Skip to main content
eLife logoLink to eLife
. 2020 Aug 10;9:e55795. doi: 10.7554/eLife.55795

Ecdysone steroid hormone remote controls intestinal stem cell fate decisions via the PPARγ-homolog Eip75B in Drosophila

Lisa Zipper 1, Denise Jassmann 1, Sofie Burgmer 1, Bastian Görlich 1, Tobias Reiff 1,✉
Editors: Elisabeth Knust2, K VijayRaghavan3
PMCID: PMC7440922  PMID: 32773037

Abstract

Developmental studies revealed fundamental principles on how organ size and function is achieved, but less is known about organ adaptation to new physiological demands. In fruit flies, juvenile hormone (JH) induces intestinal stem cell (ISC) driven absorptive epithelial expansion balancing energy uptake with increased energy demands of pregnancy. Here, we show 20-Hydroxy-Ecdysone (20HE)-signaling controlling organ homeostasis with physiological and pathological implications. Upon mating, 20HE titer in ovaries and hemolymph are increased and act on nearby midgut progenitors inducing Ecdysone-induced-protein-75B (Eip75B). Strikingly, the PPARγ-homologue Eip75B drives ISC daughter cells towards absorptive enterocyte lineage ensuring epithelial growth. To our knowledge, this is the first time a systemic hormone is shown to direct local stem cell fate decisions. Given the protective, but mechanistically unclear role of steroid hormones in female colorectal cancer patients, our findings suggest a tumor-suppressive role for steroidal signaling by promoting postmitotic fate when local signaling is deteriorated.

Research organism: D. melanogaster

Introduction

Reproduction is an energetically costly process triggering multiple physiological adaptations of organs such as liver, pancreas and gastrointestinal tract upon pregnancy in various species (Hammond, 1997; Roa and Tena-Sempere, 2014). As a part of the hormonal response to mating and increased metabolic energy consumption, the female Drosophila melanogaster midgut is remodeled in size and physiology by stimulating intestinal stem cell (ISC) driven epithelial expansion to achieve an even energy balance (Cognigni et al., 2011; Klepsatel et al., 2013; Reiff et al., 2015).

Since the discovery of adult intestinal stem cells (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006), local signaling pathways such as Notch (N), Jak/Stat, EGFR, Wnt/wingless, Insulin-receptor, Hippo/Warts and Dpp-signaling were shown to contribute to intestinal homeostasis under physiological and challenged conditions like bacterial infections (Miguel-Aliaga et al., 2018)(and references therein). The midgut epithelium is maintained by ISC giving rise to only two types of differentiated cells: enteroendocrine cells (EE) and absorptive enterocytes (EC) (Figure 1A). Pluripotent ISC are able to self-renew or divide asymmetrically into either committed EC precursor cells called enteroblasts (EB) or enteroendocrine precursor (EEP) cells. EEP, upon timely activation of scute in ISC, divide once more prior to terminal differentiation yielding a pair of EE (Chen et al., 2018; Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007). Nine out of ten ISC mitosis give rise to EB specified by N-activation in EB daughters (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007). Post-mitotic EB retain a certain degree of plasticity by: (1) delaying their terminal differentiation through mesenchymal-to-epithelial transition (MET) (Antonello et al., 2015a), (2) changing their fate to EE upon loss of the transcription factor klu (klumpfuss) and (3) undergoing apoptosis as an additional homeostatic mechanism (Korzelius et al., 2019; Reiff et al., 2019).

Figure 1. The Ecdysone receptor in intestinal progenitors controls tissue homeostasis.

(A) Scheme of the adult Drosophila melanogaster gastrointestinal tract with cartoon depicting the midgut epithelial monolayer composed of intestinal stem cells (ISC), enteroblasts (EB), enterocytes (EC) and enteroendocrine cells (EE) colored according to the lineage tracing system ReDDM with esg-Gal4 (Antonello et al., 2015a). (B) Schematic of esgReDDM tracing including full genotype. ReDDM differentially marks cells having active or inactive Gal4 expression. Combined with esg-Gal4, active in ISC and EB, esgReDDM double marks ISC and EB driving the expression of UAS-CD8::GFP (membrane CD8::GFP, green), UAS-H2B::RFP (nuclear H2B::RFP, red) and further UAS-driven transgenes (UAS abbreviated as >hereafter in Figure panels). Newly differentiated EC and EE with inactive esg-Gal4 are RFP+-only owing to protein stability of H2B::RFP. Flies are grown at permissive 18°C in which transgene expression is repressed by ubiquitous tubulin-driven Gal80ts. By shifting adult females to the restrictive temperature of 29°C, Gal80ts is destabilized, in turn enabling ReDDM-tracing marking progeny (EE and EC with H2B::RFP nuclear stain) and in parallel manipulation by allowing transactivation of UAS-sequences through esg-driven Gal4-expression (Antonello et al., 2015a). Posterior midguts (PMG) after seven days of esgReDDM tracing of control (crossed with w1118) adult MF (D) show mating dependent addition of new EC compared to control VF (C) (Reiff et al., 2015). (E) Knockdown of EcR using UAS-driven RNAi abolishes mating induced new EC generation in MF. (F+G) Overexpression of >EcR.B2 in VF (F) and >EcRFlyORFFlyORF840 (G) does not induce proliferation or differentiation of progenitors (ISC+EB). (H–I) Quantification of progenitor numbers (H) and traced progeny encompassing EC and EE (I) in R5 PMG (n = 24,17,17,17, 8). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). (J) Cartoon depicting experimental manipulations on EcR signaling pathway investigated with esgReDDM. Scale bars = 100 µm.

Figure 1—source data 1. Data from Figure 1.
Panel G,H experimental data.

Figure 1.

Figure 1—figure supplement 1. The EcR is expressed in the adult Drosophila midgut.

Figure 1—figure supplement 1.

(A) Expression analysis of Ecdysone-receptor splice variants with specific primer sets performed on cDNA transcribed from mRNA isolations of whole midgut dissections of adult MF. (B–D) Antibody staining against all EcR variants in PMG of adult MF using transgenic lines for the ISC-specific Notch-ligand Delta tagged with GFP (Dl::GFP, B-B’’’ inset magnification) and Notch responsive element marking EB (NRE-GFP, C-C’’’ inset magnification). Absorptive differentiated EC were identified using the GFP-tagged septate junction marker Dlg-1 (D–D’’’). Shown are single fluorescence channels including DAPI and merge (B’’’–D’’’). (E–H) Representative images of esgReDDM driving EcR-RNAis showing reduction of EcR immunoreactivity (F–G’). (H) in situ quantification of EcR levels by fluorescence intensity measurements in esgReDDM after seven days of tracing. Confocal images were taken at identical excitation and emission settings. Single GFP+/RFP+ progenitor cell nuclei were measured using Fiji and statistically analyzed (n = 272,179,179) using one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). (I–L) Forced expression of dominant-negative EcR.B2-variants (I+J), heterozygosity with the EcRM554fs-allele (K) and a second EcR-RNAi (L) after seven days of esgReDDM-tracing in adult PMG of MF. Scale bars = 100 µm.
Figure 1—figure supplement 1—source data 1. Data from Figure 1—figure supplement 1.
Panel H experimental data.

Apart from aforementioned local signaling pathways, systemic hormones are released into the hemolymph and act on distant organs (Figueroa-Clarevega and Bilder, 2015; Kwon et al., 2015; Reiff et al., 2015). Upon mating, JH released by the neuroendocrine corpora allata is able to control ISC proliferation through heterodimers of Met (methoprene-tolerant) and gce (germ cells expressed) nuclear hormone receptors (Reiff et al., 2015). JH coordinates Drosophila larval development in concert with the steroid hormone 20-hydroxy-ecdysone (20HE) and both hormones stimulate egg production in adult females (Bownes et al., 1984; Gilbert et al., 2002; Kozlova and Thummel, 2000; Truman and Riddiford, 2002). In mated adult female flies, we confirmed an increase of 20HE titers in ovary and detected a similar increase of hemolymph 20HE titers compared to virgin females (Ameku and Niwa, 2016; Gilbert and Warren, 2005; Harshman et al., 1999). The anatomical proximity of ovaries and the posterior midgut (PMG) prompted us to investigate a role for the Ecdysone-receptor (EcR) signaling cascade in organ plasticity during reproduction. Downstream of EcR activation, we detected upregulation of Ecdysone-induced protein 75B (Eip75B) protein isoforms ensuring absorptive EC production upon mating. Using the established Notch tumor paradigm, we found that 20HE through Eip75B/PPARγ remote controls EB differentiation and suppresses N-loss of function driven hyperplasia. The mechanism identified in this study not only plays a role in the physiology of mating, but also contributes to our understanding of the protective effects of steroid hormone signaling in the pathophysiology of human colorectal cancer.

Results

EcR controls intestinal stem cell proliferation and progenitor differentiation

The female fly intestine undergoes various physiological post-mating adaptations including a size increase of the absorptive epithelium (Cognigni et al., 2011; Klepsatel et al., 2013; Reiff et al., 2015). Intrigued by post-mating increases of 20HE titers (Ameku and Niwa, 2016; Harshman et al., 1999), we explored a role for EcR-signaling in mating adaptations of the adult Drosophila melanogaster intestine.

EcR encodes for three different splice variants: EcR.A, EcR.B1 and EcR.B2 (Cherbas et al., 2003; Talbot et al., 1993), which we detected by PCR in intestinal tissue with highest expression for EcR.B2 (Figure 1—figure supplement 1A). Using EcR antibodies detecting all splice variants, we found EcR in ISC (positive for the Notch ligand Delta+), EB (Notch responsive element, NRE-GFP+) and EC (Discs-large-1, Dlg-1+, Figure 1—figure supplement 1B–D’’’ and Figure 1A for an overview). To investigate a role for the EcR in intestinal tissue homeostasis, we first manipulated EcR function in ISC and EB using the ‘ReDDM’ (Repressible Dual Differential Marker, Figure 1B) tracing method to observe its overall impact on tissue renewal (Antonello et al., 2015a). Briefly, ReDDM differentially marks cells having active or inactive Gal4 expression with fluorophores of different stability over a defined period of time. Combined with the enhancer trap esg-Gal4, active in progenitors (ISC and EB), esgReDDM double marks ISC and EB driving the expression of UAS-CD8::GFP (>CD8::GFP) with short half-life and >H2B::RFP with long half-life. Upon epithelial replenishment, CD8::GFP signal is lost and new terminally differentiated EC (Dlg-1+) and EE (Prospero, Pros+) stemming from ISC divisions retain a RFP+-nuclear stain due to fluorophore stability (Figure 1A,B; Antonello et al., 2015a). Crosses are grown at 18°C in which transgene expression is repressed by ubiquitous tubulin-driven temperature sensitive Gal80ts. By shifting adult females to 29°C, Gal80ts is destabilized, in turn enabling spatiotemporal control of esgReDDM-tracing and additional UAS-driven transgenes in progenitors (Figure 1B).

After seven days of esgReDDM-tracing, mated females (MF, Figure 1D) showed increases of progenitor numbers (Figure 1H) and newly generated progeny (EE+EC, Figure 1I) in the R5 region of the PMG over virgin females (VF, Figure 1C) confirming previous observations (Reiff et al., 2015). Reducing EcR-levels with two different >EcR RNAi stocks in MF resulted in a reduction of ISC/EB numbers (Figure 1E,H, Figure 1—figure supplement 1L) and newly generated progeny (Figure 1E,I, Figure 1—figure supplement 1L) to levels comparable to VF controls (Figure 1C,H,I). We confirmed knockdown efficiency of >EcR RNAi in esgReDDM by measuring fluorescence intensity of EcR in progenitor cells in situ and found EcR-protein levels significantly decreased in both RNAi lines (Figure 1—figure supplement 1E–H).

Independent of EcR-abundance, we found that expressing dominant-negative EcR.B2 isoforms or EcR-heterozygosity using EcRM554fs, a well described loss-of-function (LOF) allele, phenocopy >EcR RNAi (Figure 1—figure supplement 1I–K). Generally, EcR LOF leads to a similar phenotype as JH-receptor knockdown in MF (Reiff et al., 2015). To investigate whether EcR-levels affect progenitor behavior, we overexpressed wildtype EcR.B2 and pan-EcR using esgReDDM in VF. We found neither induction of progenitor numbers nor an increase in new EC (Figure 1F–I), suggesting that EcR-dependent proliferation and differentiation of progenitors might be limited by 20HE availability (Figure 1J).

Ecdysone titers are increased upon mating and actively transported into progenitors to adapt intestinal physiology

In close anatomical proximity to the PMG, the ovaries are an established ecdysteroidogenic tissue. Determining 20HE titers 48 hr after mating using enzyme immunoassays, we confirmed previous reports of mating dependent increases of ovarian 20HE titers (Figure 2A; Ameku and Niwa, 2016; Harshman et al., 1999) and observed a similar increase in the hemolymph (Figure 2A). As a study investigating the ecdysoneless mutants suggested that the ovary is the only source for 20HE in adult females (Garen et al., 1977), we sought to diminish 20HE titers in adult females. Therefore, we genetically ablated the ovaries using the dominant sterile ovoD1 allele in which egg production is blocked prior to vitellogenesis (Busson et al., 1983; Oliver et al., 1987; Reiff et al., 2015; Figure 2D). 20HE titers in the hemolymph of ovoD1 females are reduced around 40–50% compared to wild-type females (Figure 2B,A). Interestingly, 20HE titers in hemolymph and remnants of the ovaries are still significantly increased upon mating of ovoD1 females (Figure 2C). Consequently, 20HE titers in sterile esgReDDM/ovoD1 MF increase the number of progenitors (Figure 2E) and progeny (Figure 2F). This suggests that remaining 20HE levels are sufficient to elicit mating related midgut adaptations.

Figure 2. Intracellular 20-Hydroxy-ecdysone levels control ecdysone response through the ecdysone importer.

(A–C) Determination of 20HE titers in ovaries and hemolymph of wild-type (A,B) and ovoD1 (B,C) adult VF and MF 48 hr after mating. (A,C) show fold-change increases over VF titer (dotted line at y = 1). (D) Cartoon depicting ovarian 20HE release to ISC/EB in the adjacent PMG. Please note that in wild-type females, 20HE is incorporated into developing eggs during vitellogenesis, whereas in ovoD1 vitellogenesis is absent and might lead to higher (proportional) release into the hemolymph. 20HE from the hemolymph is absorbed by ISC/EB in the PMG, where the cartoon illustrates specific genetical and pharmacological manipulations on the EcR-signaling pathway. (E–I) Representative images of adult PMG after seven days of esgReDDM tracing of ovoD1 VF (E), ovoD1 MF (F) and control VF (G) and MF (H). (I) Control VF PMG after oral administration of RH5849 (50 µg/ml). (J) Quantitative RT-PCR on EcRE (Ecdysone responsive elements, [Schwedes et al., 2011]) driving lacZ expression on intestinal cDNA from VF and MF control flies. Values are normalized to VF levels (dotted line at y = 1) and statistically analysed using student´s t-test (*p<0.05, **p<0.01; ***p<0,001;). (K–N) Up- and downregulation of EcI in VF (K,M) and MF (L,N) using UAS driven transgenes after seven days of tracing with esgReDDM. (O) Quantitative RT-PCR of EcI on intestinal cDNA from VF and MF control flies. Values are normalized to VF levels (dotted line at y = 1) and statistically analysed using student´s t-test (*p<0.05, **p<0.01; ***p<0,001;). (P,Q) Quantification of progenitor numbers (P) and traced progeny encompassing EC and EE (Q) in R5 PMG (n = 7,9/3,9,5,13/16,13,8,10,10,19). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). Scale bars = 100 µm.

Figure 2—source data 1. Data from Figure 2.
Panel A,B,C,J,O,P,Q experimental data.

Figure 2.

Figure 2—figure supplement 1. 20HE regulates physiological adaptations of fatty acid metabolism.

Figure 2—figure supplement 1.

(A) Drosophila food tubes of w1118 control egg layings to determine concentrations of RH5849. Please note that there is no crawling L3-larvae and puparium formation in both RH5849 concentrations. MeOH is the carrier solution and serves as control in all performed pharmacological experiments using RH5849. (B–B’’’) Forced expression of >EcI::HA using esgReDDM with subsequent immunohistochemistry using HA-antibodies reveals correct membrane localization of tagged EcI::HA (B’) in ISC/EB (B) (Okamoto et al., 2018). (C–G) Srebp-Gal4 > CD8::GFP carrying VF and MF were crossed with w1118 (C+D),>EcR RNAi (E+F) or treated with RH5849 (G) for three days. The Srebp-Gal4 line used is subjected to the same proteolytic processing as wild-type Srebp, thus reflecting upregulation of lipid uptake gene expression (Athippozhy et al., 2011; Reiff et al., 2015). (H) Mean GFP-fluorescence intensities in R5 PMG of according genotypes in (C–G) were measured using Fiji imaging software and statistically analyzed (n = 12, 15, 13, 18, 9) using one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). Scale bars = 100 µm. (I–N) Representative images of direct assessment of lipid content in PMG with OilRedO-staining of the indicated genotypes. Mex-Gal4, tub-Gal80ts was used to temporally control EC manipulation of indicated genes. (I–N) Control flies (I+J), fed with RH5849 (K), >EcI (L), >EcI RNAi (M) and >EcR RNAi (N) were kept for seven days at 29°C to allow transgene activation. (O) Quantification of OilRedO intensity and statistical analysed (n = 11,17,12,16,8,9) using student’s t-test. Unluckily, we were unable to combine these fly stocks with ovoD1 to reveal whether egg production obscures a reduction of EcI-RNAi and EcR-RNAi in EC lipid uptake as shown in Reiff et al., 2015.
Figure 2—figure supplement 1—source data 1. Data from Figure 2—figure supplement 1.
Panel H,O experimental data.

20HE is a polar steroid, which disperses through hemolymph and binds to EcR to activate target gene transcription (Figure 2D; Bownes et al., 1984; Gilbert et al., 2002). Using an established reporter for the activation of 20HE signaling, we found mating induced increases of EcR activity in PMG and ovaries using qPCR (Figure 2J). As orally administered 20HE is metabolized and cleared of rapidly, we used the potent non-steroidal EcR agonist RH5849. RH5849 is used as pest control due to its stability, specificity and a 30–60 times higher efficacy compared to 20HE (Robinson et al., 1987; Wing et al., 1988). Testing concentrations from 1 to 100 µg/ml in timed egg-layings, we observed expected larval molting defects for concentrations from 50 µg/ml upwards (Figure 2—figure supplement 1A). Feeding control esgReDDM VF 50 µg/ml with RH5849, we traced intestinal progenitors with pharmacologically activated EcR-signaling for seven days. RH5849 strongly induces ISC mitosis, reflected by a tenfold increase in newly generated progeny over mating induction (Figure 2G–I,Q). Interestingly, RH5849 mediated EcR-activation leads to no accumulation of progenitors (Figure 2P) as observed in oncogenic manipulations or disruptions of intestinal homeostasis, suggesting a role for EcR in both, proliferation and differentiation (Antonello et al., 2015a; Chen et al., 2016; Patel et al., 2015; Reiff et al., 2019). Given the role of 20HE induced programmed cell death (PCD) in larval metamorphosis and the recently discovered role of EB PCD in adult midgut homeostasis (Jiang et al., 1997; Jiang et al., 2000; Reiff et al., 2019), we addressed PCD by activated caspase-3 staining, but found no increase of PCD by RH5849 (data not shown).

