by other scientists as well.48,50,55−57 Apoptosis is related with different cellular processes such as caspase up-regulation,58 ROS generation,59 and death-inducing signals.60 Several studies reported that cellular uptake of AgNPs leads to the generation of ROS in MCF-7 cells which provokes the oxidative stress causing apoptosis.1,47,50 ROS generation was also observed in this study after treatment of MCF-7 cells with DCFH-DA. Cytotoxicity of the AgNPs happened as the neutral silver (Ag0) transformed to Ag+, Ag–O and Ag–S which may cause production of ROS by chain effect.50 Our study revealed that the synthesized Ag/AgCl-NPs were capable of inducing cytosolic oxidative stresses and promoting cell death.

A group of genes are related to mitochondrial and death receptor pathways of cell signaling involved in apoptosis. These genes can be grouped as pro-apoptotic and anti-apoptotic. The pro-apoptotic genes include FAS, caspases, BAX and so forth, and anti-apoptotic genes include Bcl-2, Bcl-X, PARP, and so forth. After checking the expressions of eight such genes, no expression was observed for BID, p53, MLKL, and TNFα genes. Our results clearly demonstrated that Ag/AgCl-NPs activated death receptor FAS on the cell surface. As a result, the expression level of FADD known as FAS-associated protein with the death domain had also been increased causing the activation of caspase-3 through the caspase-8. In this investigation, Hoechst 33342 staining of the treated cells confirmed the damage of DNA. PARP plays a role for the repair of damaged DNA, while caspase-3 mediates the cleavage of PARP. Here, the expression level of DNA repairing protein PARP became decreased because of the over expression of caspase-3. As a result, apoptosis was induced in MCF-7 cell. From the above discussion, it can be hypothesized that FAS was possibly activated by Ag/AgCl-NPs that consequently activated caspase-3 via the activation of FADD and caspase-8. Up-regulation of the above genes along with the down regulation of PARP and ROS generation caused apoptotic cell death in MCF-7 cells (pictorially represented in Figure 9). Previously, it was reported that Achillea Biebersteinii extract-mediated AgNPs inhibited the growth of MCF-7 cells via caspase activation and regulation of Bax and Bcl-2 gene expression,48 and R. fairholmiamus extract-mediated AgNPs induced apoptosis in MCF-7 cells through the mitochondria-mediated intrinsic pathway.50 Our present study reported that biogenic Ag/AgCl-NPs inhibited MCF-7 cell line by the induction of apoptosis, possibly in the FAS-mediated pathway.

Figure 9.

Figure 9

Pictorial representation of synthesized Ag/AgCl-NP-induced apoptosis in MCF-7 cells.

Conclusions

Applying eco-friendly and rapid strategies such as using fruit extracts as reducing and stabilizing agents to synthesize metal-based nanoparticles is becoming usual day by day. In the present study, Ag/AgCl-NPs were synthesized from the extract of Z. mauritiana fruit and characterized by a number of spectroscopic methods. The nanoparticles showed marked antibacterial and antifungal activities against four pathogenic bacteria and two fungi, respectively. Growth of human (MCF-7) and mice (EAC) cancer cells also became inhibited by these nanoparticles. Mechanism of this growth inhibitory activity of the synthesized biogenic Ag/AgCl-NPs against MCF-7 cancer cells is being reported for the first time, and it became evident that it occurs through the induction of apoptosis possibly in the FAS-mediated pathway. The biogenic Ag/AgCl-NPs can be effective for the breast cancer treatment though further research is required to find out its efficacy and adverse reaction. The structure–activity relationship of these nanoparticles should also be studied in future to check their potential as anticancer drugs.

Materials and Methods

Chemicals and Reagents

Hoechst 33342 and 5-fluorouracil were purchased from Sigma (USA). Dulbecco’s modified Eagle’s medium (DMEM) was purchased from Gibco; fetal bovine serum (FBS) and Tripsin-EDTA were purchased from HiClone (USA); Tris-HCl and silver nitrate were purchased from Carl Roth (Germany); YF488-Annexin V and SuperView 488 caspase-3 substrate were purchased from ABM (Canada). Streptomycin and neomycin were purchased from Amresco, RNA isolation kit was purchased from Tiangen (China), and CYBR green master mix was purchased from Applied Biosystem (USA), Primers were purchased from TsingKe Biological Technology, China.

Sample Preparation

BAU Kul (Z. mauritiana Lamk) was bought from the local market (Voucher specimen number 22 identified by Prof. A. H. M. Mahbubur Rahman, Dept. of Botany, University of Rajshahi, Bangladesh) and washed by deionized water, slashed into small pieces, homogenized with deionized water at 1:5 ratios (w/v), and centrifuged at 10,000g for 20 min. The supernatant (around pH 4.6) was collected, and pH was adjusted around 7.0 by the addition of Tris-HCL (10–20 mM). Finally, it was centrifuged again at 10,000g for 10 min, and supernatant was collected and subsequently used for silver/silver chloride nanoparticle synthesis.

Silver Nanoparticles Synthesis and UV–visible Spectra Analysis

Z. mauritiana supernatant was taken in 4 test tubes (2 mL/tube), and 1 M of silver nitrate was added to the clear supernatant to make final concentrations of 2, 3, 4, and 5 mM and kept in the sunlight for around 2 h and then subjected to UV–visible spectroscopic analysis (Hitachi U-1800, Japan) at the wavelength range from 250 to 700 nm. The best result was obtained in the presence of 5 mM of silver nitrate. For the synthesis of nanoparticles in large scale, 1 M silver nitrate was added to 500 mL of Z. mauritiana clear supernatant to the final concentration of 5 mM and kept at sunlight for 2 h and then centrifuged at 10,000g for 30 min at 4 °C. Afterward, the pellet was rinsed three times by using deionized water and a part of the colloidal nanoparticles was lyophilized for the purpose of concentration measurement, TEM, TGA, FTIR, AFM, and XRD analysis. Rest of the colloidal solution was used for biological application. About 1.5 kg of fruit was used for the synthesis of nanoparticles.

Characterization of Ag/AgCl-NPs

TEM (2100F, JEOL, Japan) was utilized for the morphological analysis (size and shape) of the synthesized nanoparticles. At first, nanoparticles were dropped in the carbon-coated copper (Cu) grid, then dried in air, and finally, TEM observation was carried out with an accelerating voltage of 80 kV. Elemental analysis was carried out using an EDX spectrometer equipped with TEM.

Ultima IV (Rigaku, Japan) X-ray diffractometer with Cu Kα1 radiation was operated at 40 kV and 40 mA at a 2θ angle pattern which was used for the XRD analysis of the synthesized Ag/AgCl-NPs. Data were analyzed by using QualX2 software.

Thermal analysis of Ag/AgCl-NPs was measured by using TGA (PerkinElmer STA 8000, USA) at a heating rate of 10 °C/min under a nitrogen atmosphere.

Liquid/colloidal Ag/AgCl-NPs was taken in a glass slide and dried in air. Then surface properties and size of the synthesized silver nanoparticles were analyzed using an atomic force microscope (AFM, Park system XE 70, Korea) where titanium coated nitrate tips were in tapping mode.

Lyophilized Ag/AgCl-NPs and crude extracts were mixed (1:100) with potassium bromide (KBr), and FTIR (PerkinElmer, Spectrum 100, USA) spectroscopic measurements were performed at the frequency range from 4000 to 225 cm–1, with a resolution of 1 cm–1.

Antibacterial Assay by Disc Diffusion Methods

Disc diffusion method was used to determine the antibacterial activities of the synthesized Ag/AgCl-NPs. B. subtilis, S. boydii, E. coli, and Salmonella enteritidis were used for this experiment. Ag/AgCl-NPs (10–40 μg/mL) and streptomycin (20 unit) applied on the paper disc with 5 mm in diameter were placed at the sterilized solidified nutrient agar plate where bacterial suspension was previously spread out. After incubation at 37 °C for 24 h, the diameter of each inhibitory zone (mm) was measured.

Determination of Antifungal Activity by MTT Assay

Antifungal activity was checked by MTT colorimetric assay by using RPMI-1640 media as described by Kabir et al.(61)A. niger and Trichoderma spp. (8 × 105 cells) were plated in the 96-well flat bottom culture plates containing serially diluted Ag/AgCl-NPs (7.5–60 μg/mL) and without nanoparticles in 100 μL of RPMI-1640 media. Then, the cells were incubated for 24 h at 32 °C, and MTT assay was performed.

Cell Culture

DMEM medium with 10% FBS, neomycin, and streptomycin in a 25 cm2 cell culture flask was used for the culture of MCF-7 cells at 37 °C in 5% CO2 incubator, and sub-cultures were carried out at 80–90% confluence.

Antiproliferative Activity of Ag/AgCl-NPs by MTS Assay

MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS(a)] colorimetric assay was carried out according to the manufacturer’s guideline (Promega, USA) to detect proliferation of MCF-7 cells. Briefly, 1 × 104 MCF-7 cells in 150 μL of DMEM medium were seeded in each well of the 96-well flat-bottom culture plate and incubated at 37 °C in a CO2 incubator for 24 h. Then, serially diluted Ag/AgCl-NPs and 5-fluorouracil in 50 μL of DMEM medium were added to each well of the culture plate to a final concentration of 8–32 and 40–320 μg/mL, respectively, and incubated at 37 °C in a CO2 incubator for 48 h. EAC cells were collected from mice, and around 1 × 105 EAC cells in DMEM media were seeded in each well of another 96 well cell culture plate and incubated at 37 °C in a CO2 incubator for 24 h. Wells containing only MCF-7 and EAC cells without Ag/AgCl-NPs were used as controls. Then, aliquot of each well was removed, and 100 μL of DMEM medium was added. After that, 10 μL of MTS with phenazine ethosulfate was added to each well and incubated for 2 h. Finally, a micro plate reader with 490 nm filter was used for measuring the absorbance. Three wells were employed for each concentration, and by the following equation, cell proliferation inhibition was estimated

graphic file with name ao0c02878_m001.jpg

where A and B designates OD490 nm of the cellular homogenate (control) without Ag/AgCl-NPs and with Ag/AgCl-NPs, respectively.