Cellular 20HE uptake was recently shown to depend on Ecdysone Importer (EcI) belonging to the evolutionary conserved SLCO superfamily of solute carrier transporters. EcI LOF causes phenotypes indistinguishable from 20HE and EcR deficiencies in vivo (Okamoto et al., 2018). To investigate a role of EcI, we confirmed membrane localization of >EcI tagged with HA by immunostaining in progenitors using esgReDDM (Figure 2—figure supplement 1B). After seven days, forced expression of >EcI using esgReDDM in VF lead to no increase in progenitor numbers and new EC, underlining that VF 20HE levels are low (Figure 2K,P,Q). Further supporting this hypothesis,>EcI in MF lead to an increase of newly generated EC exceeding typical mating induction of MF controls by 4.8 fold (Figure 2L,P,Q). Blocking 20HE uptake by EcI-RNAi in MF abolished ecdysone induced tissue expansion to VF control levels (Figure 2N,P,Q). In addition, we tested a function of the EcI gene in mating induction, but found no change in EcI expression upon mating (Figure 2O). Both, pharmacological and genetic experiments, suggest that 20HE titer and import control EcR-activity upon mating (Figure 2D).

Upon mating, absorptive EC undergo metabolic adaptations upregulating genes known for lipid uptake (Reiff et al., 2015). We found EC immunoreactive for EcR (Figure 1—figure supplement 1D) and investigated a function for EcR in mating related upregulation of lipid uptake by measuring the activity of sterol regulatory element-binding protein (Srebp) (Reiff et al., 2015). Therefore, we used a GFP-reporter (Srebp >CD8::GFP) that is subjected to the same proteolytic processing as Srebp (Athippozhy et al., 2011; Reiff et al., 2015). Confirming previous observations, Srebp-activity increases 2.2 fold upon mating (mean fluorescence intensity, Figure 2—figure supplement 1C,D; Reiff et al., 2015). Using the Srebp-reporter to drive >EcR RNAi in MF, we found reduced Srebp-activity comparable VF controls (Figure 2—figure supplement 1E–F,H), whereas feeding VF with RH5849 induced Srebp-activity 2.4 fold (Figure 2—figure supplement 1G,H). Next, we directly addressed lipid uptake with OilRedO-staining on PMG using the EC driver Mexts. In accordance with Srebp-activity (Figure 2—figure supplement 1C,D,G), feeding flies with RH5849 (Figure 2—figure supplement 1K) and forced expression of EcI (Figure 2—figure supplement 1L) significantly induced lipid uptake (Figure 2—figure supplement 1O) over controls (Figure 2—figure supplement 1I,J). Mexts > EcI RNAi and >EcR RNAi did not result in a reduction of lipid uptake below control levels (Figure 2—figure supplement 1M,N,I), confirming previous observations of direct fatty acid incorporation into newly produced eggs (Reiff et al., 2015).

These data support the idea that mating related synergistic effects of JH- and 20HE-signaling drive adaptation of intestinal homeostasis and physiology. The JH-signal is transduced by the transcription factor Krüppel-homolog 1 (Kr-h1) in adult MF intestines, which prompted us to explore a function for the ‘classical’ Ecdysone target genes (Jindra et al., 2013; Reiff et al., 2015).

Ecdysone-induced protein 75b protein isoforms Eip75B-A and Eip75B-C control enteroblast differentiation

During Drosophila development, 20HE pulses lead to direct binding of EcR to regulatory regions of early ecdysone response genes Ecdysone-induced protein 74A (Eip74EF) and Ecdysone-induced protein 75B (Eip75B, Figure 3A; Bernardo et al., 2014; Karim and Thummel, 1991; Segraves and Hogness, 1990). First, we performed conventional PCR to analyze JH- and Ecdysone target gene expression. Signal for Kr-h1-A (Kr-h1 in the following), but not Kr-h1-B, and for all isoforms of Eip74EF and Eip75B was found (Figure 3B). Using quantitative real time PCR (qPCR) analysis, we confirmed an increase of JH-pathway activity upon mating using Kr-h1 as control (Figure 3C; Reiff et al., 2015). To our surprise, we found Eip74EF expression unchanged, in contrast to its prominent role in the control of germline stem cell (GSC) proliferation in oogenesis (Ables and Drummond-Barbosa, 2010). Instead, we found induction of Eip75B-A and -C isoforms (Figure 3C). Eip75B encodes for three protein isoforms (Eip75B-A, -B and –C) that differ in their N-terminal domain structure (Segraves and Hogness, 1990) and Eip75B-B lacks one of the two zinc-finger DNA binding domains rendering it incapable of direct DNA binding (White et al., 1997).

Figure 3. Ecdysone induced protein 75B is upregulated upon mating and controls progenitor differentiation.

(A) Cartoon depicting EcR signaling cascade activating early ecdysteroid target genes. (B) Expression analysis of Ecdysone- and JH-signaling target genes including protein isoforms on cDNA transcribed from mRNA isolations from whole midgut dissections of MF. (C) Quantitative RT-PCR on early ecdysteroid genes on intestinal cDNA from VF and MF control flies. Values are normalized to VF levels (horizontal line = 1) and statistically analyzed using student´s t-test (n = 6; *p<0.05, **p<0.01;). (D–E) RNAi-mediated downregulation of Eip75B in VF (D), MF (E) and MF fed with RH5849 (F) after seven days of tracing with esgReDDM. (G–K) Representative images of adult PMG with forced expression of Eip75B isoforms Eip75B-A (G), Eip75B-A and EcI-RNAi (H), Eip75B-B (I), Eip75B-C (J), Eip75B-C and EcI-RNAi (K) after seven days of tracing with esgReDDM. Inset in (F) depicts epithelial integration of newly generated Dlg-1+/RFP+-EC. (I–J) Quantification of progenitor numbers (I) and traced progeny encompassing EC and EE (J) in R5 PMG (n = 12,13,10,12,11,11,14,8,10,10,10,5,11). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001, identical p-values are marked by # when compared to MF). Scale bars = 100 µm.

Figure 3—source data 1. Data from Figure 3.
Panel C,L,M experimental data.

Figure 3.

Figure 3—figure supplement 1. Analysis of Eip75B-A MARCM clones.

Figure 3—figure supplement 1.

(A–E’’) Representative images of MARCM clones of the indicated allele five days after clone induction (ACI) counterstained with Dlg-1 and Pros immunohistochemistry. Control clones lead to proper EC formation (big GFP+-nuclei/Dlg-1+) and EE (small GFP+ diploid nuclei/Pros+, arrowheads in B). Eip75B-A null mutant clones (C–C’’) do not contain properly differentiated EC (big GFP+ nuclei without Dlg-1). Scale bars indicated in the images (A,B–C). (D) Quantification of GFP-MARCM clone size in R5 PMG (n = 294,252 clones analyzed). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from unpaired Student´s t-test (*p<0.05). (E) Quantification of EE (n = 12,13,10,12,11) and (F) pH3 (n = 9,11,7,10,10) in R5 PMG. Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). (G) Overall length in µm of midguts from proventriculus to mid-/hindgut boundary of indicated genotypes. > N RNAi is a genetic condition in which no new EC are generated (Figure 5), thus reflecting the maximum midgut length reduction when no new EC are added.
Figure 3—figure supplement 1—source data 1. Data from Figure 3—figure supplement 1.
Panel D,E,F,G experimental data.
Figure 3—figure supplement 2. EB specific genetic manipulation of Eip75B using kluReDDM.

Figure 3—figure supplement 2.

(A) Cartoon depicting kluReDDM-tracing. klu-Gal4 is active in EC-committed EB only and EC progeny is labelled with nuclear H2B::RFP (Reiff et al., 2019). (B–D’’) Representative images of MF controls (B–B’’) and EB-specific knockdown of EcR (C-C´´) and Eip75B (D–D’’) using kluReDDM after seven days of tracing. Differentiated progeny was identified in (B+D) with Dlg-1 and Pros immunohistochemistry. (E–I) Representative images of adult PMG of control VF (E) and MF (F) and forced expression of Eip75B gene products Eip75B-A (G), Eip75B-B (H) and Eip75B-C (I) after seven days of tracing with kluReDDM. (J–L) Quantification of EB number (J), traced progeny encompassing EC and EE (K) and ISC mitosis (L) in R5 PMG (n = 11,13,10,10,10,10,6,10,10,10). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001, identical p-values are marked by # when compared to MF). Scale bars = 100 µm.
Figure 3—figure supplement 2—source data 1. Data from Figure 3—figure supplement 2.
Panel A,J,K,L experimental data.

Intrigued by mating increases of Eip75B-A /- C levels, we manipulated Eip75B function using esgReDDM. Reducing Eip75B levels with RNAi, we found a significant increase in ISC and EB numbers (Figure 3D,E,L), but not in EC generation compared to VF controls (Figure 3M). In MF, Eip75B knockdown reduced newly generated EC compared to MF controls, pointing to a role of Eip75B in EB differentiation downstream of EcR-activation (Figure 3E,M). Interestingly, feeding flies with RH5849 lacking Eip75B in their intestinal progenitors (Figure 3F) did not result in newly generated progeny (Figure 3M compare to Figure 2Q), suggesting a central role for Eip75B in the RH5849 response. Additionally, we investigated homozygous Eip75B-A mutants using MARCM clonal analysis with a known LOF allele (Rabinovich et al., 2016). MARCM clones of Eip75B-A (Eip75BA81) are significantly larger compared to controls (Figure 3—figure supplement 1A–D; Lee and Luo, 1999). Eip75BA81 deficient clones contain few differentiated EC (GFP+/Dlg-1+, Figure 3—figure supplement 1C) suggesting disturbed EB to EC differentiation as observed for esgReDDM >Eip75 B-RNAi (Figure 3E). Together, these LOF experiments hint to a role for mating induced Eip75B-A /- C isoforms in EC differentiation of EB downstream of EcR.

Forced expression of Eip75B variants with esgReDDM resulted in three prominent phenotypes: (1) Eip75B-A and Eip75B-C strongly drive differentiation into EC (Dlg-1+, Figure 3G,J,M) depleting the entire progenitor pool (Figure 3G,J,M). (2) The Eip75B-B isoform induces ISC proliferation in VF (Figure 3I, Figure 3—figure supplement 1F) and raised progenitor numbers suggesting slowed down but not inhibited terminal differentiation (Figure 3I,L,M). (3) All Eip75B manipulations strongly reduce the number of newly differentiated EE (Figure 3—figure supplement 1E). This suggests that EE differentiation upon Eip75B-RNAi and forced expression of the Eip75B-B isoform is blocked (Figure 3I,L, Figure 3—figure supplement 1E). Eip75B-A and Eip75B-C are sufficient to instantaneously drive progenitors into EC differentiation (Figure 3G,H,J,K) even in the absence of 20HE import (Figure 3H,K). The immediate strong differentiation stimulus prevents further ISC division and as a consequence also reduces new EE (Figure 3L,M, Figure 3—figure supplement 1E). Disrupting intestinal homeostasis alters midgut length (Hudry et al., 2016) and in line with this, Eip75B manipulations result in a shorter midgut as EC make up around 90% of the whole midgut epithelium (Figure 3—figure supplement 1G). Eip75B affects intestinal homeostasis by either slowing down terminal EB to EC differentiation (Eip75B-B and Eip75B-RNAi) or depleting the ISC and EB pool (Eip75B-A /– C, Figure 3—figure supplement 1G) preventing sufficient EC production along the gut. When EC production is blocked using >N RNAi, the midgut shrinks around one third over a period of seven days (Chen et al., 2018; Guo and Ohlstein, 2015; Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007; Patel et al., 2015). Thus, all Eip75B manipulations ultimately lead to an insufficient number of new absorptive EC resulting in a shorter midgut.

Eip75B is a long term predicted PPARγ-homologue (peroxisome proliferator-activated receptor gamma) in Drosophila. A close functional homology got recently confirmed in pharmacogenetic approaches demonstrating that Eip75B-mutant flies are irresponsive to PPARγ activating drugs (Joardar et al., 2015; King-Jones and Thummel, 2005). This homology is of particular interest, as human PPARγ plays a role in i) pregnancy related adaptations of lipid metabolism (Waite et al., 2000) and ii) as target in colorectal cancer (CRC) (Sarraf et al., 1999). Thus, we tested pharmacological activation of Eip75B/PPARγ with the established agonist Pioglitazone, a drug used in Diabetes mellitus treatment (Gillies and Dunn, 2000; Jafari et al., 2007). Flies fed with food containing Pioglitazone show a strong increase in the number of progenitor cells (Figure 4B,E) and newly generated EC (Figure 4F) compared to controls (Figure 4A). Strikingly, knockdown of Eip75B led to irresponsiveness to Pioglitazone (Figure 4C,D,F) suggesting that Pioglitazone activates Eip75B in intestinal progenitors.

Figure 4. The Eip75B/PPARγ agonist Pioglitazone acts through Eip75B to stimulate progenitor differentiation.

Figure 4.

(A–D) Representative images of adult PMG after seven days of esgReDDM tracing of control MF (A,B) and >Eip75 B-RNAi MF (C,D) fed with DMSO as control (A,C, 2.5 µl/ml food) and Pioglitazone (B,D; 0,002 mg in DMSO/ml food). (E+F) Quantification of progenitor numbers (E) and newly generated EC (F) in R5 PMG (n = 7,6,10,11). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001,. Scale bars = 100 µm.

Figure 4—source data 1. Data from Figure 4.
Panel E,F experimental data.

Taken together, these findings strongly suggested a role for Eip75B in EB differentiation. EB are specified by N-signaling and their lineage is maintained by the transcription factor klumpfuss (klu). klu+-EB retain some plasticity to change fate to EE upon reduction of klu-levels (Korzelius et al., 2019; Reiff et al., 2019). We used kluReDDM to explore the function of EcR and Eip75B in EB lineage identity (Figure 3—figure supplement 2A). No changes in EB fate decisions towards EE differentiation were observed upon knockdown of EcR and Eip75B (Figure 3—figure supplement 2A,B–D). Eip75B-A and Eip75B-C expression with kluReDDM phenocopied EB to EC differentiation effects observed in esgReDDM (Figure 3—figure supplement 2G,I,J,K) without non-autonomously inducing proliferation in wild-type ISC of VF and MF (Figure 3—figure supplement 2J,K). Expressing Eip75B-B in kluReDDM lead to delayed EB differentiation similar to esgReDDM and non-autonomous induction of ISC mitosis (Figure 3I, Figure 3—figure supplement 2J,L; Patel et al., 2015; Reiff et al., 2019). Having identified Eip75B-A /- C as mating induced differentiation effector of 20HE signaling, we hypothesized and investigated a synergism of 20HE and JH hormonal signaling pathways controlling epithelial expansion upon mating.

The interplay between JH and 20HE in intestinal progenitors

Our data suggest that mating induced JH and 20HE signaling affect ISC proliferation and EB differentiation through their effectors Kr-h1 and Eip75B-A /- C (Figure 5K; Reiff et al., 2015). In VF lacking mating induction of both hormones (Figure 2A–C; Ameku and Niwa, 2016; Harshman et al., 1999; Reiff et al., 2015), forced >Kr h1 expression doubles progenitor numbers reproducing previous results (Figure 5B,I; Reiff et al., 2015). Initially, we aimed to perform a full genetic epistasis analysis for Eip75B and Kr-h1, but this analysis was hampered as we failed to recombine Kr-h1-RNAi with Eip75B isoform expressing stocks.

Figure 5. Crosstalk between JH- and Ecdysone-signaling pathways controlling intestinal progenitor proliferation and differentiation.

Figure 5.

(A–B) Images of adult PMG of control VF (A) and forced expression of > Kr h1 (B) traced for seven days with esgReDDM. (C–H) Images of adult PMG with forced expression of > Kr h1 with > Eip75 B-RNAi in VF and MF (C,D) and expression of Eip75B isoforms > Eip75 B-A (E),>Eip75 B-B (F),>Eip75 B-C (G) and double > Eip75B-RNAi/>Kr-h1-RNAi (H) after seven days of tracing with esgReDDM. Please note that genotypes of (C–G) were accompanied with semi-lethality even at permissive 18°C, suggesting for example background transgene expression or position effects most probably caused by the total number of six transgenes including esgReDDM. PMG of > Kr h1 combinations also showed some progenitor lethality indicated by membrane-blebbing and irregularities (arrowheads, (E–G) as described in Reiff et al., 2019. (J) Quantification of progenitor numbers (I) and traced progeny encompassing EC and EE (J) in R5 PMG (n = 12,5,9,8,7,13,8,8,13). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001, identical p-values are marked by # when compared to MF). Scale bars = 50 µm (K) Cartoon depicting transcriptional effectors of JH- and Ecdysone signaling pathways. The JH receptor is formed by a heterodimer of Methoprene tolerant (Met) and germ cells expressed (gce). Ligand bound receptor activates the transcription of krüppel homolog 1 (Kr-h1) mediating mating effects in the adult intestine (Reiff et al., 2015) Forced expression of Eip75B-B affects proliferation and differentiation through an yet unknown stimulus.

Figure 5—source data 1. Data from Figure 5.
Panel I,J experimental data.

However, we were able to analyze midguts of MF with forced Kr-h1-expression and simultaneous Eip75B-RNAi (Figure 5C,D), which increases progenitor numbers (Figure 5I) with only few newly generated EC (Figure 5J). This finding supports the requirement of Eip75B in EB differentiation (Figure 3E) and Kr-h1 in ISC proliferation (Figure 5A). Simultaneous double knockdown of >Kr-h1-RNAi/Eip75B-RNAi (Figure 5H) in MF did not show mating induction. Progenitor numbers and differentiated progeny are reduced (Figure 5I,J) phenocopying single >Kr h1-RNAi (Reiff et al., 2015). Surprisingly, we observed a strong increase of progenitor numbers forcing Kr-h1 and Eip75B-B expression (Figure 5F,I,J). These results indicate an additive role of forced Eip75B-B and Kr-h1-expression on ISC proliferation, whereas the latter transduces the mating related proliferation response (Figure 3C). The stimulus inducing Eip75B-B expression yet needs to be identified (Figure 5K).

Most interestingly, Eip75B-A and –C, despite of raised Kr-h1-levels, drive progenitors into EC differentiation largely phenocopying sole Eip75B-A and -C expression (compare Figures 3G,J and 5E,G,I,J). Our data on Eip75B-A and -C corroborate a potent role for Ecdysone-induced EB differentiation. ISC fate decisions in the adult midgut rely on N-signaling (Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007). During Drosophila follicle cell development N opposes EcR-function (Sun et al., 2008), which prompted us to investigate Eip75B-A /- C as effectors of EcR-signaling in the context of N-dependent EB differentiation.

Ecdysone signaling through Eip75B-A and Eip75B-C controls enteroblast differentiation in a notch deficiency tumor model

In the Drosophila and mammalian intestinal stem cell niche, N-signaling specifies EE and EC fate (Jensen et al., 2000; Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007; VanDussen et al., 2012). In Drosophila, mitosis of N mutant ISC generates only ISC-like progenitor cells and EE, which results in an intestinal epithelium accumulating a lack of newly produced EC and compensatory proliferation (Figure 6A,B; Chen et al., 2018; Guo and Ohlstein, 2015; Micchelli and Perrimon, 2006; Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007; Patel et al., 2015).

Figure 6. Ecdysone induced protein 75B promotes EB differentiation in a Notch tumor paradigm.

(A) Cartoon depicting cell fate changes upon N-LOF combined with esgReDDM coloring (Ohlstein and Spradling, 2006; Ohlstein and Spradling, 2007). (B) > N RNAi driven by esgReDDM leads to different tumor sizes after seven days of tracing that were classified in four classes according to size. Note, ISC-like/EE clusters up to four cells are not quantified as they occasionally occur in controls too. Progenitors are double labelled (GFP+/RFP+), where newly generated EE are identified by immunostaining for Prospero (Pros) and H2B::RFP trace from esgReDDM. (C–D) Co- expression of Eip75B isoforms > Eip75 B-A (C) and > Eip75 B-C (D) after seven days of tracing with esgReDDM > N RNAi in MF. Note additional Dlg-1+-immunoreactivity in (grey,C+D) demonstrating epithelial integration of newly generated cells as EC (Dlg-1+/RFP+). (E+E’) RNAi-mediated downregulation of Eip75B in MF shows confluent N-tumors (E) accompanied by increased mitosis (E’). (F) Quantification of ISC progeny encompassing ISC-like and EE total N-tumor number in R5 PMG (n = 10,10,10). (G–J) Feeding of the Eip75B/PPARy agonist Pioglitazone to esgReDDM > NDN flies leads to the generation of newly generated EC ((H,I), Dlg-1+/RFP+) after seven days of tracing compared to DMSO controls (G,I). (I–J) Quantification of ISC progeny encompassing ISC-like and EE total N-tumor number in R5 PMG (n = 5,5). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; *** p$$BOX_TXT_END$$. <0,001; ****p<0.0001). Scale bars = 25 µm.

Figure 6—source data 1. Data from Figure 6.
Panel F,I,J experimental data.

Figure 6.

Figure 6—figure supplement 1. Size distribution of different Notch-tumor classes.

Figure 6—figure supplement 1.

(A) Quantification of ISC progeny encompassing ISC-like, EC and EE classified after tumor size (classes I to IV) in R5 PMG of esgReDDM > N RNAi (n = 10,10,10). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001).
Figure 6—figure supplement 1—source data 1. Data from Figure 6—figure supplement 1.
Panel A experimental data.

Using N-LOF tumors as an experimental paradigm lacking EC production, we sought to investigate the differentiation inducing properties of Eip75B-A /- C. Reduction of N by RNAi or a dominant-negative N-receptor using esgReDDM lead to tumors of different sizes, which we quantified and classified according to their number (Figure 6B). We predominantly found tumors of 5–10 cells (Figure 6B, Figure 6—figure supplement 1A), but also few tumors containing more than 100 ISC/EE-like cells with indistinguishable single or multiple ISC origin (class IV, Figure 6B, Figure 6—figure supplement 1A).

Co-expression of Eip75B-A /- C with N-LOF strongly reduced total tumor number (Figure 6C,D,F) and smaller class I, II and III tumors (Figure 6—figure supplement 1A), whereas Eip75B-RNAi results in confluent class IV tumors all along the PMG (Figure 6E). Although tumor number is strongly reduced (Figure 6F), occasional class IV tumors (<1/PMG) are able to escape suppressive Eip75B-A /- C showing no reduction in tumor size (Figure 6—figure supplement 1A). Additional tumorigenic mechanisms such as Upd- or EGF-ligand upregulation may counteract the tumor suppressive function of 20HE signaling in class IV tumors (Patel et al., 2015).

Since Eip75B-A and Eip75B-C re-enable EC differentiation despite the lack of N (Figure 6C,D; Dlg-1+/RFP+), we investigated whether the EcR-pathway and pharmacological Eip75B-activation are able to trigger EC fate in a N-LOF context. Activation of Eip75B using Pioglitazone led to more newly generated EC (Figure 6H,I) compared to controls (Figure 6G). In addition, we observed a slight, but significant reduction in the number of N-tumors upon feeding Pioglitazone (Figure 6J).

Given the protective role of steroid hormone signaling in colorectal cancer (CRC), we sought to investigate N tumor numbers upon EcR-signaling activation (Chen et al., 1998; Hendifar et al., 2009; Lin et al., 2012). We activated EcR-signaling with RH5849 (Figure 7B) or by raising intracellular levels of 20HE expressing > EcI in esgReDDM(Figure 7D). Either manipulation resulted in numerous confluent tumors reflecting the previously observed role of 20HE in proliferation (Figure 7F). In line with this,>EcI RNAi- and >EcR RNAi significantly reduced tumor burden (Figure 7C,E,F).

Figure 7. Ecdysone signaling promotes EC-fate in a Notch tumor paradigm.

(A–E’’) Pharmacological and genetic manipulation of Ecdysone signaling. Adult PMG of MF with N-LOF (>N RNAi or > NDN) treated with MeOH as control (A–A’’) or RH5849 (B–B’’) to activate Ecdysone signaling. Arrowheads highlight newly generated Dlg-1+/RFP+-EC (B+B’’) after seven days of esgReDDM > NDN. (C–C’’) RNAi-mediated downregulation of EcI in esgReDDM > NDN, forced expression of >EcI (D–D’’) and >EcR RNAi (E–E’’) in esgReDDM > N RNAi MF after seven days of tracing. Arrowheads highlight newly generated Dlg-1+-EC (D+D’’), scale bars = 25 µm. (F) Quantification of ISC progeny encompassing ISC-like, EC and EE classified after tumor size in R5 PMG (n = 13,5,7,4,6,9). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). (G) Quantification of newly generated EC (Dlg-1+/RFP+) in R5 PMG (n = 13,5,7,4,6,9). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from one-way ANOVA with Bonferroni's Multiple Comparison Test (*p<0.05, **p<0.01; ***p<0,001; ****p<0.0001). (H) Model of 20HE and JH hormonal pathways influencing physiological and pathological turnover in the intestine. Upon mating, JH from the neuroendocrine CA (corpora allata, [Reiff et al., 2015]) as well as ovarian 20HE (a) synergize on progenitor cells in the posterior midgut of adult female flies. The source of 20HE could not be definitely determined in this current study and 20HE might as well stem from the brain (b). JH induces ISC proliferation through Kr-h1, whereas 20HE signaling transduced by Eip75B-A /- C/PPARγ, ensures that newly produced EB differentiate into EC. New EC lead to a net increase in absorptive epithelium and thus ensures physiological adaptation of intestinal size to the new metabolic energy requirements of pregnancy. In the adult intestine, early steps of tumor-pathology are recapitulated when EC fate is inhibited by the lack of Notch signaling in progenitors (Patel et al., 2015). Notch mutant ISC divisions only produces ISC-like progenitors and EE. We show in this study that 20HE signaling, through Eip75B-A /- C/PPARγ, is capable to alleviate Notch tumor growth by driving intestinal progenitors into post-mitotic absorptive EC fate.

Figure 7—source data 1. Data from Figure 7.
Panel F,G experimental data.

Figure 7.

Figure 7—figure supplement 1. Analysis of Notch mutant MARCM clones and consequences of clonal EcR-activation.

Figure 7—figure supplement 1.

(A–E’’) Representative images of MARCM clones for the Notch receptor (N55e11) in MF PMG four days after clone induction (ACI) counterstained with Dlg-1 and Pros antibodies. Control Notch clones (MeOH) contain GFP-labelled clones containing ISC-like cells (GFP-only, green arrowheads) or EE (small GFP+ diploid nuclei/Pros+, white arrowheads). Notch null mutant clones (B–B’’) treated with RH5849 contain differentiated EC in adjacent to Notch tumors (Dlg1+/GFP+) arrowheads). (C) Quantification of GFP-labelled EC in Notch MARCM clones in R5 PMG (n = 7,6). Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from unpaired Student´s t-test (*p<0.05, p=0,0129). (D+E) Forced expression of > Eip75 B-A (D) and > Eip75 B-C (E) leads to the immediate formation of single cell clones that immediately differentiated into EC (arrowheads). (F) Notch activity addressed by Gbe-SuH activity fluorescence activity in RH5849 fed flies vs. control flies (>250 EB in n > 3 midguts, Error bars are Standard Error of the Mean (SEM) and asterisks denote significances from unpaired Student´s t-test (****p<0.001). Scale bars = 100 µm.
Figure 7—figure supplement 1—source data 1. Data from Figure 7—figure supplement 1.
Panel C,G experimental data.

More importantly, ecdysone-pathway activation led to significantly higher numbers of newly generated EC (arrowheads in Figure 7B,D,G), suggesting an upregulation of Eip75B-A and Eip75B-C in Notch tumors upon EcR-activation through RH5849 and > EcI. To exclude remaining N activity, we generated MARCM clones mutant for N (N55e11) (Guo and Ohlstein, 2015). In agreement with our previous observations, activating 20HE signaling in N clones led to a tenfold increase in EC numbers over controls (Figure 7—figure supplement 1A–C) and forced expression of > E75 A/-C to instant EC formation (Figure 7—figure supplement 1D–E). Interestingly, in the presence of N, its activity is increased upon RH5849 feeding (Figure 7—figure supplement 1F), which suggests an interplay between Notch and EcR-signaling that might converge on Eip75B (this study) and klu (Korzelius et al., 2019; Reiff et al., 2019).

Taken together, our data establish 20HE as a systemic signal controlling reproductive adaptations in synergism with JH (Figure 7H). Focusing on EcR-signaling in ISC and EB, we found the mating induced Eip75B-A /- C isoforms acting as differentiation factors in EB. Eip75B-A /- C induces EC fate even in Notch-deficient midgut progenitors, an experimental paradigm used to recapitulate early steps of tumorigenesis. Notch dependent fate decisions in midgut precursor cells are conserved between flies and humans. Thus, our findings suggest a new mechanism how steroid hormone signaling might suppress tumor growth by promoting post-mitotic cell fate in intestinal neoplasms marked by a lack of fate specification.

Discussion

Systemic hormones and intestinal remodeling upon mating

Growing offspring involves significant metabolic adaptations to raised energy demands in mothers. Drosophila melanogaster uses a classical r-selected reproductive strategy with high number of offspring and minimal parental care (Pianka, 1970). Upon mating, egg production is increased tenfold supported by metabolic and behavioral adaptations such as food intake and transit, nutrient preference and a net increase of absorptive tissue in the PMG depending on JH release (Carvalho et al., 2006; Cognigni et al., 2011; Reiff et al., 2015; Ribeiro and Dickson, 2010).

Here, we describe a role for the steroid-hormone ecdysone controlling intestinal tissue remodeling upon mating through EcR-signaling. The unliganded heterodimer of EcR and ultraspiracle (USP) binds its DNA consensus sequences serving as a repressor. Upon ligand binding, the EcR/USP heterodimer turns into an activator inducing the expression of early response genes Eip74EF, Eip75B and broad (br) (Schwedes et al., 2011; Uyehara and McKay, 2019). Initially, we investigated knockdown of USP, br and Eip74EF in intestinal progenitors and observed effects on progenitor survival independent of mating status (Figure 3C, Zipper and Reiff, unpublished data).

Our data support the idea that 20HE and JH synergistically concert intestinal adaptations balancing nutrient uptake to the increased energy demands after mating (Figures 1–5). We confirmed that mating induces ovarian ecdysteroid biosynthesis stimulating egg production by ovarian GSC (Figure 2A; Ables and Drummond-Barbosa, 2010; Ameku and Niwa, 2016; Ameku et al., 2017; Harshman et al., 1999; König et al., 2011; Morris and Spradling, 2012; Uyehara and McKay, 2019). In accordance with an inter-organ signaling role for 20HE, we also detected increased 20HE titers in the hemolymph (Figure 2A). Surprisingly, we found this mating dependent increase of 20HE titers still present upon partial genetic ablation of the ovaries using ovoD1 (Figure 2B; Reiff et al., 2015). This can be explained by either (i) other source(s) for 20HE in adult females like the brain (Chen et al., 2014; Itoh et al., 2011) or (ii) 20HE release from remaining germarial cells in stage 1–4 eggs of ovoD1 VF and MF. Indeed, germarial cells have been shown to express the ecdysteroidogenic Halloween genes (Ameku and Niwa, 2016; Ameku et al., 2017). In addition, ovoD1 MF lack ovarian 20HE uptake during vitellogenesis (Figure 2D) of later egg stages, which potentially contributes to 20HE titer in the hemolymph of ovoD1 females and intestinal epithelium expansion (Figure 2D,E,J,K; Enya et al., 2014).

The epithelial expansion upon mating of ovoD1 females has been observed before (Reiff et al., 2015) and might be comparably high due to the different genetic background of ovoD1 flies compared to w1118 (Figure 2Q). While this work was in review, genetic ablation of ovarian ecdysteroidogenic enzymes was performed in female flies and resulted in a reduction of mitotic ISC. However, a direct assessment of 20HE titers was not performed and a mating dependent context was not analyzed (Ahmed et al., 2020). Taken together, current data cannot clearly dissect whether the ovary is the exclusive source of 20HE (Garen et al., 1977). In future experiments, 20HE titers have to be directly addressed to investigate whether other sources like the brain might be involved in 20HE release upon mating and other physiological stimuli (Chen et al., 2014; Itoh et al., 2011).

In the adjacent posterior midgut, we describe the impact of 20HE on Eip75B-A /- C expression (Figure 7H) and show that 20HE import triggers EcR-activation: i) in VF with low ovarian 20HE levels, overexpression of wild-type EcR and EcI are unable to elicit neither ISC proliferation nor differentiation effects (Figures 1–2). ii) pharmacological activation through RH5849 and Pioglitazone (Figures 2 and 4) as well as (iii) forced EcI expression induce proliferation and EB differentiation in MF mediated by Eip75B-A /- C (Figures 2, 3, 6 and 7). Together with the previous findings on JH upon mating (Reiff et al., 2015), our current data suggest a concerted role for JH on proliferation and 20HE on differentiation of midgut progenitors.

The interplay between Eip75B and Kr-h1 controls intestinal size adaptation

Downstream of the EcR, we found differential regulation of Eip75B isoforms upon mating. Eip75B activates egg production in ovarian GSC (Ables and Drummond-Barbosa, 2010; König et al., 2011; Morris and Spradling, 2012; Uyehara and McKay, 2019) and its knockdown reduces germarial size and number. In accordance with differentiation defects found in EB in our work, the number of cystoblasts, the immediate daughters of GSC, is reduced as well (Ables and Drummond-Barbosa, 2010; Morris and Spradling, 2012).

In our study, we dissected specific roles for Eip75B isoforms. Eip75B-B expression is at the lower detection limit (Figure 3B) and unchanged upon mating (Figure 3C). Thus, our finding that forced Eip75B-B expression raised ISC mitosis in VF (Figure 3—figure supplement 1F) might be due to ectopic expression. Eip75B-B mutants are viable and fertile and Eip75B-B is interacting with DNA only upon forming heterodimers with Hormone receptor 3 (Hr3) temporarily repressing gene expression (Bialecki et al., 2002; Sullivan and Thummel, 2003; White et al., 1997). Further studies of Eip75B-B, especially its expression pattern and transcriptional regulation, are necessary to elucidate in which physiological context, else than mating, Eip75B-B controls ISC proliferation.

Mating induction of Eip75B-A /- C, but not Eip75B-B, underlines their differential transcriptional regulation (Segraves and Hogness, 1990). This idea is supported by the finding that larval epidermis from Manduca sexta exposed to heightened JH-levels is sensitized to 20HE, which results in a 10-fold increase of Eip75B-A, but not of Eip75B-B expression (Dubrovskaya et al., 2004; Zhou et al., 1998). An in silico analysis of 4 kb regulatory regions upstream of Kr-h1 using JASPAR revealed several EcR/USP and Met consensus sequences (Khan et al., 2018), suggesting that both hormonal inputs may also converge on Kr-h1 driving ISC proliferation (Figure 5B; Reiff et al., 2015). We propose a synergistic interplay between JH- and 20HE-signaling upon mating, in which the JH pathway effector Kr-h1 increases proliferation in ISC and the EcR effectors Eip75B-A /- C drive EB into differentiation. The combined action of Kr-h1 and Eip75B-A /- C ensures mating induced organ size growth (Figures 5K and 7H). The experimental investigation of Eip75B and Kr-h1 regulatory regions incorporating endocrine signals from at least two different organs and leading to differential activity and function in ISC and EB will be a fascinating topic for future studies.

Eip75B/PPARγ and progenitor fate commitment in physiology and pathology

A key discovery of our study is that systemic 20HE directs local intestinal progenitor differentiation. Upon EcR activation, we found Eip75B-A /- C promoting EB to EC differentiation. When tissue demand arises, EB are thought to physically separate from ISC and become independent of N. Detached EB acquire motility and are able to postpone their terminal epithelial integration after initial specification (Antonello et al., 2015a; Antonello et al., 2015b; Martin et al., 2018; Siudeja et al., 2015). Epithelial integration of progenitors can be initiated experimentally by nubbin (nub) mediated downregulation of esg and the nub-RB isoform is sufficient to initiate EC formation downstream of Notch signaling (Korzelius et al., 2014; Tang et al., 2018).

Our data suggest, that the ecdysone pathway acting through Eip75B-A /- C provides a similar, remotely inducible signal for terminal EB differentiation. This idea is supported by several lines of evidence: i) EB-specific knockdown of Eip75B stalls their differentiation using kluReDDM (Figure 3—figure supplement 2E), suggesting Eip75B functions after initial N-input. ii) klu+-EB do not change fate upon Eip75B knockdown, suggesting a more mature EB differentiation status that already lost plasticity (Figure 3—figure supplement 2A–D; Korzelius et al., 2019; Reiff et al., 2019). iii) Forced Eip75B-A /- C expression in EB leads to their immediate differentiation independent of N-input (Figure 6C,D, Figure 7—figure supplement 1D,E). In addition, Eip75B was found to be highly expressed in EB in a recent study from the Perrimon lab (Hung et al., 2018), raising the question about its transcriptional regulation.

A plethora of studies established Eip75B as an early response gene downstream of the Ecdysone pathway (Ables and Drummond-Barbosa, 2010; König et al., 2011; Morris and Spradling, 2012; Thummel, 1996; Uyehara and McKay, 2019). Another pathway stimulating Eip75B expression in EB might be the N pathway. N activation leads to immediate EC differentiation of progenitors and thus phenocopies Eip75B-A /- C expression (Hudry et al., 2016; Reiff et al., 2019). Indeed, 20HE- and Notch-signaling have been shown to converge on target genes in various tissues and functions (Mitchell et al., 2013; Sun et al., 2008; Xu et al., 2018) and both pathways acetylate H3K56 modifying multiple regulatory genomic regions including Eip75B (Skalska et al., 2015). We observed that 20HE-signaling leads to the differentiation of progenitors to EC in a N LOF context (Figures 5 and 6, Figure 7—figure supplement 1). This is probably the result from strong genetic and pharmacological stimuli (Figures 6 and 7, Figure 7—figure supplement 1) acting through Eip75B. 20HE signaling might facilitate the expression of differentiation factors like Eip75B as well as klu in the presence of N signaling under normal physiological conditions (Figure 7—figure supplement 1F). Future in-depth analysis of Eip75B regulatory regions and the generation of Eip75B reporter flies will help to understand the interplay of 20HE and N signaling acting on Eip75B.