Colony Formation Assay

To determine of the effect of Ag/AgCl-NPs on the colony formation, around 1.6 × 103 MCF-7 cells were seeded in each well of the 6-well cell culture plate with complete DMEM medium. After 24 h, three wells of cells were treated with 28 μg/mL of Ag/AgCl-NPs and the remaining three wells were kept as controls. The cells were kept in the CO2 incubator at 37 °C to grow and form colonies. Visible colonies were observed two weeks later, and then, the wells were washed by phosphate buffered saline (PBS). Afterward, fixation of cells was performed with 70% cold ethanol for 15 min and stained by incubation with 0.5% crystal violet at 25 °C for 2 h and washed with water. Finally, images were captured after air-drying the wells, and the numbers of colonies were counted.

Observation of Morphologic Changes of MCF-7 Cells by YF488-Annexin V

After treating MCF-7 cells with 28 μg/mL of Ag/AgCl-NPs in a 96-well cell culture plate as described above, cells were incubated with YF488-Annexin V according to the instruction of the producer (US Ever Bright). Finally, a fluorescence microscope (Olympus iX71, Korea) was used to observe the morphological changes of the cells following a method as described by Kabir et al.(62)

Study of Cell Nuclei Change by Hoachst-33342 Staining

Around 10,000 MCF-7 cells were seeded in each well of a 96-well cell culture plate and then treated with 28 μg/mL concentration of Ag/AgCl-NPs for 48 h as described above. After that, cells were rinsed with PBS and stained with Hoechst 33342 according to Kabir et al.(63) Finally, cell morphology was observed under both dark and bright field using a fluorescence microscope.

Observation of Changes of the ROS

Changes of the ROS level in the MCF-7 cells after treatment with 28 μg/mL of Ag/AgCl-NPs were detected by using 2′,7′-dichlorofluorescein-diacetate (DCFH-DA) staining. Cells were cultured in a 96-well plate and treated with Ag/AgCl-NPs for 48 h as described above. Cells were washed once by the serum free medium and incubated with diluted DCFH-DA (1:1000) at 37 °C for 20 min, and finally, cells were examined by a fluorescence microscope.

Detection of Caspase-3 Expression

For the detection of caspase-3 expression, MCF-7 cells were cultured in 96-wells plate and treated with 28 μg/mL concentration of the synthesized Ag/AgCl-NPs for 48 h as described above and the treated and untreated MCF-7 cells was incubated with US Ever Bright super view-488 caspase-3 substrate for 30 min according to the manufacturer’s instructions. Finally, morphological alteration of the cells was viewed using a fluorescence microscope as described by Kabir et al.(62)

Expression of Apoptosis-Related Genes by Real Time PCR

For the isolation of RNA, MCF-7 cells were seeded (16 × 104/well) in a 6-well cell culture plate and treated with 28 μg/mL concentration of Ag/AgCl-NPs, and MCF-7 cells seeded without Ag/AgCl-NPs were used as control. After incubation for 48 h, the medium was removed, cells were washed by PBS and dissolved with RZ buffer, and RNA was isolated according to the manufacturer’s guideline (Tiangen, China). cDNA was synthesized from an equal amount of RNA by reverse transcriptase enzyme as described by the manufacturer (ABM, Canada). Reaction mixture for real time PCR was prepared by the addition of cDNA, forward and reverses primers mentioned in Table 2, water, and 2× SYBR green master mix, which was used as described by the manufacturer (Applied Biosystems). Bio Rad thermo cycler (CFX96) was used for gene expression. The PCR condition was set to 50 °C for 2 min and 95 °C for 2 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Finally, real time PCR data were analyzed by double delta CT methods using Excel software.

Table 2. List of Primers.

FAS F AGCTTGGTCTAGAGTGAAAA
  R GAGGCAGAATCATGAGATAT
TNFα F CTTCTCCTTCCTGATCGTGG
  R GCTGGTTATCTCTCAGCTCCA
18s F GTAACCCGTTGAACCCCATT
  R CCATCCAATCGGTAGTAGCG
p53 F GCCCAACAACACCAGCTCCT
  R CCTGGGCATCCTTGAGTTCC
PARP F GGCCTCGGTGGATGGAATG
  R GCAAACTAACCCGGATAGTCTCT
BID F AGCGCAAACTTAGCCTGTCTG
  R TCCGGGATGGTGAGATCCTTC
MLKL F TTAGGCCAGCTCATCTATGAACA
  R TGCACACGGTTTCCTAGACG
caspase-8 F ACACAGTCGAGTAGACTCTCAAA
  R AGGAAGTGATGCTCGTTCAGA
FADD F GCTGGCTCGTCAGCTCAAA
  R ACTGTTGCGTTCTCCTTCTCT

Statistical Analysis

Results were expressed as the mean ± S.D. (standard deviation). For the calculation of data, one way ANOVA of the SPSS software (version 16) was used.