Confirming a close relationship between fly Eip75B and human PPARγ, we found midgut progenitors responding to the known PPARγ agonist Pioglitazone. In patients, PPARγ plays a role in i) pregnancy related adaptations of lipid metabolism (Waite et al., 2000) and ii) as target in colorectal cancer (CRC) (Sarraf et al., 1999). Decreased PPARγ levels are associated with development of insulin resistance and failure of lipolysis in obese pregnant women (Rodriguez-Cuenca et al., 2012; Vivas et al., 2016). Mating upregulates PPARγ/Eip75B (Figure 3) and we also describe increased lipid uptake upon EcR-activation (Figure 2—figure supplement 1) in absorptive EC. Srebp, a gene with known function in fatty acid metabolism, is also activated (Horton et al., 2003; Reiff et al., 2015; Seegmiller et al., 2002). Studying this interplay between SREBP, PPARγ and steroid hormone signaling will shed light on to which extent adaptation of intestinal size and lipid metabolism contribute to pathophysiological conditions like diabetes.

In CRC, PPARγ loss-of-function mutations are observed in around 8% of patients (Sarraf et al., 1999). PPARγ expression correlates with good prognosis and PPARγ is epigenetically silenced during CRC progression (Ogino et al., 2009; Pancione et al., 2010). In agreement with our in vivo experiments on Eip75B-A /- C in EB differentiation (Figures 3–7), in vitro studies identified PPARγ promoting differentiation in various colon cancer cell lines (Cesario et al., 2006; Shimizu and Moriwaki, 2008; Yamazaki et al., 2007; Yoshizumi et al., 2004).

In a CRC mouse model, biallelic loss of PPARγ leads to a 4-fold increase tumor incidence and reduced survival in female mice over males (ApcMin/+/PPARγ-/-) (McAlpine et al., 2006), whereas males develop around three times more colon tumors with wild type PPARγ (Cooper et al., 2005). In line with this, ovariectomized ApcMin/+ mice develop significantly more tumors and have decreased PPARγ expression, highlighting a possible link between PPARγ and estrogen signaling. Meta-analyses of hormone replacement studies have shown that estrogen confers a lower risk to develop CRC and better survival rates for female CRC patients (Chen et al., 1998; Hendifar et al., 2009; Lin et al., 2012).

It is tempting to speculate that this mechanism of steroid hormones signaling through EcR/ER (estrogen receptor) to activate Eip75B/PPARγ is conserved from flies to humans. Indeed, human estradiol and 20HE activate the EcR with similar affinity and elicit Eip75B transcription by binding to EcRE (Ecdysone-Responsive Elements). EcRE can be converted to functional ERE (estrogen responsive elements) by a simple change of nucleotide spacing suggesting high conservation (Martinez et al., 1991; Schwedes et al., 2011).

Taken together, our findings reveal that mating induced steroid hormone release, which signals to adjacent intestinal stem cells, controls their proliferation and, more importantly, differentiation of committed precursor cells through Eip75B/PPARγ. Ecdysone control of cell fate ensures the production of absorptive enterocytes during mating related intestinal adaptations and induces enterocyte fate in a Drosophila intestinal tumor model marked by loss of enterocyte differentiation. Mechanistically, we propose that Eip75B/PPARγ exerts an anti-neoplastic role by promoting progenitor differentiation into postmitotic enterocyte fate, thereby reducing the pool of mitotically active cells. Our findings might be a first step towards understanding the protective, but so far mechanistically unclear tumor suppressive role of steroid hormones in female colorectal cancer patients. Downstream of steroidal signaling, Eip75B/PPARγ promotes postmitotic cell fate when local signaling is deteriorated and thus might reflect a promising target for future studies in colorectal cancer models.

Materials and methods

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Genetic reagent (Drosophila melanogaster) esgReDDM Antonello et al., 2015a
DOI: 10.15252/embj.201591517
Figures 1–7; Figure 1—figure supplement 1; Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) esgReDDM > Eip75B-A Rabinovich et al., 2016
DOI: 10.1016/j.cell.2015.11.047
Figure 3; Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) esgReDDM > Eip75B-B Rabinovich et al., 2016
DOI: 10.1016/j.cell.2015.11.047
Figure 3; Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) esgReDDM > Eip75B-C Rabinovich et al., 2016
DOI: 10.1016/j.cell.2015.11.047
Figure 3; Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) Srebp > CD8::GFP Reiff et al., 2015
DOI: 10.7554/eLife.06930
Figure 2—figure supplement 1
Genetic reagent (D. melanogaster) Mex > ts Phillips and Thomas, 2006
DOI: 10.1242/jcs.02839
Figure 2—figure supplement 1
Genetic reagent (D. melanogaster) MARCM (FRT2A) Lee and Luo, 1999
DOI: 10.1016/S0896-6273 (00)80701–1
Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) Eip75A81-MARCM (FRT2A) Rabinovich et al., 2016
DOI: 10.1016/j.cell.2015.11.047
Figure 3—figure supplement 1
Genetic reagent (D. melanogaster) kluReDDM Reiff et al., 2019
DOI: 10.15252/embj.2018101346
Figure 3—figure supplement 2
Genetic reagent (D. melanogaster) N55e11-MARCM (FRT19A) Guo and Ohlstein, 2015
DOI: 10.1126/science.aab0988
Figure 7—figure supplement 1
Chemical compund, drug RH5849 DrEhrenstorfer DRE-C16813000 340 µM final concentration
Chemical compund, drug Pioglitazone Sigma-Aldrich Sigma-Aldrich 112529-15-4 14 µM final concentration

Genetics and fly husbandry/fly strains

OregonR and w1118 flies served as wild-type controls. The following transgenes and mutations were employed: esgReDDM (Antonello et al., 2015a), kluReDDM (Reiff et al., 2019), UAS-EcI-Flag-HA (Okamoto et al., 2018), UAS-EcI (Okamoto et al., 2018), UAS-EcI-RNAi (Okamoto et al., 2018), UAS-Eip75B-A-Flag (Rabinovich et al., 2016), UAS-Eip75B-B-Flag (Rabinovich et al., 2016), UAS-Eip75B-C-Flag (Rabinovich et al., 2016), UAS-NDN (J. Treisman), Dl::GFP (F. Schweisguth), N55e11 FRT19A (Guo and Ohlstein, 2015), Srebp-GAL4 (Kunte et al., 2006), Mex-Gal4 (Phillips and Thomas, 2006), Gbe+Su(H)dsRed (T. Klein). From Bloomington Drosophila Stock Center (BDSC): UAS-EcR-RNAi (BL58286), UAS-EcR.B2 (BL4934), UAS-EcR.B2W650A (BL9449), UAS-EcR.B2F645A (BL9450), EcRM554fs (BL4894), EcRE-lacZ (BL4516), Eip75BA81(BL23654), UAS-CD8::GFP (BL5137), ovoD1 (BL1309), NRE::GFP (BL30727), NRE::GFP (BL30728), Dlg-1::GFP (BL59417), From Kyoto Drosophila Stock Center: UAS-Kr-h1 (DGRC120052). From FlyORF, Switzerland: UAS-EcR-HA (F000480), UAS-Kr-h1 (F000495). From Vienna Drosophila Resource Center (VDRC) UAS-EcR-RNAi (GD37059), UAS-Eip75B-RNAi (GD44851), UAS-Eip75B-RNAi (KK108399), UAS-N-RNAi (GD14477).

MARCM clones

Mosaic analysis with repressible cell marker (MARCM; Lee and Luo, 1999) clones were induced in midguts by Flippase under control of a heat-shock promoter. Expression of the Flippase was activated for 45 min in a 37°C-water bath to induce positively marked clones. Guts were dissected 5 days after induction. Clones in experimental and control flies were induced in parallel.

Food composition and fly keeping

Fly food contained 1424 g corn meal, 900 g malt extract, 800 g sugar beet syrup, 336 g dried yeast, 190 g soy fluor, 100 g agarose, 90 ml propionic acid and 30 g NIPAGIN powder (antimycotic agent) in 20 l H2O. Food was cooked for about an hour to reduce bioburden, then filled into small plastic vials and cooled down to RT. Flies were kept at 25°C except for crosses with temperature-sensitive GAL80ts (GAL4 repressor) which were kept at 18°C (permissive temperature) until shifted to 29°C (restrictive temperature) to activate GAL4-mediated transgene expression. Crosses with esgReDDM and kluReDDM were carried out as described previously (Antonello et al., 2015a; Reiff et al., 2015; Reiff et al., 2019). Due to persisting problems with mucous formation on food surface in vials with VF, all experiments distinguishing between mated and virgin female flies were run on food with twice the amount of NIPAGIN. Mucous formation was avoided because of massive induction of tissue renewal by pathogenic stress.

Hormone analogue treatments

A vial of fly food was reheated in the microwave until it became liquid, the hormone analogues were added, thoroughly mixed and filled into a new vial. For each ml of food 5 µl of RH5849 (340 µM final concentration; 20 µg/µl stock solution, diluted in MeOH; DRE-C16813000, DrEhrenstorfer) was added. As a control, an equivalent volume of carrier solution (MeOH) was added to the food. Hormone analogue treatments were performed for the period of the 7 days ReDDM (Antonello et al., 2015a) shift.

PPARγ agonist treatments

A vial of fly food was reheated in the microwave until it became liquid, the PPARγ agonist was added, thoroughly mixed and filled into a new vial. For each ml of food 2.5 µl Pioglitazone (14 µM final concentration, 2 µg/µl stock solution, diluted in DMSO; Sigma-Aldrich, St. Louis, USA) were added. The equivalent amount of DMSO served as control. Flies were starved in an empty vial for at least six hours to ensure synchronized feeding when set to Pioglitazone. Food was renewed after three days and fly midguts were dissected after five days.

Immunohistochemistry

Guts were dissected in PBS and transferred into 4% PFA immediately after dissection and staining was performed on an orbital shaker. After 45 min of fixation guts were washed once with PBS for 10 min. Antibodies were diluted in 0.5% PBT + 5% normal goat serum. The incubation with primary antibodies (1:250 anti-Dlg-1 [mouse; Developmental studies Hybridoma Bank (DSHB)]; 1:50 anti-Pros [mouse; DSHB]; 1:2000 anti-pH3 [rabbit; Merck Millipore, 06–570]; 1:50 anti-EcR common Ag10.2 [mouse; DSHB]; 1:500 anti-HA High Affinity 3F10 [rat; Merck, Sigma-Aldrich]; 1:1500 anti-ß-Galactosidase preabsorbed [rabbit; Cappel Research Products]) was performed at 4°C over night. After washing with PBS guts were incubated with secondary antibodies (1:500 Goat anti-MouseAlexa647 [Invitrogen]; 1:500 Goat anti-RatAlexa647 [Invitrogen]; 1:500 Goat anti-RabbitAlexa647 [Invitrogen]) and DAPI (1:1000; 100 µg/ml stock solution in 0.18 M Tris pH 7.4; DAPI No. 18860, Serva, Heidelberg) for at least 3 hr at RT. Guts were washed a last time with PBS prior to mounting in Fluoromount-G Mounting Medium (Electron Microscopy Sciences).

X-Gal staining of Drosophila midguts

Guts were dissected in PBS and transferred into 4% PFA immediately after dissection. After 20 min of fixation, guts were washed three times with 0.3% PBT. Stainingbuffer (0.15M NaCl; 1 mM MgCl2; 10 mM Na-phosphate buffer pH 7.2; 3.3 mM F3Fe(CN)6, 3.3 mM K4Fe(CN)6; 0.3% Triton X-100) was heated to 65°C and 3% X-Gal added. The guts were stained for at least 1 hr at 37°C until a dark blue staining became visible. Guts were washed two times in 0.3% PBT prior to mounting in Fluoromount-G Mounting Medium (Electron Microscopy Sciences). Stained midguts were imaged using an Axiophot2 microscope (Carl Zeiss) equipped with an AxioCam MRc (Carl Zeiss).

OilRedO staining of Drosophila midguts

Guts were dissected in PBS and transferred into 4% PFA immediately after dissection. After 45 min of fixation, guts were washed in consecutive applications of 1xPBS, double-distilled H2O, and 60% isopropanol. Guts were stained in a 6:4 dilution of OilRedO (Sigma-Aldrich, 0.1% stock solution diluted in isopropanol) in dH2O for 20 min, then washed in 60% isopropanol and dH2O. After mounting in Fluoromount-G Mounting Medium (Electron Microscopy Sciences, emsdiasum) PMG were imaged using an Axiophot2 microscope (Carl Zeiss) equipped with an AxioCam MRc (Carl Zeiss). OilRedO staining intensity was analyzed using Fiji. RGB channels were split and the green channel was subtracted from the red channel to eliminate background signal. A fixed threshold was set, and guts were manually outlined as a ROI. The mean intensity of the resulting signal within the ROI was measured.

Image acquisition

Posterior midguts were imaged using an LSM 880 Airyscan confocal microscope (Carl Zeiss) using ‘Plan-Apochromat 10x/0.45 M27’, ‘Plan-Apochromat 20x/0.8 M27’ and ‘C-Apochromat 40x/1.20 W Corr M27’ objectives. Image resolution was set to at least 2048 × 2048 pixels. At least three focal planes (1 µm distance) were combined into a Z-stack to image one cell layer and to compensate for gut curvature.

For determining whole midgut length, an Axio Zoom.V16 (Carl Zeiss) was employed with DAPI filter and 1x/0.25-objective.

Quantification of proliferation and intensity measurements

Maximum intensity projections were calculated from Z-stack images of PMG by Fiji (ImageJ 1.51 n, Wayne Rasband, National Institutes of Health, USA). Total cell number and RFP-positive cell count of ReDDM (Antonello et al., 2015a) guts were analyzed semi-automatically by a self-written macro for Fiji whereas GFP-positive cells were counted manually (macro available from the authors).

For fluorescence or OilRedO intensity measurements, intestines were scanned with fixed laser/exposure time settings and measured in Fiji. The region of interest was selected manually, and mean intensity of the area was determined. This way, relative EcR and ß-Galactosidase protein levels were measured in antibody-stainings, relative SREBP activity was analyzed in PMG cells expressing mCD8::GFP under the control of Srebp-GAL4, and amount of triglycerides was analyzed by OilRedO stainings.

Jaspar

The open-access webtool JASPAR (Khan et al., 2018) was utilized to predict transcription factor binding sites within the 5’-UTR of EcI. It was specifically scanned for binding motifs related to Ecdysone and Juvenile Hormone signaling.

RNA isolation and cDNA synthesis

The R5 regions or ovaries of at least three female flies were dissected and transferred into a droplet of RNAlater Solution (Invitrogen by Thermo Fisher Scientific) on ice. The tissue was homogenized in 100 µl peqGOLD TriFast (VWR Life Science) and total RNA was isolated as specified by the manufacturer. The following cDNA synthesis was performed with 250 ng of total RNA and the SuperScript IV Reverse Transcriptase (Invitrogen by Thermo Fisher Scientific) using a 1:1 mixture of oligo-dT primers and random hexamers directly upon RNA isolation. Prior to Real-time qPCR, cDNA samples were diluted 1:2 in dH2O.

Verification of gene expression in the adult midgut by PCR

To verify gene expression in the adult Drosophila midgut, PCRs were performed with primer pairs specific for ovo and the Svb isoform, or isoform-specific primer pairs for EcR spanning at least one exon-exon boundary. PCRs were performed with Q5 High-Fidelity DNA Polymerase (NEB) for at least 30 cycles. Reaction products were loaded on an agarose gel (1.5%) and separated by electrophoresis to verify lengths of PCR products.

Primer Forward (5’−3’) Reverse (5’−3’)
EcR.A GGGGTCTAAGAAACATTTTGAGG CCATTTGCAGCTGCAGCCGACGT
EcR.B1 GCACGTACGAAGCCCGATCGCGT CCGGACTCGTTGCCGCAGAGCC
EcR.B2 GCACGTACGAAGCCCGATCGCGT CTCTTCCCTCTGTTCACGCCC
ovo CGCAGAGCCAAGATGTACGTG GATAGTGGACCTCCGGCT
SvbRep ACAGTAAGTTGCGAGCCGG TGTTTTGGGGTGTCCTTTCGTG

Real-time qPCR

Expression levels of Ecdysone signaling pathway-associated genes were determined in VF and MF. Eclosed OregonR or EcRE-LacZ flies were aged for 4d before mating. After 72 hr of mating, RNA was isolated and cDNA synthetized before running qPCRs. After an enzyme activation step (20 s 95°C), 40 cycles of denaturation (2 s 95°C), primer annealing (20 s 58°C) and elongation (20 s 72°C) were run. Primers were designed to anneal at 59°C. Reaction was set up with KAPA SYBR FAST Universal (Roche) in a total volume of 10 µl. All qPCR results were normalized to the house-keeping gene rp49.

Primer Forward (5’−3’) Reverse (5’−3’)
Eip74EF-A AGAAACTTCGAGGCAATAGGGT TGTGCGGCCTCATCTCAAG
Eip74EF-B TGGCCATCCCACAACGC GGGCGGAAATGAACCTGTTG
Eip75B-A CCTGTGCCAGAAGTTCGATGA AAGAATCCATCGGCATCTTCGT
Eip75B-B CGTCTAGCTCGATTCCTGATCTA CGGAAGAATCCCTTGCAACC
Eip75B-C CTGTGGTTCCGGCGGATT TCGAATTCTATGTTGAGTTCTGGTT
EcI TGCAGTGCCGCTCTCAACTGTACC TCACAGTAACCGTTGACCGCCTCC
EcR.A GTGTTCGGTGAAAAACGCAA TCCTAGCAACTGAGCTTTTGTAGAC
EcR.B1 TTAACGGTTGTTCGCTCGCA AGTGCGGGAAACAATCAGAGCAT
EcR.B2 GTTAACGGTTGTTCGCTCGC TGCGGGAAACAATCAGAGCATA
Kr-h1(A) ACAATTTTATGATTCAGCCACAACC GTTAGTGGAGGCGGAACCTG
Kr-h1(B) AAATCTTGGGCACCCAAACAA GTTGTGGCTGAATCTTTCGC
Lac-Z ATCAGGATATGTGGCGGATGAGCG AGTACAGCGCGGCTGAAATCATC
rp49 TGGTTTCCGGCAAGCTTCAA TGTTGTCGATACCCTTGGGC

20-HE isolation and titer determination

20-HE titers were determined in VF and MF of the same age. Eclosed OregonR or heterozygous ovoD1 mutant flies were aged for 3d before mating. After 24 hr or 48 hr at least 20 adult female flies were pierced in the thorax with a needle and put into a 150 µl-PCR tube that was punctured in its very bottom. Hemolymph was harvested by centrifugation (5.000x g 5 min RT) and collected in a 1.5 ml-reaction tube. Total weight of flies was determined before and after centrifugation. Typical yields of hemolymph were around 0.6–1 mg. The isolated hemolymph was mixed with 500 µl MeOH, centrifuged (12.000x g 20 min 4°C) and the supernatant was transferred into a new 1.5 ml-reaction tube. MeOH was evaporated at 30°C in a vacuum centrifuge (Eppendorf concentrator plus) and 20HE was resuspended in 100 µl EIA buffer and stored at −20°C until usage.

Ecdysone levels were determined using the 20-Hydroxyecdysone Enzyme Immunoassay kit according to manufacturer’s instructions (#A05120.96 wells; Bertin Bioreagent). 20HE titer was normalized to hemolymph yield.

Statistical analysis

Figures of quantifications were assembled, and statistics were run in GraphPad Prism 6.01. For single comparisons, data sets were analyzed by two-sided unpaired t-test. For multiple comparisons, data sets were analyzed by one-way ANOVA and Tukey’s post-hoc test. Significant differences are displayed as * for p≤0.05, ** for p≤0.01, *** for p≤0.001 and **** for p≤0.0001.

Acknowledgements

We thank Maria Dominguez, Thomas Klein, Oren Schuldiner, Francois Schweisguth, Naoki Yamanaka, the Bloomington Drosophila Stock Center (NIHP400D018537), the Transgenic RNAi Project (TRiP) at Harvard Medical School (NIK/NIGMS R01-GM084947) and the Vienna Drosophila Resource Center (VDRC, http://www.vdrc.at) for providing transgenic fly stocks. We thank the Center for Advanced Imaging (CAi) at HHU for providing microscopy services. TR thanks Maria Dominguez in whose lab he initiated this project and Thomas Klein for being a very supportive host. We also thank Zeus Antonello, Nahuel Villegas, Hendrik Pannen and Thomas Klein for comments on the manuscript. The project is funded by a Deutsche Forschungsgesellschaft (DFG-Sachbeihilfe RE 34532–1) grant. LZ is supported by the Wilhelm Sander-Stiftung (2018.145.1).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Tobias Reiff, Email: reifft@hhu.de.

Elisabeth Knust, Max-Planck Institute of Molecular Cell Biology and Genetics, Germany.

K VijayRaghavan, National Centre for Biological Sciences, Tata Institute of Fundamental Research, India.

Funding Information

This paper was supported by the following grants:

  • Deutsche Forschungsgemeinschaft RE 34532-1 to Tobias Reiff.

  • Wilhelm Sander-Stiftung 2018.145.1 to Lisa Zipper.

Additional information

Competing interests

No competing interests declared.

Author contributions

Investigation.

Investigation.

Investigation.

Investigation.

Conceptualization, Funding acquisition, Investigation, Writing - original draft, Writing - review and editing.

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided in a separate Excel File.

References

  1. Ables ET, Drummond-Barbosa D. The steroid hormone ecdysone functions with intrinsic chromatin remodeling factors to control female germline stem cells in Drosophila. Cell Stem Cell. 2010;7:581–592. doi: 10.1016/j.stem.2010.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Ahmed SMH, Maldera JA, Krunic D, Paiva-Silva GO, Pénalva C, Teleman AA, Edgar BA. Fitness trade-offs incurred by ovary-to-gut steroid signalling in Drosophila. Nature. 2020;584:415–419. doi: 10.1038/s41586-020-2462-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ameku T, Yoshinari Y, Fukuda R, Niwa R. Ovarian ecdysteroid biosynthesis and female germline stem cells. Fly. 2017;11:185–193. doi: 10.1080/19336934.2017.1291472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ameku T, Niwa R. Mating-Induced increase in germline stem cells via the neuroendocrine system in female Drosophila. PLOS Genetics. 2016;12:e1006123. doi: 10.1371/journal.pgen.1006123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Antonello ZA, Reiff T, Ballesta-Illan E, Dominguez M. Robust intestinal homeostasis relies on cellular plasticity in enteroblasts mediated by miR-8-Escargot switch. The EMBO Journal. 2015a;34:2025–2041. doi: 10.15252/embj.201591517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Antonello ZA, Reiff T, Dominguez M. Mesenchymal to epithelial transition during tissue homeostasis and regeneration: patching up the Drosophila midgut epithelium. Fly. 2015b;9:132–137. doi: 10.1080/19336934.2016.1140709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Athippozhy A, Huang L, Wooton-Kee CR, Zhao T, Jungsuwadee P, Stromberg AJ, Vore M. Differential gene expression in liver and small intestine from lactating rats compared to age-matched virgin controls detects increased mRNA of cholesterol biosynthetic genes. BMC Genomics. 2011;12:95. doi: 10.1186/1471-2164-12-95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bernardo TJ, Dubrovskaya VA, Xie X, Dubrovsky EB. A view through a chromatin loop: insights into the ecdysone activation of early genes in Drosophila. Nucleic Acids Research. 2014;42:10409–10424. doi: 10.1093/nar/gku754. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bialecki M, Shilton A, Fichtenberg C, Segraves WA, Thummel CS. Loss of the ecdysteroid-inducible E75A orphan nuclear receptor uncouples molting from metamorphosis in Drosophila. Developmental Cell. 2002;3:209–220. doi: 10.1016/S1534-5807(02)00204-6. [DOI] [PubMed] [Google Scholar]
  10. Bownes M, Dübendorfer A, Smith T. Ecdysteroids in adult males and females of Drosophila melanogaster. Journal of Insect Physiology. 1984;30:823–830. doi: 10.1016/0022-1910(84)90019-2. [DOI] [Google Scholar]
  11. Busson D, Gans M, Komitopoulou K, Masson M. Genetic analysis of three dominant Female-Sterile mutations located on the X chromosome of Drosophila melanogaster. Genetics. 1983;105:309–325. doi: 10.1093/genetics/105.2.309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Carvalho GB, Kapahi P, Anderson DJ, Benzer S. Allocrine modulation of feeding behavior by the sex peptide of Drosophila. Current Biology. 2006;16:692–696. doi: 10.1016/j.cub.2006.02.064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cesario RM, Stone J, Yen WC, Bissonnette RP, Lamph WW. Differentiation and growth inhibition mediated via the RXR:ppargamma heterodimer in Colon cancer. Cancer Letters. 2006;240:225–233. doi: 10.1016/j.canlet.2005.09.010. [DOI] [PubMed] [Google Scholar]
  14. Chen MJ, Longnecker MP, Morgenstern H, Lee ER, Frankl HD, Haile RW. Recent use of hormone replacement therapy and the prevalence of colorectal adenomas. Cancer Epidemiology Biomarkers Prevention. 1998;7:227–230. [PubMed] [Google Scholar]
  15. Chen W, Liu Z, Li T, Zhang R, Xue Y, Zhong Y, Bai W, Zhou D, Zhao Z. Regulation of Drosophila circadian rhythms by miRNA let-7 is mediated by a regulatory cycle. Nature Communications. 2014;5:5549. doi: 10.1038/ncomms6549. [DOI] [PubMed] [Google Scholar]
  16. Chen J, Xu N, Huang H, Cai T, Xi R. A feedback amplification loop between stem cells and their progeny promotes tissue regeneration and tumorigenesis. eLife. 2016;5:e14330. doi: 10.7554/eLife.14330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chen J, Xu N, Wang C, Huang P, Huang H, Jin Z, Yu Z, Cai T, Jiao R, Xi R. Transient scute activation via a self-stimulatory loop directs enteroendocrine cell pair specification from self-renewing intestinal stem cells. Nature Cell Biology. 2018;20:152–161. doi: 10.1038/s41556-017-0020-0. [DOI] [PubMed] [Google Scholar]
  18. Cherbas L, Hu X, Zhimulev I, Belyaeva E, Cherbas P. EcR isoforms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue. Development. 2003;130:271–284. doi: 10.1242/dev.00205. [DOI] [PubMed] [Google Scholar]
  19. Cognigni P, Bailey AP, Miguel-Aliaga I. Enteric neurons and systemic signals couple nutritional and reproductive status with intestinal homeostasis. Cell Metabolism. 2011;13:92–104. doi: 10.1016/j.cmet.2010.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Cooper HS, Chang WC, Coudry R, Gary MA, Everley L, Spittle CS, Wang H, Litwin S, Clapper ML. Generation of a unique strain of multiple intestinal neoplasia (Apc(+/Min-FCCC)) mice with significantly increased numbers of colorectal adenomas. Molecular Carcinogenesis. 2005;44:31–41. doi: 10.1002/mc.20114. [DOI] [PubMed] [Google Scholar]
  21. Dubrovskaya VA, Berger EM, Dubrovsky EB. Juvenile hormone regulation of the E75 nuclear receptor is conserved in diptera and lepidoptera. Gene. 2004;340:171–177. doi: 10.1016/j.gene.2004.07.022. [DOI] [PubMed] [Google Scholar]
  22. Enya S, Ameku T, Igarashi F, Iga M, Kataoka H, Shinoda T, Niwa R. A halloween gene noppera-bo encodes a glutathione S-transferase essential for ecdysteroid biosynthesis via regulating the behaviour of cholesterol in Drosophila. Scientific Reports. 2014;4:6586. doi: 10.1038/srep06586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Figueroa-Clarevega A, Bilder D. Malignant Drosophila tumors interrupt insulin signaling to induce cachexia-like wasting. Developmental Cell. 2015;33:47–55. doi: 10.1016/j.devcel.2015.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Garen A, Kauvar L, Lepesant JA. Roles of ecdysone in Drosophila development. PNAS. 1977;74:5099–5103. doi: 10.1073/pnas.74.11.5099. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gilbert LI, Rybczynski R, Warren JT. Control and biochemical nature of the ecdysteroidogenic pathway. Annual Review of Entomology. 2002;47:883–916. doi: 10.1146/annurev.ento.47.091201.145302. [DOI] [PubMed] [Google Scholar]
  26. Gilbert LI, Warren JT. A molecular genetic approach to the biosynthesis of the insect steroid molting hormone. Vitamins and Hormones. 2005;73:31–57. doi: 10.1016/S0083-6729(05)73002-8. [DOI] [PubMed] [Google Scholar]
  27. Gillies PS, Dunn CJ. Pioglitazone. Drugs. 2000;60:333–343. doi: 10.2165/00003495-200060020-00009. [DOI] [PubMed] [Google Scholar]
  28. Guo Z, Ohlstein B. Stem cell regulation bidirectional notch signaling regulates Drosophila intestinal stem cell multipotency. Science. 2015;350:aab0988. doi: 10.1126/science.aab0988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Hammond KA. Adaptation of the maternal intestine during lactation. Journal of Mammary Gland Biology and Neoplasia. 1997;2:243–252. doi: 10.1023/a:1026332304435. [DOI] [PubMed] [Google Scholar]
  30. Harshman LG, Loeb AM, Johnson BA. Ecdysteroid titers in mated and unmated Drosophila melanogaster females. Journal of Insect Physiology. 1999;45:571–577. doi: 10.1016/S0022-1910(99)00038-4. [DOI] [PubMed] [Google Scholar]
  31. Hendifar A, Yang D, Lenz F, Lurje G, Pohl A, Lenz C, Ning Y, Zhang W, Lenz HJ. Gender disparities in metastatic colorectal Cancer survival. Clinical Cancer Research. 2009;15:6391–6397. doi: 10.1158/1078-0432.CCR-09-0877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS, Goldstein JL. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. PNAS. 2003;100:12027–12032. doi: 10.1073/pnas.1534923100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Hudry B, Khadayate S, Miguel-Aliaga I. The sexual identity of adult intestinal stem cells controls organ size and plasticity. Nature. 2016;530:344–348. doi: 10.1038/nature16953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hung R-J, Hu C, Kirchner R, Li F, Xu C. A cell atlas of the adult Drosophila midgut. PNAS. 2018;117:1514–1523. doi: 10.1073/pnas.1916820117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Itoh TQ, Tanimura T, Matsumoto A. Membrane-bound transporter controls the circadian transcription of clock genes in Drosophila. Genes to Cells. 2011;16:1159–1167. doi: 10.1111/j.1365-2443.2011.01559.x. [DOI] [PubMed] [Google Scholar]
  36. Jafari M, Khodayari B, Felgner J, Bussel II, Rose MR, Mueller LD. Pioglitazone: an anti-diabetic compound with anti-aging properties. Biogerontology. 2007;8:639–651. doi: 10.1007/s10522-007-9105-7. [DOI] [PubMed] [Google Scholar]
  37. Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, Kageyama R, Guillemot F, Serup P, Madsen OD. Control of endodermal endocrine development by Hes-1. Nature Genetics. 2000;24:36–44. doi: 10.1038/71657. [DOI] [PubMed] [Google Scholar]
  38. Jiang C, Baehrecke EH, Thummel CS. Steroid regulated programmed cell death during Drosophila metamorphosis. Development. 1997;124:4673–4683. doi: 10.1242/dev.124.22.4673. [DOI] [PubMed] [Google Scholar]
  39. Jiang C, Lamblin AF, Steller H, Thummel CS. A steroid-triggered transcriptional hierarchy controls salivary gland cell death during Drosophila metamorphosis. Molecular Cell. 2000;5:445–455. doi: 10.1016/S1097-2765(00)80439-6. [DOI] [PubMed] [Google Scholar]
  40. Jindra M, Palli SR, Riddiford LM. The juvenile hormone signaling pathway in insect development. Annual Review of Entomology. 2013;58:181–204. doi: 10.1146/annurev-ento-120811-153700. [DOI] [PubMed] [Google Scholar]
  41. Joardar A, Menzl J, Podolsky TC, Manzo E, Estes PS, Ashford S, Zarnescu DC. PPAR gamma activation is neuroprotective in a Drosophila model of ALS based on TDP-43. Human Molecular Genetics. 2015;24:1741–1754. doi: 10.1093/hmg/ddu587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Karim FD, Thummel CS. Ecdysone coordinates the timing and amounts of E74A and E74B transcription in Drosophila. Genes & Development. 1991;5:1067–1079. doi: 10.1101/gad.5.6.1067. [DOI] [PubMed] [Google Scholar]
  43. Khan A, Fornes O, Stigliani A, Gheorghe M, Castro-Mondragon JA, van der Lee R, Bessy A, Chèneby J, Kulkarni SR, Tan G, Baranasic D, Arenillas DJ, Sandelin A, Vandepoele K, Lenhard B, Ballester B, Wasserman WW, Parcy F, Mathelier A. JASPAR 2018: update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Research. 2018;46:D260–D266. doi: 10.1093/nar/gkx1126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. King-Jones K, Thummel CS. Nuclear receptors — a perspective from Drosophila. Nature Reviews Genetics. 2005;6:311–323. doi: 10.1038/nrg1581. [DOI] [PubMed] [Google Scholar]
  45. Klepsatel P, Gáliková M, De Maio N, Ricci S, Schlötterer C, Flatt T. Reproductive and post-reproductive life history of wild-caught Drosophila melanogaster under laboratory conditions. Journal of Evolutionary Biology. 2013;26:1508–1520. doi: 10.1111/jeb.12155. [DOI] [PubMed] [Google Scholar]
  46. König A, Yatsenko AS, Weiss M, Shcherbata HR. Ecdysteroids affect Drosophila ovarian stem cell niche formation and early germline differentiation. The EMBO Journal. 2011;30:1549–1562. doi: 10.1038/emboj.2011.73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Korzelius J, Naumann S, Loza‐Coll M A, Sk Chan J, Dutta D. Escargot maintains stemness and suppresses differentiation in Drosophila intestinal stem cells. Embo J. . 2014;33:2967–2982. doi: 10.15252/embj.201489072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Korzelius J, Azami S, Ronnen-Oron T, Koch P, Baldauf M, Meier E, Rodriguez-Fernandez IA, Groth M, Sousa-Victor P, Jasper H. The WT1-like transcription factor klumpfuss maintains lineage commitment of enterocyte progenitors in the Drosophila intestine. Nature Communications. 2019;10:4123. doi: 10.1038/s41467-019-12003-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Kozlova T, Thummel CS. Steroid regulation of postembryonic development and reproduction in Drosophila. Trends in Endocrinology & Metabolism. 2000;11:276–280. doi: 10.1016/S1043-2760(00)00282-4. [DOI] [PubMed] [Google Scholar]
  50. Kunte AS, Matthews KA, Rawson RB. Fatty acid auxotrophy in Drosophila larvae lacking SREBP. Cell Metabolism. 2006;3:439–448. doi: 10.1016/j.cmet.2006.04.011. [DOI] [PubMed] [Google Scholar]
  51. Kwon Y, Song W, Droujinine IA, Hu Y, Asara JM, Perrimon N. Systemic organ wasting induced by localized expression of the secreted insulin/IGF antagonist ImpL2. Developmental Cell. 2015;33:36–46. doi: 10.1016/j.devcel.2015.02.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Lee T, Luo L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22:451–461. doi: 10.1016/S0896-6273(00)80701-1. [DOI] [PubMed] [Google Scholar]
  53. Lin BR, Huang MT, Chen ST, Jeng YM, Li YJ, Liang JT, Lee PH, Chang KJ, Chang CC. Prognostic significance of TWEAK expression in colorectal Cancer and effect of its inhibition on invasion. Annals of Surgical Oncology. 2012;19 Suppl 3:385–394. doi: 10.1245/s10434-011-1825-x. [DOI] [PubMed] [Google Scholar]
  54. Martin JL, Sanders EN, Moreno-Roman P, Jaramillo Koyama LA, Balachandra S, Du X, O'Brien LE. Long-term live imaging of the Drosophila adult midgut reveals real-time dynamics of division, differentiation and loss. eLife. 2018;7:e36248. doi: 10.7554/eLife.36248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Martinez E, Givel F, Wahli W. A common ancestor DNA motif for invertebrate and vertebrate hormone response elements. The EMBO Journal. 1991;10:263–268. doi: 10.1002/j.1460-2075.1991.tb07946.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. McAlpine CA, Barak Y, Matise I, Cormier RT. Intestinal-specific PPARgamma deficiency enhances tumorigenesis in ApcMin/+ mice. International Journal of Cancer. 2006;119:2339–2346. doi: 10.1002/ijc.22115. [DOI] [PubMed] [Google Scholar]
  57. Micchelli CA, Perrimon N. Evidence that stem cells reside in the adult Drosophila midgut epithelium. Nature. 2006;439:475–479. doi: 10.1038/nature04371. [DOI] [PubMed] [Google Scholar]
  58. Miguel-Aliaga I, Jasper H, Lemaitre B. Anatomy and physiology of the digestive tract of Drosophila melanogaster. Genetics. 2018;210:357–396. doi: 10.1534/genetics.118.300224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Mitchell NC, Lin JI, Zaytseva O, Cranna N, Lee A, Quinn LM. The ecdysone receptor constrains wingless expression to pattern cell cycle across the Drosophila wing margin in a cyclin B-dependent manner. BMC Developmental Biology. 2013;13:28. doi: 10.1186/1471-213X-13-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Morris LX, Spradling AC. Steroid signaling within Drosophila ovarian epithelial cells sex-specifically modulates early germ cell development and meiotic entry. PLOS ONE. 2012;7:e46109. doi: 10.1371/journal.pone.0046109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Ogino S, Shima K, Baba Y, Nosho K, Irahara N, Kure S, Chen L, Toyoda S, Kirkner GJ, Wang YL, Giovannucci EL, Fuchs CS. Colorectal Cancer expression of peroxisome proliferator-activated receptor gamma (PPARG, PPARgamma) is associated with good prognosis. Gastroenterology. 2009;136:1242–1250. doi: 10.1053/j.gastro.2008.12.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Ohlstein B, Spradling A. The adult Drosophila posterior midgut is maintained by pluripotent stem cells. Nature. 2006;439:470–474. doi: 10.1038/nature04333. [DOI] [PubMed] [Google Scholar]
  63. Ohlstein B, Spradling A. Multipotent Drosophila intestinal stem cells specify daughter cell fates by differential notch signaling. Science. 2007;315:988–992. doi: 10.1126/science.1136606. [DOI] [PubMed] [Google Scholar]
  64. Okamoto N, Viswanatha R, Bittar R, Li Z, Haga-Yamanaka S, Perrimon N, Yamanaka N. A membrane transporter is required for steroid hormone uptake in Drosophila. Developmental Cell. 2018;47:294–305. doi: 10.1016/j.devcel.2018.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Oliver B, Perrimon N, Mahowald AP. The ovo locus is required for sex-specific germ line maintenance in Drosophila. Genes & Development. 1987;1:913–923. doi: 10.1101/gad.1.9.913. [DOI] [PubMed] [Google Scholar]
  66. Pancione M, Sabatino L, Fucci A, Carafa V, Nebbioso A, Forte N, Febbraro A, Parente D, Ambrosino C, Normanno N, Altucci L, Colantuoni V. Epigenetic silencing of peroxisome proliferator-activated receptor γ is a biomarker for colorectal Cancer progression and adverse patients' outcome. PLOS ONE. 2010;5:e14229. doi: 10.1371/journal.pone.0014229. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  67. Patel PH, Dutta D, Edgar BA. Niche appropriation by Drosophila intestinal stem cell tumours. Nature Cell Biology. 2015;17:1182–1192. doi: 10.1038/ncb3214. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Phillips MD, Thomas GH. Brush border spectrin is required for early endosome recycling in Drosophila. Journal of Cell Science. 2006;119:1361–1370. doi: 10.1242/jcs.02839. [DOI] [PubMed] [Google Scholar]
  69. Pianka ER. On r- and K-Selection. The American Naturalist. 1970;104:592–597. doi: 10.1086/282697. [DOI] [Google Scholar]
  70. Rabinovich D, Yaniv SP, Alyagor I, Schuldiner O. Nitric oxide as a switching mechanism between axon degeneration and regrowth during developmental remodeling. Cell. 2016;164:170–182. doi: 10.1016/j.cell.2015.11.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Reiff T, Jacobson J, Cognigni P, Antonello Z, Ballesta E, Tan KJ, Yew JY, Dominguez M, Miguel-Aliaga I. Endocrine remodelling of the adult intestine sustains reproduction in Drosophila. eLife. 2015;4:e06930. doi: 10.7554/eLife.06930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Reiff T, Antonello ZA, Ballesta-Illán E, Mira L, Sala S, Navarro M, Martinez LM, Dominguez M. Notch and EGFR regulate apoptosis in progenitor cells to ensure gut homeostasis in Drosophila. The EMBO Journal. 2019;38:e101346. doi: 10.15252/embj.2018101346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Ribeiro C, Dickson BJ. Sex peptide receptor and neuronal TOR/S6K signaling modulate nutrient balancing in Drosophila. Current Biology. 2010;20:1000–1005. doi: 10.1016/j.cub.2010.03.061. [DOI] [PubMed] [Google Scholar]
  74. Roa J, Tena-Sempere M. Connecting metabolism and reproduction: roles of central energy sensors and key molecular mediators. Molecular and Cellular Endocrinology. 2014;397:4–14. doi: 10.1016/j.mce.2014.09.027. [DOI] [PubMed] [Google Scholar]
  75. Robinson PD, Morgan ED, Wilson ID, Lafont R. The metabolism of ingested and injected [3H]ecdysone by final instar larvae of Heliothis armigera. Physiological Entomology. 1987;12:321–330. doi: 10.1111/j.1365-3032.1987.tb00757.x. [DOI] [Google Scholar]
  76. Rodriguez-Cuenca S, Carobbio S, Velagapudi VR, Barbarroja N, Moreno-Navarrete JM, Tinahones FJ, Fernandez-Real JM, Orešic M, Vidal-Puig A. Peroxisome proliferator-activated receptor γ-dependent regulation of lipolytic nodes and metabolic flexibility. Molecular and Cellular Biology. 2012;32:1555–1565. doi: 10.1128/MCB.06154-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Sarraf P, Mueller E, Smith WM, Wright HM, Kum JB, Aaltonen LA, de la Chapelle A, Spiegelman BM, Eng C. Loss-of-Function mutations in pparγ associated with human Colon cancer. Molecular Cell. 1999;3:799–804. doi: 10.1016/S1097-2765(01)80012-5. [DOI] [PubMed] [Google Scholar]
  78. Schwedes C, Tulsiani S, Carney GE. Ecdysone receptor expression and activity in adult Drosophila melanogaster. Journal of Insect Physiology. 2011;57:899–907. doi: 10.1016/j.jinsphys.2011.03.027. [DOI] [PubMed] [Google Scholar]
  79. Seegmiller AC, Dobrosotskaya I, Goldstein JL, Ho YK, Brown MS, Rawson RB. The SREBP pathway in Drosophila: regulation by Palmitate, not sterols. Developmental Cell. 2002;2:229–238. doi: 10.1016/s1534-5807(01)00119-8. [DOI] [PubMed] [Google Scholar]
  80. Segraves WA, Hogness DS. The E75 ecdysone-inducible gene responsible for the 75B early puff in Drosophila encodes two new members of the steroid receptor superfamily. Genes & Development. 1990;4:204–219. doi: 10.1101/gad.4.2.204. [DOI] [PubMed] [Google Scholar]
  81. Shimizu M, Moriwaki H. Synergistic effects of PPARgamma ligands and retinoids in Cancer treatment. PPAR Research. 2008;2008:181047. doi: 10.1155/2008/181047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Siudeja K, Nassari S, Gervais L, Skorski P, Lameiras S, Stolfa D, Zande M, Bernard V, Frio TR, Bardin AJ. Frequent somatic mutation in adult intestinal stem cells drives neoplasia and genetic mosaicism during aging. Cell Stem Cell. 2015;17:663–674. doi: 10.1016/j.stem.2015.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Skalska L, Stojnic R, Li J, Fischer B, Cerda-Moya G, Sakai H, Tajbakhsh S, Russell S, Adryan B, Bray SJ. Chromatin signatures at Notch-regulated enhancers reveal large-scale changes in H3K56ac upon activation. The EMBO Journal. 2015;34:1889–1904. doi: 10.15252/embj.201489923. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Sullivan AA, Thummel CS. Temporal profiles of nuclear receptor gene expression reveal coordinate transcriptional responses during Drosophila development. Molecular Endocrinology. 2003;17:2125–2137. doi: 10.1210/me.2002-0430. [DOI] [PubMed] [Google Scholar]
  85. Sun J, Smith L, Armento A, Deng WM. Regulation of the endocycle/gene amplification switch by notch and ecdysone signaling. Journal of Cell Biology. 2008;182:885–896. doi: 10.1083/jcb.200802084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Talbot WS, Swyryd EA, Hogness DS. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell. 1993;73:1323–1337. doi: 10.1016/0092-8674(93)90359-X. [DOI] [PubMed] [Google Scholar]
  87. Tang X, Zhao Y, Buchon N, Engström Y. The POU/Oct transcription factor nubbin controls the balance of intestinal stem cell maintenance and differentiation by Isoform-Specific regulation. Stem Cell Reports. 2018;10:1565–1578. doi: 10.1016/j.stemcr.2018.03.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Thummel CS. Flies on steroids--Drosophila metamorphosis and the mechanisms of steroid hormone action. Trends in Genetics. 1996;12:306–310. doi: 10.1016/0168-9525(96)10032-9. [DOI] [PubMed] [Google Scholar]
  89. Truman JW, Riddiford LM. Endocrine insights into the evolution of metamorphosis in insects. Annual Review of Entomology. 2002;47:467–500. doi: 10.1146/annurev.ento.47.091201.145230. [DOI] [PubMed] [Google Scholar]
  90. Uyehara CM, McKay DJ. Direct and widespread role for the nuclear receptor EcR in mediating the response to ecdysone in Drosophila. PNAS. 2019;116:9893–9902. doi: 10.1073/pnas.1900343116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. VanDussen KL, Carulli AJ, Keeley TM, Patel SR, Puthoff BJ, Magness ST, Tran IT, Maillard I, Siebel C, Kolterud Å, Grosse AS, Gumucio DL, Ernst SA, Tsai YH, Dempsey PJ, Samuelson LC. Notch signaling modulates proliferation and differentiation of intestinal crypt base columnar stem cells. Development. 2012;139:488–497. doi: 10.1242/dev.070763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  92. Vivas Y, Díez-Hochleitner M, Izquierdo-Lahuerta A, Corrales P, Horrillo D. Peroxisome proliferator activated receptor gamma 2 modulates late pregnancy homeostatic metabolic adaptations.  Molecular Medicine. 2016;22:724–736. doi: 10.2119/molmed.2015.00262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  93. Waite LL, Person EC, Zhou Y, Lim KH, Scanlan TS, Taylor RN. Placental peroxisome proliferator-activated receptor-gamma is up-regulated by pregnancy serum. The Journal of Clinical Endocrinology and Metabolism. 2000;85:3808–3814. doi: 10.1210/jcem.85.10.6847. [DOI] [PubMed] [Google Scholar]
  94. White KP, Hurban P, Watanabe T, Hogness DS. Coordination of Drosophila metamorphosis by two ecdysone-induced nuclear receptors. Science. 1997;276:114–117. doi: 10.1126/science.276.5309.114. [DOI] [PubMed] [Google Scholar]
  95. Wing KD, Slawecki RA, Carlson GR. RH 5849, a nonsteroidal ecdysone agonist: effects on larval lepidoptera. Science. 1988;241:470–472. doi: 10.1126/science.241.4864.470. [DOI] [PubMed] [Google Scholar]
  96. Xu K, Liu X, Wang Y, Wong C, Song Y. Temporospatial induction of homeodomain gene cut dictates natural lineage reprogramming. eLife. 2018;7:e33934. doi: 10.7554/eLife.33934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Yamazaki K, Shimizu M, Okuno M, Matsushima-Nishiwaki R, Kanemura N, Araki H, Tsurumi H, Kojima S, Weinstein IB, Moriwaki H. Synergistic effects of RXR alpha and PPAR gamma ligands to inhibit growth in human Colon cancer cells--phosphorylated RXR alpha is a critical target for Colon cancer management. Gut. 2007;56:1557–1563. doi: 10.1136/gut.2007.129858. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Yoshizumi T, Ohta T, Ninomiya I, Terada I, Fushida S, Fujimura T, Nishimura G, Shimizu K, Yi S, Miwa K. Thiazolidinedione, a peroxisome proliferator-activated receptor-gamma ligand, inhibits growth and metastasis of HT-29 human Colon cancer cells through differentiation-promoting effects. International Journal of Oncology. 2004;25:631–639. [PubMed] [Google Scholar]
  99. Zhou B, Hiruma K, Jindra M, Shinoda T, Segraves WA, Malone F, Riddiford LM. Regulation of the transcription factor E75 by 20-hydroxyecdysone and juvenile hormone in the epidermis of the tobacco hornworm, Manduca sexta, during larval molting and metamorphosis. Developmental Biology. 1998;193:127–138. doi: 10.1006/dbio.1997.8798. [DOI] [PubMed] [Google Scholar]