Acknowledgments

Authors acknowledge the support of Ministry of Science and Technology, Bangladesh for funding (grant nos: 39.009.002.01.00.057.2015-2016/922/Phys-362) this research work.

Author Contributions

A.A. and A.T.H. responsible for TEM and EDX related data and B.-S.C. provided lab facilities; A.A. also helped FTIR related work; M.M.R. and J.I. synthesized silver nanoparticles; R.A. supported the first author for cell culture; T.D. and M.K.R.K. helped first author for the XRD related works; M.T.A. supported the first author for the real time PCR instrumental facility; X.Z. provided MCF-7 cell line; M.B.A., R.G. and I.H. provided technical supports; first author did rest of the works and wrote the manuscript.

The authors declare no competing financial interest.

References

  1. Erdogan O.; Abbak M.; Len G.; Demirbolat M.; Id F. B.; Aksel Id M.; Pasa Id S.; Cevik Id O. Green Synthesis of Silver Nanoparticles via Cynara scolymus Leaf Extracts: The Characterization, Anticancer Potential with Photodynamic Therapy in MCF7 Cells. PLoS One 2019, 14, e0216496. 10.1371/journal.pone.0216496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bhatnagar S.; Kobori T.; Ganesh D.; Ogawa K.; Aoyagi H. Biosynthesis of Silver Nanoparticles Mediated by Extracellular Pigment from Talaromyces purpurogenus and Their Biomedical Applications. Nanomaterials 2019, 9, 1042. 10.3390/nano9071042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ahmed K. B. A.; Senthilnathan R.; Megarajan S.; Anbazhagan V. Sunlight Mediated Synthesis of Silver Nanoparticles Using Redox phytoprotein and Their Application in Catalysis and Colorimetric Mercury Sensing. J. Photochem. Photobiol., B 2015, 151, 39–45. 10.1016/j.jphotobiol.2015.07.003. [DOI] [PubMed] [Google Scholar]
  4. Ahmed S.; Ahmad M.; Swami B. L.; Ikram S. A Review on Plants Extract Mediated Synthesis of Silver Nanoparticles for Antimicrobial Applications: A Green Expertise. J. Adv. Res. 2016, 7, 17–28. 10.1016/j.jare.2015.02.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Vasanth K.; Ilango K.; MohanKumar R.; Agrawal A.; Dubey G. P. Anticancer Activity of Moringa oleifera Mediated Silver Nanoparticles on Human Cervical Carcinoma Cells by Apoptosis Induction. Colloids Surf., B 2014, 117, 354–359. 10.1016/j.colsurfb.2014.02.052. [DOI] [PubMed] [Google Scholar]
  6. Kaviya S.; Santhanalakshmi J.; Viswanathan B.; Muthumary J.; Srinivasan K. Biosynthesis of Silver Nanoparticles Using Citrus sinensis Peel Extract and Its Antibacterial Activity. Spectrochim. Acta, Part A 2011, 79, 594–598. 10.1016/j.saa.2011.03.040. [DOI] [PubMed] [Google Scholar]
  7. Krishnaraj C.; Jagan E. G.; Rajasekar S.; Selvakumar P.; Kalaichelvan P. T.; Mohan N. Synthesis of Silver Nanoparticles Using Acalypha indica Leaf Extracts and Its Antibacterial Activity against Water Borne Pathogens. Colloids Surf., B 2010, 76, 50–56. 10.1016/j.colsurfb.2009.10.008. [DOI] [PubMed] [Google Scholar]
  8. Nabikhan A.; Kandasamy K.; Raj A.; Alikunhi N. M. Synthesis of Antimicrobial Silver Nanoparticles by Callus and Leaf Extracts from Saltmarsh Plant, Sesuvium portulacastrum L. Colloids Surf., B 2010, 79, 488–493. 10.1016/j.colsurfb.2010.05.018. [DOI] [PubMed] [Google Scholar]
  9. Nakkala J. R.; Mata R.; Gupta A. K.; Sadras S. R. Biological Activities of Green Silver Nanoparticles Synthesized with Acorous calamus Rhizome Extract. Eur. J. Med. Chem. 2014, 85, 784–794. 10.1016/j.ejmech.2014.08.024. [DOI] [PubMed] [Google Scholar]
  10. Zargar M.; Hamid A. A.; Bakar F. A.; Shamsudin M. N.; Shameli K.; Jahanshiri F.; Farahani F. Molecules Green Synthesis and Antibacterial Effect of Silver Nanoparticles Using Vitex negundo L. Molecules 2011, 16, 6667–6676. 10.3390/molecules16086667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Nesrin K.; Yusuf C.; Ahmet K.; Ali S.; Muhammad A.; Suna S.; Fatih Ş. Biogenic Silver Nanoparticles Synthesized from Rhododendron ponticum and Their Antibacterial, Antibiofilm and Cytotoxic Activities. J. Pharm. Biomed. Anal. 2020, 179, 112993. 10.1016/j.jpba.2019.112993. [DOI] [PubMed] [Google Scholar]