Decision letter

Editor: Elisabeth Knust1
Reviewed by: Jerome Korzelius2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for submitting your article "Ecdysone steroid hormone remote controls intestinal stem cell fate decisions via the PPARγ-homologue E75B in Drosophila" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Reviewing Editor and K VijayRaghavan as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Jerome Korzelius (Reviewer #3).

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

We would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). Specifically, when editors judge that a submitted work as a whole belongs in eLife but that some conclusions require a modest amount of additional new data, as they do with your paper, we are asking that the manuscript be revised to either limit claims to those supported by data in hand or to explicitly state that the relevant conclusions require additional supporting data.

Our expectation is that the authors will eventually carry out the additional experiments and report on how they affect the relevant conclusions either in a preprint on bioRxiv or medRxiv, or if appropriate, as a Research Advance in eLife, either of which would be linked to the original paper.

Summary:

In this manuscript, the authors present evidence on the role of 20-Hydroxy-Ecdysone (20HE), secreted from the ovaries, in controlling proliferation and differentiation of intestinal stem cells into Enterocytes in the adult midgut of Drosophila females after mating. In the model presented, the authors propose that, following mating, 20HE secreted from the ovaries induce activation of EcR signaling within ISCs/EBs to drive EB differentiation into Enterocytes. They observed differential responses of 20HE on known target genes and followed the role of these target genes on stem cell proliferation and differentiation. The analysis of different isoforms of the ecdysone-target Eip75B reveals different roles for different isoforms of this PPARγ orthologue, with isoforms -A and -C being involved in regulation of EB-differentiation and the -B isoform inducing ISC mitosis. Additionally, activation of EcR signaling in Enterocytes is necessary for metabolic adaptation (lipid metabolism) in the gut in response to mating. Furthermore, the authors analysed the interplay between the 20HE- and the juvenile hormone-pathways. Interestingly, Ec signaling counteracts Notch driven tumourigenesis in the adult midgut.

Overall, this is an impressive volume of work that reveals a novel role for the ubiquitous ecdysone hormone in both ISC proliferation and progenitor differentiation. This connects well with recent work from the Miguel-Aliaga and Perrimon labs that has explored inter-organ communication from neighbouring tissues such as fat body and ovary to the intestine. It also invites further inquiry into the interplay between mating and the Insulin-dependent growth response upon re-feeding of the midgut (O'Brien et al., 2011).

Essential revisions:

According to the reviewers, there are two major conclusions that need to be revisited to be fully supported.

1) There is no evidence on the where the source of 20HE comes from. The authors claim that this is the ovary but there is no experimental proof of that. Suppression of 20HE synthesis in the ovary followed by assessment of ISC proliferation/differentiation and gut metabolic adaptation should address this point. Therefore, the systemic control of Ec signaling in the gut needs to be demonstrated. It represents the heart of the paper and what makes it more interesting/novel. In fact, towards the end of the abstract the authors conclude: 'To our knowledge, this is the first time a systemic hormone is shown to direct local stem cell fate decisions. ' This has not been tested and sources other than the ovaries could be playing a role.

2) The effect of Ec signaling activation on Notch-/- tumours does not prove a direct connection between the two phenomena. This could be the consequence of parallel action of two pathways with opposite effects. Is Ec signaling impaired in Notch tumours? This is key to connect both phenomena and substantiate a major claim of the paper.

The reviewers agreed that the Notch/Ec interaction is a bit overinterpreted in the manuscript, but some re-writing and combining all Notch results in Figure 5 and Figure 6 would fix this. The authors need to soften their claims and acknowledge the limitations of their experiments. This would also leave more room for some of the interesting data from the supplement regarding EE differentiation of E75A MARCM clones or the SREBP activation in Enterocytes to be included in the main manuscript.

Reviewer #1:

In this manuscript, the authors present data to show that in addition to juvenile hormone (shown in their previous paper, 2017) a second hormone, 20-Hydroxy-Ecdysone (20HE), controls proliferation and differentiation of intestinal stem cells in Drosophila females after mating. They used a system established previously, the ReDDM lineage method, to analyse the role of the 20HE-signalling pathway. They applied various genetic and pharmacological perturbations, such as overexpression and knock-down by RNAi and application of the ecdysone agonist, RH5849. They observed differential responses of 20HO on known target genes and followed the role of these target genes on stem cell proliferation and differentiation. They analysed the interplay between the 20HO- and the juvenile hormone-pathways. Finally, they present data to suggest that 20HO-mediated signalling can overcome the defects in differentiation observed upon inactivation of the Notch signalling pathway.

Major points:

1) Overall, these are interesting data and add novel insight into the way of tissue adaptation to external cues (here: mating). However, as presented here, the reader is supposed to have already detailed knowledge of the topic. In addition, this reader is often lost in details, with no easily understanding the essence. From this point of view, the manuscript would be better suited for a more specialised journal.

2) The text frequently uses the term "progenitor differentiation", based on the expression cell fate markers. Whether these cells differentiate to adopt their cell-type specific features (e. g. absorptive or endocrine) has not been studied. In addition, it is not clear what the authors mean when they state that "… results implicate EcR-signaling in.…. metabolic adaptation of EC" (last paragraph of Result section).

3) The authors demonstrate differential effects of 20HO-induced signaling on target gene expression, even on different splice variants of E75B. But how can a transcription factor (the EcR) affect the splicing of this target gene?

4) The text is often written sloppily, making it sometimes difficult to follow. One example: it reads: "After N specification, EB lineage is maintained.….". They probably mean that EBs have been specified by N signalling. The abbreviation N is not explained.

5) Figure 5 shows that overexpression of E75B-A/-C reduces the number of tumours induced by the absence of N. In addition, they "re-enable EC differentiation despite the lack of N". Again, this conclusion is based on the cell fate marker. It could still be that these cells do not differentiate properly at a later stage, they could even undergo apoptosis.

6) Figure 4: Quantification of all data shown in D-I would be helpful.

7) Figure 6H is not really clear.

8) In the Discussion section, some points were not addressed, e. g.

- What does it mean that E75B-B mRNA is not upregulated in mated females, but its overexpression induces ISC proliferation?

- How do the authors explain the shortening of the midgut, both upon E75B RNAi and E75B overexpression? Is the diameter enlarged?

Reviewer #2:

In this manuscript by Zipper et al., the authors present evidence on the role of Ecdysone (Ec/20HE) signaling regulating ISC proliferation and EB differentiation in the adult Drosophila midgut. In their model, the authors propose that, following mating, 20HE secreted from the ovaries induce activation of EcR signaling within ISCs/EBs to drive EB differentiation into Enterocytes. Additionally, activation of EcR signaling in Enterocytes is necessary for metabolic adaptation (lipid metabolism) in the gut in response to mating. Interestingly, Ec signaling counteracts Notch driven tumourigenesis in the adult midgut. The work in this report complements a previous publication from the senior author on the role of systemic juvenile hormone influencing proliferation and metabolic adaptation of the female gut in response to reproductive demands. There are, however, inconsistencies in some of the data and key aspects of the model that need more direct demonstration through experiments.

1) While the role of EcR signaling activation hormone import in the gut is reasonably demonstrated, there is no evidence on the where the source of 20HE comes from. The authors claim that this is the ovary but there is no experimental proof of that. Suppression of 20HE synthesis in the ovary followed by assessment of ISC proliferation/differentiation and gut metabolic adaptation should address this point.

2) Related to the point above: ISCs proliferation is inferred as the number of esg >gfp, rfp+ve cells throughout most of the paper. This should be directly measured by looking at pH3 staining.

3) Similarly, current data on changes in lipid metabolism (Figure S2C-G) should be complemented with direct assessment of gut lipid content.

4) Are the metabolic and ISC phenotypes influenced by EcR signaling linked? What happens to ISC proliferation if Ec import to the Enterocytes is blocked?

5) The use of SREBP-gal4 to manipulate gut Enterocytes (Figure S2—figure supplement 1E, F) is unconventional. Mex-gal4 or MyoIA-gal4, should be used.