  12. Aygün A.; Gülbağça F.; Nas M.; Alma M.; Çalımlı M.; Ustaoglu B.; Altunoglu Y.; Baloğlu M.; Cellat K.; Şen F. Biological Synthesis of Silver Nanoparticles Using Rheum Ribes and Evaluation of Their Anticarcinogenic and Antimicrobial Potential: A Novel Approach in Phytonanotechnology. J. Pharm. Biomed. Anal. 2020, 179, 113012. 10.1016/j.jpba.2019.113012. [DOI] [PubMed] [Google Scholar]
  13. Beg M. A.; Teotia U.; Farooq S. In Vitro Antibacterial and Anticancer Activity of Ziziphus. J. Med. Plants Stud. 2016, 4, 230–233. [Google Scholar]
  14. Batool M.; Afzal S.; Afzal K.; Ahmed B.; Abbas K.; Muhammad S. A.; Qadir M. I. Anticancer Activity of Ziziphus mauritiana Roots against Human Breast Cancer Cell Line. Pak. J. Pharm. Sci. 2019, 32, 1715–1716. [PubMed] [Google Scholar]
  15. Najafi S. Phytochemical Screening and Antibacterial Activity of Leaf Extract of Ziziphus mauritiana Lam. Int. Res. J. Appl. Basic Sci. 2013, 4, 3274–3276. [Google Scholar]
  16. Das S. Antimicrobial and Antioxidant Activities of Green and Ripe Fruits of Averrhoa Carambola Linn. and Zizyphus mauritiana Lam. Asian J. Pharm. Clin. Res. 2012, 5, 102–105. [Google Scholar]
  17. Tanvir E. M.; Afroz R.; Karim N.; Mottalib M. A.; Hossain M. I.; Islam M. A.; Gan S. H.; Khalil M. I. Antioxidant and Antibacterial Activities of Methanolic Extract of BAU Kul (Ziziphus mauritiana), an Improved Variety of Fruit from Bangladesh. J. Food Biochem. 2015, 39, 139–147. 10.1111/jfbc.12109. [DOI] [Google Scholar]
  18. Mollick M. M. R.; Rana D.; Dash S. K.; Chattopadhyay S.; Bhowmick B.; Maity D.; Mondal D.; Pattanayak S.; Roy S.; Chakraborty M.; Chattopadhyay D. Studies on Green Synthesized Silver Nanoparticles Using Abelmoschus esculentus (L.) Pulp Extract Having Anticancer (in Vitro) and Antimicrobial Applications. Arab. J. Chem. 2019, 12, 2572–2584. 10.1016/j.arabjc.2015.04.033. [DOI] [Google Scholar]
  19. M C. R.; K S. R. M.; A S.; Sambasiva R. K. S.; T P. Phytosynthesis of Eco-Friendly Silver Nanoparticles and Biological Applications–A Novel Concept in Nanobiotechnology. Afr. J. Biotechnol. 2015, 14, 222–247. 10.5897/ajb2013.13299. [DOI] [Google Scholar]
  20. Ali I.; Peng C.; Lin D.; Naz I. Green Synthesis of the Innovative Super Paramagnetic Nanoparticles from the Leaves Extract of Fraxinus chinensis Roxb and Their Application for the Decolourisation of Toxic Dyes. Green Process. Synth. 2019, 8, 256–271. 10.1515/gps-2018-0078. [DOI] [Google Scholar]
  21. Kota S.; Dumpala P.; Anantha R. K.; Verma M. K.; Kandepu S. Evaluation of Therapeutic Potential of the Silver/Silver Chloride Nanoparticles Synthesized with the Aqueous Leaf Extract of Rumex acetosa. Sci. Rep. 2017, 7, 11566. 10.1038/s41598-017-11853-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gopinath V.; Priyadarshini S.; Meera Priyadharsshini N.; Pandian K.; Velusamy P. Biogenic Synthesis of Antibacterial Silver Chloride Nanoparticles Using Leaf Extracts of Cissus quadrangularis Linn. Mater. Lett. 2013, 91, 224–227. 10.1016/j.matlet.2012.09.102. [DOI] [Google Scholar]
  23. Kang Y.; Jung J. Y.; Cho D.; Kwon O. H.; Cheon J. Y.; Park W. H. Antimicrobial Silver Chloride Nanoparticles Stabilized with Chitosan Oligomer for the Healing of Burns. Materials 2016, 9, 215. 10.3390/ma9040215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Yuvarajan R.; Natarajan D.; Ragavendran C.; Jayavel R. Photoscopic Characterization of Green Synthesized Silver Nanoparticles from Trichosanthes tricuspidata and Its Antibacterial Potential. J. Photochem. Photobiol., B 2015, 149, 300–307. 10.1016/j.jphotobiol.2015.04.032. [DOI] [PubMed] [Google Scholar]
  25. Gopinath K.; Gowri S.; Arumugam A. Phytosynthesis of Silver Nanoparticles Using Pterocarpus santalinus Leaf Extract and Their Antibacterial Properties. J. Nanostruct. Chem. 2013, 3, 68. 10.1186/2193-8865-3-68. [DOI] [Google Scholar]
  26. Karthick V.; Kumar V. G.; Dhas T. S.; Govindaraju K.; Sinha S.; Singaravelu G. Biosynthesis of Gold Nanoparticles and Identification of Capping Agent Using Gas Chromatography-Mass Spectrometry and Matrix Assisted Laser Desorption Ionization-Mass Spectrometry. J. Nanosci. Nanotechnol. 2015, 15, 4052–4057. 10.1166/jnn.2015.9157. [DOI] [PubMed] [Google Scholar]
  27. Raja S.; Ramesh V.; Thivaharan V. Green Biosynthesis of Silver Nanoparticles Using Calliandra haematocephala Leaf Extract, Their Antibacterial Activity and Hydrogen Peroxide Sensing Capability. Arab. J. Chem. 2017, 10, 253–261. 10.1016/j.arabjc.2015.06.023. [DOI] [Google Scholar]
  28. Shanmugam N.; Rajkamal P.; Cholan S.; Kannadasan N.; Sathishkumar K.; Viruthagiri G.; Sundaramanickam A. Biosynthesis of Silver Nanoparticles from the Marine Seaweed Sargassum wightii and Their Antibacterial Activity against Some Human Pathogens. Appl. Nanosci. 2014, 4, 881–888. 10.1007/s13204-013-0271-4. [DOI] [Google Scholar]
  29. Singh G.; Babele P. K.; Shahi S. K.; Sinha R. P.; Tyagi M. B.; Kumar A. Green Synthesis of Silver Nanoparticles Using Cell Extracts of Anabaena doliolum and Screening of Its Antibacterial and Antitumor Activity. J. Microbiol. Biotechnol. 2014, 24, 1354–1367. 10.4014/jmb.1405.05003. [DOI] [PubMed] [Google Scholar]
  30. Göl F.; Aygün A.; Seyrankaya A.; Gür T.; Yenikaya C.; Şen F. Green Synthesis and Characterization of Camellia sinensis Mediated Silver Nanoparticles for Antibacterial Ceramic Applications. Mater. Chem. Phys. 2020, 250, 123037. 10.1016/j.matchemphys.2020.123037. [DOI] [Google Scholar]
  31. Kalpana D.; Han J. H.; Park W. S.; Lee S. M.; Wahab R.; Lee Y. S. Green Biosynthesis of Silver Nanoparticles Using Torreya nucifera and Their Antibacterial Activity. Arab. J. Chem. 2019, 12, 1722–1732. 10.1016/j.arabjc.2014.08.016. [DOI] [Google Scholar]
  32. Sharma V. K.; Yngard R. A.; Lin Y. Silver Nanoparticles: Green Synthesis and Their Antimicrobial Activities. Adv. Colloid Interface Sci. 2009, 145, 83–96. 10.1016/j.cis.2008.09.002. [DOI] [PubMed] [Google Scholar]
  33. Feng Q. L.; Wu J.; Chen G. Q.; Cui F. Z.; Kim T. N.; Kim J. O. A Mechanistic Study of the Antibacterial Effect of Silver Ions on Escherichia Coli and Staphylococcus Aureus. J. Biomed. Mater. Res. 2000, 52, 662–668. 10.1002/1097-4636(20001215)52:4<662::aid-jbm10>3.0.co;2-3. [DOI] [PubMed] [Google Scholar]
  34. Narayanan K. B.; Park H. H. Antifungal Activity of Silver Nanoparticles Synthesized Using Turnip Leaf Extract (Brassica rapa L.) against Wood Rotting Pathogens. Eur. J. Plant Pathol. 2014, 140, 185–192. 10.1007/s10658-014-0399-4. [DOI] [Google Scholar]
  35. Manjumeena R.; Duraibabu D.; Sudha J.; Kalaichelvan P. T. Biogenic Nanosilver Incorporated Reverse Osmosis Membrane for Antibacterial and Antifungal Activities against Selected Pathogenic Strains: An Enhanced Eco-Friendly Water Disinfection Approach. J. Environ. Sci. Health, Part A: Toxic/Hazard. Subst. Environ. Eng. 2014, 49, 1125–1133. 10.1080/10934529.2014.897149. [DOI] [PubMed] [Google Scholar]
  36. Aygün A.; Özdemir S.; Gülcan M.; Cellat K.; Şen F. Synthesis and Characterization of Reishi Mushroom-Mediated Green Synthesis of Silver Nanoparticles for the Biochemical Applications. J. Pharm. Biomed. Anal. 2020, 178, 112970. 10.1016/j.jpba.2019.112970. [DOI] [PubMed] [Google Scholar]
  37. Panácek A.; Kolár M.; Vecerová R.; Prucek R.; Soukupová J.; Krystof V.; Hamal P.; Zboril R.; Kvítek L. Antifungal Activity of Silver Nanoparticles against Candida Spp.. Biomaterials 2009, 30, 6333–6340. 10.1016/j.biomaterials.2009.07.065. [DOI] [PubMed] [Google Scholar]