6) Images should be presented for the data in Figure 2H.

7) The phenotype resulting from overexpression of E75B-A and E75B-C appears much stronger than that form EcI overexpression of the use of the EcR agonist. How do the authors explain that?

8) Genetic interactions presented in Figure 4 should be quantified (ISC proliferation and differentiation) and controls with individual gene manipulations included.

9) Can the phenotype of EcI overexpression or EcR activation be modified by knocking down E75B? Reciprocally, can E75B-A or -C overexpression rescue EcI knockdown?

10) The phenotype of E75B-A MARCM clones is unclear. A time course should be done. The authors claim Enteroendocrine cells are lost. However, I cannot see that in the data presented. This should be quantified. EE cell stainings are overall unclear.

11) The effect of Ec signaling activation on Notch-/- tumours does not prove a direct connection between the two phenomena. This could be the consequence of parallel action of two pathways with opposite effects. Is Ec signaling impaired in Notch tumours? This is key to connect both phenomena and substantiate a major claim of the paper.

Reviewer #3:

This work describes the role of ecdysone signaling, especially its downstream target Eip75 in midgut homeostasis in Drosophila. As ecdysone spikes after mating, and the intestine was already shown to be receptive to JH-signaling from the ovary in previous work by the last author, the authors start with addressing the role of the ecdysone receptor EcR in ISC/EB proliferation and differentiation. Next, the role of the ecdysone-target Eip75B is explored. Interestingly, the analysis of different isoforms reveals different roles for different isoforms of this PPAR-γ orthologue, with isoforms -A and -C being involved in regulation of EB-differentiation and the -B isoform inducing ISC mitosis. The interaction with JH-signaling is investigated and lastly, the role of EcR and its downstream target Eip75B is assessed in Notch LOF-tumors. Altogether, this is an impressive volume of work that reveals a new role for the ubiquitous ecdysone hormone in both ISC proliferation and progenitor differentiation. This connects well with recent work from the Miguel-Aliaga and Perrimon labs that has explored inter-organ communication from neighbouring tissues such as fat body and ovary to the intestine. It also invites further inquiry into the interplay between mating and the Insulin-dependent growth response upon re-feeding of the midgut (O'Brien et al., 2011). I would recommend this work for publication after the issues described below would be addressed. Especially in the light of the current Covid19-crisis, I do not think extra experimental work should be necessary.

Major comments:

1) Central to their thesis is the fact that ecdysone produced in the ovary would signal to ISCs/EBs to exert its effect. However, the authors have not done any genetic experiments to show that flies without ecdysone production in the ovary would not have the mating-induced response ISC-EB increase. Hence, a role of local ecdysone production by either the fat body or gut cannot be ruled out. Related to this, the authors decribe determination of 20HE-titers on wild-type and ovoD1 heterozygotes in their Materials and methods section, but no data can be found in the manuscript. Can the authors comment on that and include the 20HE-titer data?

2) This relates more to the parallels drawn between the work described here and the parallels with mammalian steroid hormone signaling. Based on their results, I do not think the statement that "our findings suggest a tumor-suppressive role for steroidal signalling " is warranted. Loss of EcR suppresses ISC/EB proliferation upon mating and the EcR agonist RH5849 dramatically induces proliferation, which would be more in line with an oncogenic effect of EcR-signaling in the fly. I understand that EcR induces Eip75, a PPARγ orthologue and they provide evidence that this induces differentiation and therefore impairs Notch LOF-driven tumorigenesis, in line with mammalian data. I would suggest altering some of these statements and moving them out of the Abstract and Introduction to the Discussion section, where there is more room to elaborate on these contradictions.

eLife. 2020 Aug 10;9:e55795. doi: 10.7554/eLife.55795.sa2

Author response


Summary:

In this manuscript, the authors present evidence on the role of 20-Hydroxy-Ecdysone (20HE), secreted from the ovaries, in controlling proliferation and differentiation of intestinal stem cells into Enterocytes in the adult midgut of Drosophila females after mating. In the model presented, the authors propose that, following mating, 20HE secreted from the ovaries induce activation of EcR signaling within ISCs/EBs to drive EB differentiation into Enterocytes. They observed differential responses of 20HE on known target genes and followed the role of these target genes on stem cell proliferation and differentiation. The analysis of different isoforms of the ecdysone-target Eip75B reveals different roles for different isoforms of this PPARγ orthologue, with isoforms -A and -C being involved in regulation of EB-differentiation and the -B isoform inducing ISC mitosis. Additionally, activation of EcR signaling in Enterocytes is necessary for metabolic adaptation (lipid metabolism) in the gut in response to mating. Furthermore, the authors analysed the interplay between the 20HE- and the juvenile hormone-pathways. Interestingly, Ec signaling counteracts Notch driven tumourigenesis in the adult midgut.

Overall, this is an impressive volume of work that reveals a novel role for the ubiquitous ecdysone hormone in both ISC proliferation and progenitor differentiation. This connects well with recent work from the Miguel-Aliaga and Perrimon labs that has explored inter-organ communication from neighbouring tissues such as fat body and ovary to the intestine. It also invites further inquiry into the interplay between mating and the Insulin-dependent growth response upon re-feeding of the midgut (O'Brien et al., 2011).

Essential revisions:

According to the reviewers, there are two major conclusions that need to be revisited to be fully supported.

1) There is no evidence on the where the source of 20HE comes from. The authors claim that this is the ovary but there is no experimental proof of that. Suppression of 20HE synthesis in the ovary followed by assessment of ISC proliferation/differentiation and gut metabolic adaptation should address this point. Therefore, the systemic control of Ec signaling in the gut needs to be demonstrated. It represents the heart of the paper and what makes it more interesting/novel. In fact, towards the end of the abstract the authors conclude: 'To our knowledge, this is the first time a systemic hormone is shown to direct local stem cell fate decisions. ' This has not been tested and sources other than the ovaries could be playing a role.

We fully agree that the 20HE source and determining 20HE titers were important experiments to perform. 20HE titer measurements in ovaries and hemolymph of VF vs MF are part of Figure 2A-C now. As reviewer 3 commented, we began measuring 20HE titers in wild-type and ovoD1 female flies. Unfortunately, due to the Covid19 crisis, we waited more than 5 months for a last immunoassay Kit to arrive to finally complete three biological replicas. The kit arrived finally two months after the initial submission. The corresponding new data and text were added to:

Results section: “In close anatomical proximity to the PMG, the ovaries are an established ecdysteroidogenic tissue. Determining 20HE titers 48hours after mating using enzyme immunoassays, we confirmed previous reports of mating dependent increases of ovarian 20HE titers (Figure 2A) (Ameku and Niwa, 2016, Harshman et al., 1999) and observed a similar increase in the hemolymph (Figure 2A). As a study investigating the ecdysoneless mutants suggested that the ovary is the only source for 20HE in adult females (Garen et al., 1977), we sought to diminish 20HE titers in adult females. Therefore, we genetically ablated the ovaries using the dominant sterile ovoD1 allele in which egg production is blocked prior to vitellogenesis (Busson et al., 1983, Oliver et al., 1987, Reiff et al., 2015) (Figure 2D). 20HE titers in the hemolymph of ovoD1 females are reduced around 40-50% compared to wild-type females (Figure 2B,A). Interestingly, 20HE titers in hemolymph and remnants of the ovaries are still significantly increased upon mating of ovoD1 females (Figure 2C). Consequently, 20HE titers in sterile esgReDDM/ovoD1 MF increase the number of progenitors (Figure 2E) and progeny (Figure 2F). This suggests that remaining 20HE levels are sufficient to elicit mating related midgut adaptations.”

Discussion section: “Our data supports the idea that 20HE and JH synergistically concert intestinal adaptations balancing nutrient uptake to increased energy demands upon mating (Figure 1, Figure 2, Figure 3, Figure 4, Figure 5). We confirmed that mating induces ovarian ecdysteroid biosynthesis stimulating egg production by ovarian GSC (Figure 2A)(Ables and Drummond-Barbosa, 2010, Ameku and Niwa, 2016, Ameku et al., 2017, Harshman et al., 1999, König et al., 2011, Morris and Spradling, 2012, Uyehara and McKay, 2019). In accordance with an interorgan signaling role for 20HE, we detected increased 20HE titers in the hemolymph (Figure 2A). Surprisingly, we found this mating dependent increase of 20HE titers still present upon partial genetic ablation of the ovaries using ovoD1 (Figure 2B)(Reiff et al., 2015). This can be explained by either (i) other source(s) for 20HE in adult females like the brain (Chen et al., 2014, Itoh et al., 2011) or (ii) 20HE release from remaining germarial cells in stage 1-4 eggs of ovoD1 VF and MF. Indeed, germarial cells have been shown to express the ecdysteroidogenic Halloween genes (Ameku and Niwa, 2016, Ameku et al., 2017). In addition, ovoD1 MF lack ovarian 20HE uptake during vitellogenesis (Figure 2D) of later egg stages, which potentially contributes to 20HE titer in the hemolymph of ovoD1 females and intestinal epithelium expansion (Figure 2D,E,J,K) (Enya et al., 2014).

The epithelial expansion upon mating of ovoD1 females has been observed before (Reiff et al., 2015) and might be comparably high due to the different genetic background of ovoD1 flies compared to w1118 (Figure 2Q). Taken together, our current experiments cannot clearly dissect whether the ovary is the exclusive source of 20HE (Garen et al., 1977). In future experiments, complete ablation of ovarian 20HE by genetically removing GSC (Flatt et al., 2008, Kai and Spradling, 2003) or from other sources like the brain need to be performed to address the exact source(s) (Chen et al., 2014, Itoh et al., 2011).”

We also considered that ovoD1 might act directly on intestinal homeostasis due to the induction of EC production (Figure 2Q). A current preprint from Francois Payre and Dani Osman suggests that the EcR induced post translational modification of somatically expressed shavenbaby (svbRep) from the ovo gene locus controls ISC self-renewal and EC differentiation (Al Hayek et al., 2019). (Consistent with our study, they also observe less progenitors expressing EcR-RNAi and a dominant-negative EcR construct). After consulting the senior authors, a role for ovoD1 acting on somatic shavenbaby can be excluded (Francois Payre, University of Toulouse, personal communication) (Andrews et al., 1998, Delon et al., 2003, Mevel-Ninio et al., 1996).

Taken together, we cannot clearly dissect with these experiments whether the ovary (or the remaining cells after ovoD1 ablation) are the exclusive source of 20HE. We now reworked the manuscript accordingly and discuss other sources than the ovaries.

2) The effect of Ec signaling activation on Notch-/- tumours does not prove a direct connection between the two phenomena. This could be the consequence of parallel action of two pathways with opposite effects. Is Ec signaling impaired in Notch tumours? This is key to connect both phenomena and substantiate a major claim of the paper.

The reviewers raise an important and interesting issue. Downstream of the 20HE signaling, we found differential regulation of Eip75B isoforms and to investigate their timely expression and function is of high importance, therefore we aimed to tackle them experimentally.

As we discuss in the revised manuscript now, Eip75B might not only be a ‘classical’ effector of 20HE signaling but also a target of Notch activation. Convergence of EcR and Notch signaling are known from various tissues and functions. Acting together, EcR and Notch were shown to regulate processes like proliferation, differentiation and endocycling/gene amplification by converging on transcription factors like cut, tramtrack and the broad complex (Mitchell et al., 2013, Sun et al., 2008, Xu et al., 2018).

A possibility how both pathways may converge on Eip75B is indicated by a study from Sarah Brays lab. The study suggests that active EcR and Notch, via H3K56 histone acetylation, modify multiple regulatory regions including Eip75B (Skalska et al., 2015). A thorough investigation of Eip75B regulatory regions is required to elucidate in detail how both pathways may affect Eip75B.

Experimentally, we tried to tackle 20HE signaling inside of Notch tumors during the revision process. We followed several approaches:

We investigated EcR activity in Notch tumors by crossing esgReDDM flies with EcRE-LacZ and >N-RNAi. After X-Gal stainings failed on EcRE-LacZ PMG (reviewer#2, point6), we performed (i) immunohistochemistry, (ii) qPCR and iii) activating EcR in Notch activity reporter flies:

i) We used antibodies against the EcRE-LacZ gene product β-Galactosidase and compared intra- and extra tumoral EcRE signal intensity (A-D). We found a decrease of β-Galactosidase signal intensity in Notch tumors compared to control ISC/EB (-23,2%, D) and surrounding EC (-22,7%, D). Interestingly this reduction in EcRE-LacZ intensity was restricted to the ISC fraction (B) and no difference was observed in the EE fraction of N-tumors (C).

However, there is conflicting data about the intracellular localization of the EcRE-lacZ gene product in the literature (Kozlova and Thummel 2003, Neto et al., 2017, Okamoto et al., 2018, Schwedes et al., 2011). Okamoto et al., clearly show an enrichment of signal in the nucleus, whereas the original paper from Kozlova, the Schwedes and Neto publications and our images suggest cytoplasmatic localization of the β-Gal enzyme (A-C). Given this discrepancy in the literature, we decided not to include this finding in the main manuscript and state that 20HE signaling is affected in N-tumors. However, we are open to the reviewer’s expertise and opinion about including it or not.

ii) We addressed EcRE-LacZ activity with qPCR in guts carrying Notch tumors (esgReDDM/>N-RNAi, E), but found no significant change compared to control guts (esgReDDM/+, E). However this experiment is difficult in its interpretation, as whole gut cDNA is used and changes in the most abundant non-manipulated cells (EC) might occur when N-tumors are induced (Patel et al. 2015). Similar intricacies are true for qPCR for Eip75B isoform expression levels in (F), in which we also did not detect any difference in N-tumor (esgReDDM/>N-RNAi) vs. control guts (esgReDDM/+) after seven days of tumor induction. FACS sorting of esg+-cells for those experiments would sufficiently enrich the ISC/EB fraction to perform these experiments in a more convincing way, but is not readily established.

iii) In a third experiment, we activated EcR-signaling in Gbe-SuH reporter flies (reviewer 2, point 10) using RH5849 and detected a significant increase in N-activity (G). This experiment shows that under physiological conditions, N activity is indeed impacted by EcR-signaling leading to EC generation (Figure 2I, Figure 7—figure supplement 1F). Thus, our data suggests that Eip75B elicits EC differentiation downstream of EcR- and Notch activation, and thus may incorporate signals from both pathways (Figure 3, Figure 4, Figure 6, Figure 7, Figure 3—figure supplement 1, Figure 3—figure supplement 2 Figure 7—figure supplement 1 and reviewer 2, point 10). This interesting interplay on Eip75B and also the role of the Notch target gene klu warrant future studies (Korzelius et al., 2019, Reiff et al., 2019).

Again, we thank the reviewer(s) for this important comment and adjusted our claims and acknowledged the limitations of our N LOF experiments in the revised manuscript. We added Figure 6—figure supplement 1F to the revised manuscript and now dedicate a paragraph addressing the possible regulation of Eip75B by both pathways in the Discussion.

Author response image 1.

Author response image 1.

The reviewers agreed that the Notch/Ec interaction is a bit overinterpreted in the manuscript, but some re-writing and combining all Notch results in Figure 5 and Figure 6 would fix this. The authors need to soften their claims and acknowledge the limitations of their experiments. This would also leave more room for some of the interesting data from the supplement regarding EE differentiation of E75A MARCM clones or the SREBP activation in Enterocytes to be included in the main manuscript.

We agree and adjusted the claims of our data concerning Notch and 20HE. We re-wrote various paragraphs in the revised manuscript. For details, please see the individual reviews.

Reviewer #1:

In this manuscript, the authors present data to show that in addition to juvenile hormone (shown in their previous paper, 2017) a second hormone, 20-Hydroxy-Ecdysone (20HE), controls proliferation and differentiation of intestinal stem cells in Drosophila females after mating. They used a system established previously, the ReDDM lineage method, to analyse the role of the 20HE-signalling pathway. They applied various genetic and pharmacological perturbations, such as overexpression and knock-down by RNAi and application of the ecdysone agonist, RH5849. They observed differential responses of 20HO on known target genes and followed the role of these target genes on stem cell proliferation and differentiation. They analysed the interplay between the 20HO- and the juvenile hormone-pathways. Finally, they present data to suggest that 20HO-mediated signalling can overcome the defects in differentiation observed upon inactivation of the Notch signalling pathway.

Major points:

1) Overall, these are interesting data and add novel insight into the way of tissue adaptation to external cues (here: mating). However, as presented here, the reader is supposed to have already detailed knowledge of the topic. In addition, this reader is often lost in details, with no easily understanding the essence. From this point of view, the manuscript would be better suited for a more specialised journal.

We thank the reviewer for pointing this out and we have revised our manuscript addressing the reviewer´s concerns. The revised manuscript now aims to underline the more general implications of our findings for the broad readership of eLife. As an example, we now include data showing that the PPARγ agonist Pioglitazone acts through Eip75B (Figure 4) that points to a more general relevance of our findings. Regarding the interest for eLife readers: We think that for stem cell biologists the demonstration how a hormone acts through Eip75B on progenitor fate decisions is of considerable interest. The Drosophila research community profits from the understanding of synergistic action of hormones acting sequentially on different cell types in the context of mating. Finally, for clinical researchers the defined in vivo role of Eip75B/PPARγ in intestinal progenitors might be of interest in the future as a plethora of activating and inhibiting ligands is readily available. Our data highlights intestinal progenitor differentiation as a new and important aspect of how hormones are involved in physiological and pathological intestinal homeostasis.

2) The text frequently uses the term "progenitor differentiation", based on the expression cell fate markers. Whether these cells differentiate to adopt their cell-type specific features (e. g. absorptive or endocrine) has not been studied. In addition, it is not clear what the authors mean when they state that "… results implicate EcR-signaling in.…. metabolic adaptation of EC" (last paragraph of Result section).

The ReDDM method combined with esg-Gal4 allows to distinguish between the ISC/EB progenitor cell types (GFP+/RFP+) and the differentiated progeny (GFP-/RFP+, EE and EC, Antonello et al., 2015). Our term RFP-only progeny from the quantifications encompasses terminally differentiated absorptive EC marked by Discs-large-1 (Dlg-1 marks smooth septate junctions in highly polarized cells integrated into the epithelium (Chen et al., 2018a, Furuse and Izumi, 2017, Izumi et al., 2019, Izumi et al., 2016, Izumi et al., 2012)) and EE marked by prospero (Ohlstein and Spradling, 2006). We and other labs did not observe any other differentiated or non-differentiated RFP+-only cell type stemming from esgReDDM tracings (Al Hayek et al., 2019, Arthurton et al., 2019, Martin et al., 2018, Mundorf et al., 2019, von Frieling et al., 2020).

We now include new supplementing quantification for data in Figure 3 showing that the abundance of EE fate in Eip75B manipulations is less than one new EE (Figure 3—figure supplement 1E) of more than 300 RFP+-only counts (Figure 3M). In various other figures (Figure 5, Figure 6, Figure 7, Figure 3—figure supplement 2 and Figure 7—figure supplement 1), we present images co-stained with terminal differentiation markers Dlg-1 and Pros. For figures in which cell fate changes were investigated, we also now provide quantifications of Dlg-1+/RFP+ upon activated Eip75B (Figure 4F) and 20HE signaling (Figure 6I, Figure 7—figure supplement 1C, Figure 7G) and the induction of EC fate.