  38. Kim K.-J.; Sung W. S.; Suh B. K.; Moon S.-K.; Choi J.-S.; Kim J. G.; Lee D. G. Antifungal Activity and Mode of Action of Silver Nano-Particles on Candida albicans. BioMetals 2009, 22, 235–242. 10.1007/s10534-008-9159-2. [DOI] [PubMed] [Google Scholar]
  39. Stewart B. W.; Wild C. P.. International Agency for Research on Cancer; WHO, World Cancer Report 2014, 2014.
  40. Ferlay J.; Soerjomataram I.; Dikshit R.; Eser S.; Mathers C.; Rebelo M.; Parkin D. M.; Forman D.; Bray F. Cancer Incidence and Mortality Worldwide: Sources, Methods and Major Patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. 10.1002/ijc.29210. [DOI] [PubMed] [Google Scholar]
  41. Jang S. J.; Yang I. J.; Tettey C. O.; Kim K. M.; Shin H. M. In-Vitro Anticancer Activity of Green Synthesized Silver Nanoparticles on MCF-7 Human Breast Cancer Cells. Mater. Sci. Eng., C 2016, 68, 430–435. 10.1016/j.msec.2016.03.101. [DOI] [PubMed] [Google Scholar]
  42. Cragg G. M.; Boyd M. R.; Khanna R.; Newman D. J.; Sausville E. A.. Natural Product Drug Discovery and Development. Phytochemicals in Human Health Protection, Nutrition, and Plant Defense; Springer: US, 1999; pp 1–29 [Google Scholar]
  43. Rasheed T.; Bilal M.; Iqbal H. M. N.; Li C. Green Biosynthesis of Silver Nanoparticles Using Leaves Extract of Artemisia vulgaris and Their Potential Biomedical Applications. Colloids Surf., B 2017, 158, 408–415. 10.1016/j.colsurfb.2017.07.020. [DOI] [PubMed] [Google Scholar]
  44. Rasheed T.; Bilal M.; Li C.; Iqbal H. M. N. Biomedical Potentialities of Taraxacum officinale-Based Nanoparticles Biosynthesized Using Methanolic Leaf Extract. Curr. Pharm. Biotechnol. 2017, 18, 1116–1123. 10.2174/1389201019666180214145421. [DOI] [PubMed] [Google Scholar]
  45. Kelkawi A. H. A.; Abbasi Kajani A.; Bordbar A.-K. Green Synthesis of Silver Nanoparticles Using Mentha pulegium and Investigation of Their Antibacterial, Antifungal and Anticancer Activity. IET Nanobiotechnol. 2017, 11, 370–376. 10.1049/iet-nbt.2016.0103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Iqbal M. J.; Ali S.; Rashid U.; Kamran M.; Malik M. F.; Sughra K.; Zeeshan N.; Afroz A.; Saleem J.; Saghir M. Biosynthesis of Silver Nanoparticles from Leaf Extract of Litchi chinensis and Its Dynamic Biological Impact on Microbial Cells and Human Cancer Cell Lines. Cell. Mol. Biol. 2018, 64, 42–47. 10.14715/cmb/2018.64.13.9. [DOI] [PubMed] [Google Scholar]
  47. Barabadi H.; Mahjoub M. A.; Tajani B.; Ahmadi A.; Junejo Y.; Saravanan M. Emerging Theranostic Biogenic Silver Nanomaterials for Breast Cancer: A Systematic Review. J. Cluster Sci. 2019, 30, 259–279. 10.1007/s10876-018-01491-7. [DOI] [Google Scholar]
  48. Baharara J.; Namvar F.; Ramezani T.; Mousavi M.; Mohamad R. Silver Nanoparticles Biosynthesized Using Achillea biebersteinii Flower Extract: Apoptosis Induction in MCF-7 Cells via Caspase Activation and Regulation of Bax and Bcl-2 Gene Expression. Molecules 2015, 20, 2693–2706. 10.3390/molecules20022693. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Çiftçi H.; Türk M.; Tamer U.; Karahan S.; Menemen Y. Silver Nanoparticles: Cytotoxic, Apoptotic, and Necrotic Effects on MCF-7 Cells. Turk. J. Biol. 2013, 37, 573–581. 10.3906/biy-1302-21. [DOI] [Google Scholar]
  50. George B. P. A.; Kumar N.; Abrahamse H.; Ray S. S. Apoptotic Efficacy of Multifaceted Biosynthesized Silver Nanoparticles on Human Adenocarcinoma Cells. Sci. Rep. 2018, 8, 14368. 10.1038/s41598-018-32480-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Fard S. E.; Tafvizi F.; Torbati M. B. Silver Nanoparticles Biosynthesised Using Centella asiatica Leaf Extract: Apoptosis Induction in MCF-7 Breast Cancer Cell Line. IET Nanobiotechnol. 2018, 12, 994–1002. 10.1049/iet-nbt.2018.5069. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Behboodi S.; Baghbani-Arani F.; Abdalan S.; Sadat Shandiz S. A. Green Engineered Biomolecule-Capped Silver Nanoparticles Fabricated from Cichorium intybus Extract: In Vitro Assessment on Apoptosis Properties Toward Human Breast Cancer (MCF-7) Cells. Biol. Trace Elem. Res. 2019, 187, 392–402. 10.1007/s12011-018-1392-0. [DOI] [PubMed] [Google Scholar]
  53. Chahardolia A.; Karimia N.; Fattahib A. Biosynthesis, Characterization, Antimicrobial and Cytotoxic Effects of Silver Nanoparticles Using Nigella arvensis Seed Extract. Iran. J. Pharm. Res. 2017, 16, 1167–1175. [PMC free article] [PubMed] [Google Scholar]
  54. Hemlata; Meena P. R.; Singh A. P.; Tejavath K. K. Biosynthesis of Silver Nanoparticles Using Cucumis prophetarum Aqueous Leaf Extract and Their Antibacterial and Antiproliferative Activity against Cancer Cell Lines. ACS Omega 2020, 5, 5520–5528. 10.1021/acsomega.0c00155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Banerjee P. P.; Bandyopadhyay A.; Nagesh H.; Policegoudra R.; Bhattacharya S.; Karak N.; Chattopadhyay A. Mentha arvensis (Linn.)-Mediated Green Silver Nanoparticles Trigger Caspase 9-Dependent Cell Death in MCF7 and MDA-MB-231 Cells. Breast Cancer: Targets Ther. 2017, 9, 265–278. 10.2147/bctt.s130952. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Şahin B.; Demir E.; Aygün A.; Gündüz H.; Şen F. Investigation of the Effect of Pomegranate Extract and Monodisperse Silver Nanoparticle Combination on MCF-7 Cell Line. J. Biotechnol. 2017, 260, 79–83. 10.1016/j.jbiotec.2017.09.012. [DOI] [PubMed] [Google Scholar]
  57. Singh A. K.; Tiwari R.; Kumar V.; Singh P.; Riyazat Khadim S. K.; Tiwari A.; Srivastava V.; Hasan S. H.; Asthana R. K. Photo-Induced Biosynthesis of Silver Nanoparticles from Aqueous Extract of Dunaliella salina and Their Anticancer Potential. J. Photochem. Photobiol., B 2017, 166, 202–211. 10.1016/j.jphotobiol.2016.11.020. [DOI] [PubMed] [Google Scholar]
  58. Park E.-J.; Yi J.; Chung K.-H.; Ryu D.-Y.; Choi J.; Park K. Oxidative Stress and Apoptosis Induced by Titanium Dioxide Nanoparticles in Cultured BEAS-2B Cells. Toxicol. Lett. 2008, 180, 222–229. 10.1016/j.toxlet.2008.06.869. [DOI] [PubMed] [Google Scholar]
  59. Hsin Y.-H.; Chen C.-F.; Huang S.; Shih T.-S.; Lai P.-S.; Chueh P. J. The Apoptotic Effect of Nanosilver Is Mediated by a ROS-and JNK-Dependent Mechanism Involving the Mitochondrial Pathway in NIH3T3 Cells. Toxicol. Lett. 2008, 179, 130–139. 10.1016/j.toxlet.2008.04.015. [DOI] [PubMed] [Google Scholar]
  60. Chipuk J. E.; Green D. R. Do Inducers of Apoptosis Trigger Caspase-Independent Cell Death?. Nat. Rev. Mol. Cell Biol. 2005, 6, 268–275. 10.1038/nrm1573. [DOI] [PubMed] [Google Scholar]
  61. Kabir S. R.; Rahman M. M.; Tasnim S.; Karim M. R.; Khatun N.; Hasan I.; Amin R.; Islam S. S.; Nurujjaman M.; Kabir A. H.; Sana N. K.; Ozeki Y.; Asaduzzaman A. K. M. Purification and Characterization of a Novel Chitinase from Trichosanthes dioica Seed with Antifungal Activity. Int. J. Biol. Macromol. 2016, 84, 62–68. 10.1016/j.ijbiomac.2015.12.006. [DOI] [PubMed] [Google Scholar]
  62. Kabir K. M. A.; Amin R.; Hasan I.; Asaduzzaman A.; Ahsanul Kabir K.; Khatun H.; Kabir S. R. Geodorum densiflorum Rhizome Lectin Inhibits Ehrlich Ascites Carcinoma Cell Growth by Inducing Apoptosis through the Regulation of BAX, P53 and NF-ΚB Genes Expression. Int. J. Biol. Macromol. 2019, 125, 92–98. 10.1016/j.ijbiomac.2018.12.042. [DOI] [PubMed] [Google Scholar]
  63. Kabir S. R.; Rahman M. M.; Amin R.; Karim M. R.; Mahmud Z. H.; Hossain M. T. Solanum tuberosum Lectin Inhibits Ehrlich Ascites Carcinoma Cells Growth by Inducing Apoptosis and G2</Inf>/M Cell Cycle Arrest. Tumor Biol. 2016, 37, 8437–8444. 10.1007/s13277-015-4735-x. [DOI] [PubMed] [Google Scholar]

Articles from ACS Omega are provided here courtesy of American Chemical Society

RESOURCES