Concerning the metabolic adaptation of EC (Figure 2—figure supplement 1C-O), we were referring to the upregulation of Srebp upon mating, which is accompanied by the upregulation of transcripts of fatty acid synthesis (long-chain fatty acid CoA ligases bubblegum (bgm), AcylCoA synthetase long-chain (Acsl), Fatty acid synthase (FAS) and Acetyl-CoA carboxylase (ACC)) described in (Reiff et al. 2015). We additionally provide data now showing RH5849 and >EcI raising lipid uptake by directly addressing lipid uptake with OilRedO stainings (Figure 2—figure supplement 1I-O). We added and rephrased the revised manuscript accordingly.

3) The authors demonstrate differential effects of 20HO-induced signaling on target gene expression, even on different splice variants of E75B. But how can a transcription factor (the EcR) affect the splicing of this target gene?

The reviewer is right and we replaced the term ‘splice variant’ with protein ‘isoform’ throughout the manuscript as there is no evidence for alternative splicing of Eip75B. However, it cannot be excluded that such regulation exists for Eip75B gene products as it was recently shown that e.g. JH primes the ecdysteroid response through alternative splicing of taiman in mosquitoes (Liu et al., 2018).

4) The text is often written sloppily, making it sometimes difficult to follow. One example: it reads: "After N specification, EB lineage is maintained.….". They probably mean that EBs have been specified by N signalling. The abbreviation N is not explained.

We carefully proofread the manuscript again and corrected many phrases that were long and thus difficult to understand. The abbreviation Notch (N) is correctly introduced in the second paragraph of the Introduction. In addition, we prepared a list of abbreviations following the reviewer’s suggestion.

5) Figure 5 shows that overexpression of E75B-A/-C reduces the number of tumours induced by the absence of N. In addition, they "re-enable EC differentiation despite the lack of N". Again, this conclusion is based on the cell fate marker. It could still be that these cells do not differentiate properly at a later stage, they could even undergo apoptosis.

The cell fate marker (Dlg-1+/RFP+ EC) in new Figure 6 and Figure 7 faithfully reflects terminal differentiation (see reviewer 1, point 2 for references and details).

There are several lines of evidence arguing against a role for PCD in EB survival. (i) We directly addressed programmed cell death with cleaved-caspase 3 feeding flies with RH5849 (mimicking 20HE mating induction) and found no EB death. (ii) PCD in EB is comparably easy to detect by membrane-blebbing and irregularities (GFP+-vesicles) when ReDDM tracing is used (Reiff et al., 2019). (iii) A later PCD as fully differentiated pros+-EE and Dlg-1+-EC (see reviewer 1, point 2) is unlikely as transgenes are not esg- or klu-Gal4 activated anymore in differentiate cell types (Figures 1A-B, Figure 3—figure supplement 2A). (iv) Upon Eip75B-A/-C expression, ISC/EB progenitor numbers are strongly reduced (Figure 3L). The high number of differentiated cells upon Eip75B-A/-C expression (Figure 3M) argues against a significant contribution of EB-death, but rather shows EB to EC differentiation (inset Figure 3G,H,K) as the main cause of progenitor compartment reduction. Taken together our data argues against a major role of cell loss in neither progenitor- nor differentiated progeny populations.

6) Figure 4: Quantification of all data shown in D-I would be helpful.

In the time after the submission and during the revision, we were able to raise the replica numbers of these genotypes and perform a statistical analysis of all genotypes now. We added this information to new Figure 5 now and incorporated it into the revised manuscript.

7) Figure 6H is not really clear.

New Figure 7H is providing a model of our current and published findings about hormonal control of midgut progenitors in physiology and pathology. We extended and specified its description in the figure legend now.

8) In the Discussion section, some points were not addressed, e. g.

- What does it mean that E75B-B mRNA is not upregulated in mated females, but its overexpression induces ISC proliferation?

The topic of Eip75B-B regulation is indeed interesting. We already discussed Eip75B-B function and regulation in subsection “The interplay between Eip75B and Kr-h1 controls intestinal size adaptation”. “In our study, we dissected specific roles for Eip75B isoforms. Eip75B-B expression is at the lower detection limit (Figure 3B) and unchanged upon mating (Figure 3C). Thus, our finding that forced Eip75B-B expression raised ISC mitosis in VF (Figure 3—figure supplement 1F) might be due to ectopic expression. Eip75B-B mutants are viable and fertile and Eip75B-B is interacting with DNA only upon forming heterodimers with Hormone receptor 3 (Hr3) temporarily repressing gene expression (Bialecki et al., 2002, Sullivan and Thummel, 2003, White et al., 1997). Further studies of Eip75B-B, especially its expression pattern and transcriptional regulation, are necessary to elucidate in which physiological context, else than mating, Eip75B-B controls ISC proliferation.”

One has to keep in mind that Eip75B-B expression in ISC with UAS constructs is forced and could be ectopic. Eip75B-B levels on whole midgut cDNA are low (Figure 3B) and could originate from another cell type than progenitors. The lack of a Zn-finger domain in Eip75B-B and the interaction with Hr3 definitely warrants an in-depth future investigation. We reworked the manuscript concerning this point and highlight now that the stimulus leading to Eip75B-B is unknown (Figure 5K).

- How do the authors explain the shortening of the midgut, both upon E75B RNAi and E75B overexpression? Is the diameter enlarged?

We reworked this part of the Results section now and added some details. The text goes as follows now: “Disrupting intestinal homeostasis alters midgut length (Hudry et al., 2016) and in line with this, Eip75B manipulations result in a shorter midgut as EC make up around 90% of the whole midgut epithelium (Figure 3—figure supplement 1G). Eip75B affects intestinal homeostasis by either slowing down terminal EB to EC differentiation (Eip75B-B and Eip75B-RNAi) or depleting the ISC and EB pool (Eip75B-A/–C, Figure 3—figure supplement 1G) preventing sufficient EC production along the gut. When EC production is blocked using >N-RNAi, the midgut shrinks around one third over a period of seven days (Chen et al., 2018b, Guo and Ohlstein, 2015, Micchelli and Perrimon, 2006, Ohlstein and Spradling, 2006, Ohlstein and Spradling, 2007, Patel et al., 2015). Thus, all Eip75B manipulations ultimately lead to an insufficient number of new absorptive EC resulting in a shorter midgut.”

We also added measurements of midguts with Notch-tumors combined with esgReDDM to illustrate how much total block of EC production reduces midgut length (~1/3, Figure 3—figure supplement 1G). Concerning midgut diameter measurements: we found the diameter to fluctuate more than midgut length and also depend on different food recipes. We found measuring midgut length resulting in more robust values in concordance with the work of Bruno Hudry and Irene Miguel-Aliaga (Hudry et al., 2016).

Reviewer #2:

In this manuscript by Zipper et al., the authors present evidence on the role of Ecdysone (Ec/20HE) signaling regulating ISC proliferation and EB differentiation in the adult Drosophila midgut. In their model, the authors propose that, following mating, 20HE secreted from the ovaries induce activation of EcR signaling within ISCs/EBs to drive EB differentiation into Enterocytes. Additionally, activation of EcR signaling in Enterocytes is necessary for metabolic adaptation (lipid metabolism) in the gut in response to mating. Interestingly, Ec signaling counteracts Notch driven tumourigenesis in the adult midgut. The work in this report complements a previous publication from the senior author on the role of systemic juvenile hormone influencing proliferation and metabolic adaptation of the female gut in response to reproductive demands. There are, however, inconsistencies in some of the data and key aspects of the model that need more direct demonstration through experiments.

1) While the role of EcR signaling activation hormone import in the gut is reasonably demonstrated, there is no evidence on the where the source of 20HE comes from. The authors claim that this is the ovary but there is no experimental proof of that. Suppression of 20HE synthesis in the ovary followed by assessment of ISC proliferation/differentiation and gut metabolic adaptation should address this point.

We thank the reviewer for this experimental suggestion. Please find new data and discussion in Essential revisions 1.

2) Related to the point above: ISCs proliferation is inferred as the number of esg >gfp, rfp+ve cells throughout most of the paper. This should be directly measured by looking at pH3 staining.

We agree with the reviewer that momentary ISC proliferation is best addressed with pH3 or comparable markers of proliferation. However, concerning questions related to homeostatic turnover of the intestinal tissue, cell tracing systems like MARCM clones (Lee and Luo, 2001) and later Bruce Edgars esg-FlpOut (Jiang et al., 2009) and our ReDDM method (Antonello et al., 2015), have been proven highly reliable to address stem cell production over time. One also has to keep in mind that additional regulatory mechanisms like nutrition, delayed differentiation and even EB death strongly affect homeostatic processes and thus momentary ISC proliferation as well (Antonello et al., 2015, O'Brien et al., 2011, Reiff et al., 2019, Reiff et al., 2015).

Additionally, ISC proliferation was shown to strongly depend on the circadian rhythm (Karpowicz et al., 2013), thus a ‘snapshot‘ of ISC proliferation using pH3 after seven days can be even misleading when overall tissue turnover is not addressed. As a consequence, tracing methods like our ReDDM are now used in many laboratories to address intestinal homeostasis (Al Hayek et al., 2019, Arthurton et al., 2019, Martin et al., 2018, Mundorf et al., 2019, von Frieling et al., 2020).

For a key experiment (Eip75B isoforms), we now include pH3 graphs (Figure 3—figure supplement 1F) and adapted the revised manuscript accordingly.

3) Similarly, current data on changes in lipid metabolism (Figure S2C-G) should be complemented with direct assessment of gut lipid content.

We appreciate this comment and include this experiment now (Figure 2—figure supplement 1F). See reviewer 2, point 5 for details.

4) Are the metabolic and ISC phenotypes influenced by EcR signaling linked? What happens to ISC proliferation if Ec import to the Enterocytes is blocked?

We thank the reviewer for this question, which points to a logical follow up experiment to our current study. Indeed, we are currently performing these experiments in the course of another entire project. EGF and Upd ligands from EC have been implicated to induce homeostatic and stress induced signaling pathways ISC proliferation in various contexts (Jiang et al., 2011, Jiang et al., 2009, Liang et al., 2017).

So far, we can say that there is a role for systemic 20HE being translated into a local signal released from EC, as ISC proliferation is reduced upon 20HE importer RNAi (Mexts>EcI-RNAi). This preliminary data suggests an indirect effect of 20HE acting on EC signaling to ISC, in addition to the direct role for 20HE in ISC and EB described in this current paper.

5) The use of SREBP-gal4 to manipulate gut Enterocytes (Figure 2—figure supplement 1E, F) is unconventional. Mex-gal4 or MyoIA-gal4, should be used.

We agree with the reviewer that the use of Srebp-Gal4 is unconventional and include now OilRedO staining of PMG (Figure 2—figure supplement 1I-O). In Reiff et al., 2015 we showed that Srebp-Gal4>CD8::GFP is the more sensitive tool to address the upregulation of lipid uptake and we were able to detect changes between VF and MF or RH5849 fed flies (Figure 2—figure supplement 1C,D,G). We agree that the measurements done in Srebp>EcR-RNAi might harbor some imprecision due to possible fluctuations of the driver.

The newly included OilRedO-stainings, directly addressing lipid content, show that the RH5849 agonist and the overexpression of >EcI significantly increase lipid content. But why is there no significant decrease when EcR and EcI are knocked down? One explanation is that there is also very low levels of OilRedO staining in PMG of controls (Figure 2—figure supplement 1I,J). Together with the Miguel-Aliaga lab, we have previously described that the uptake of lipids using OilRedO can be only visualized when egg production is blocked from instantly taking up lipids into developing eggs (Reiff et al., 2015). Therefore, we aimed to reduce egg production with ovoD1, but could not create viable stocks that harbor ovoD1, Mex> and tub-Gal80ts to perform this experiment. For future experiments, a stock directly driving GFP from the Srebp activity construct used to make Srebp-Gal4 could tackle this problem.

Taken together, we now show that in addition to the activation of Srebp, 20HE signaling activation also leads to higher lipid content directly addressed by OilRedO.

6) Images should be presented for the data in Figure 2H.

The data we presented in Figure 2H is raised with qPCR on R5 tissue to detect small differences in EcRE-lacZ mRNA levels. With images, reviewer#2 is probably referring to the Schwedes publication (Schwedes et al., 2011), in which X-Gal stainings were performed on EcRE-lacz fly stocks in different tissues. We also performed those stainings (for 1hour @37°C) for the revision and noted big differences in staining intensity among different gut regions (see Author response image 2A-C, proventriculus). We were unable to detect differences between VF and MF (A’-B’). An intensity-based evaluation of the above images after β-Gal staining was not successful because of the signal stemming from luminal gut content (A’-C’), which is why we chose to rely on our qPCR data.

Author response image 2.

Author response image 2.

However, old flies showed strong staining in the posterior midgut suggesting an age dependency (C,C’). However, it is also possible that the known high protein stability of β-galactosidase leads to a strong signal in 20d old flies. Another explanation is that old flies have higher 20HE titers or other factors augment the response to 20HE in older flies.

7) The phenotype resulting from overexpression of E75B-A and E75B-C appears much stronger than that form EcI overexpression of the use of the EcR agonist. How do the authors explain that?

This is a very difficult question to address and we will discuss this issue based on our current data: First of all, the strong differentiation phenotype of Eip75B-A and Eip75B-C stems from the direct and forced expression in ISC/EB (esgReDDM) or EB (kluReDDM). Levels of Eip75B isoforms are probably several fold higher than under physiological conditions, but were shown to be able to rescue Eip75B LOF phenotypes in the brain (Rabinovich et al. 2016). Driven by strong tubulin-Gal4, we measured around 50-fold increases for all splice variants (not shown), which is much stronger than normal mating induction (Figure 3C). Overexpression with weaker drivers like esg/kluReDDM are supposedly milder. A possible experiment to address this directly, would involve FACS sorting of esg/kluReDDM marked cells and subsequent qPCR for Eip75B isoforms, which is not established in our lab.

Secondly, we assume 20HE ligand availability as the most probable limiting factor for the activation of EcR. In line with this, >EcR overexpression is unable to induce further proliferation and differentiation (Figure 1F,G). In this revised version, we now show that the overall 20HE titer in the hemolymph (Figure 2A) doubles upon mating. In line with this, we observe an about two-fold increase in progeny in >EcI MF (Figure 2K compared to control MF). In addition, when 20HE (and JH) titers are low in VF, EcI overexpression is not sufficient to elicit an increased number of differentiated cells. Together, we assume ligand availability as the limiting factor for EcR activation.

Feeding flies with the RH5849 non-steroidal EcR agonist affects EB to EC differentiation through Eip75B (Figure 2, Figure 6, Figure 7, Figure 7—figure supplement 1, Figure 3F) and RH5849 elicits EC production similarly to EcI MF (Figures 2Q and 7G). Chipseq, DamID and Cut-Run experiments suggest that EcR is found at between 100-1000 binding sites in the genome depending on the investigated tissue/cell line (Gauhar et al., 2009, Shlyueva et al., 2014, Uyehara and McKay, 2019). Distribution of taken up 20HE or RH5849 might additionally weaken EcR activation on a single gene level (like Eip75B) compared to direct UAS driven Eip75B expression. Another important trigger for activation strength of Eip75B might be an additional activation of Eip75B through the Notch pathway, which would be circumvented with direct >Eip75B-A/-C expression. The interplay with Notch is discussed now in the revised manuscript and under reviewer 2, point 10 and the Essential revisions.

8) Genetic interactions presented in Figure 4 should be quantified (ISC proliferation and differentiation) and controls with individual gene manipulations included.

Please see reviewer 1, point 6 and the new Figure 5 for a quantification of ISC/EB numbers and progeny numbers.

9) Can the phenotype of EcI overexpression or EcR activation be modified by knocking down E75B? Reciprocally, can E75B-A or -C overexpression rescue EcI knockdown?

We thank the reviewer for this suggestion and performed the experiments. We include the according panels and quantifications in Figure 3(F,H,K,L,M) now and discuss them accordingly in the revised manuscript.

10) The phenotype of E75B-A MARCM clones is unclear. A time course should be done. The authors claim Enteroendocrine cells are lost. However, I cannot see that in the data presented. This should be quantified. EE cell stainings are overall unclear.

We thank the reviewer for this comment and quantified EE (GFP+/Pros+) cells in Eip75B-A(A81) MARCM clones. Quantification revealed no significant difference in the number of EE compared to FRT2A controls. We noticed however that clonal EE numbers in FRT2A controls are exceptionally low (compared to FRT40A control clones, see attached quantification (A), 7d after clone induction). Additionally, we analyzed the activation of Notch in Eip75B-A clones using GBE+Suh-dsRed reporter flies (B-B’’, Grainy head Binding Elements and Suppressor of Hairless Notch activity reporter construct from Sarah Brays lab). We detected no significant difference in Notch signal activity that may have indicated a fate change from EC to EE (Micchelli and Perrimon, 2006, Ohlstein and Spradling, 2006, Ohlstein and Spradling, 2007). We removed the statement from the revised text.

Author response image 3.

Author response image 3.

11) The effect of Ec signaling activation on Notch-/- tumours does not prove a direct connection between the two phenomena. This could be the consequence of parallel action of two pathways with opposite effects. Is Ec signaling impaired in Notch tumours? This is key to connect both phenomena and substantiate a major claim of the paper.

We thank the reviewer for pointing out this important issue. Please find new data and discussion in Essential revisions 1.

Reviewer #3:

This work describes the role of ecdysone signaling, especially its downstream target Eip75 in midgut homeostasis in Drosophila. As ecdysone spikes after mating, and the intestine was already shown to be receptive to JH-signaling from the ovary in previous work by the last author, the authors start with addressing the role of the ecdysone receptor EcR in ISC/EB proliferation and differentiation. Next, the role of the ecdysone-target Eip75B is explored. Interestingly, the analysis of different isoforms reveals different roles for different isoforms of this PPARγ orthologue, with isoforms -A and -C being involved in regulation of EB-differentiation and the -B isoform inducing ISC mitosis. The interaction with JH-signaling is investigated and lastly, the role of EcR and its downstream target Eip75B is assessed in Notch LOF-tumors. Altogether, this is an impressive volume of work that reveals a new role for the ubiquitous ecdysone hormone in both ISC proliferation and progenitor differentiation. This connects well with recent work from the Miguel-Aliaga and Perrimon labs that has explored inter-organ communication from neighbouring tissues such as fat body and ovary to the intestine. It also invites further inquiry into the interplay between mating and the Insulin-dependent growth response upon re-feeding of the midgut (O'Brien et al., 2011). I would recommend this work for publication after the issues described below would be addressed. Especially in the light of the current Covid19-crisis, I do not think extra experimental work should be necessary.

Major comments:

1) Central to their thesis is the fact that ecdysone produced in the ovary would signal to ISCs/EBs to exert its effect. However, the authors have not done any genetic experiments to show that flies without ecdysone production in the ovary would not have the mating-induced response ISC-EB increase. Hence, a role of local ecdysone production by either the fat body or gut cannot be ruled out. Related to this, the authors decribe determination of 20HE-titers on wild-type and ovoD1 heterozygotes in their Materials and methos section, but no data can be found in the manuscript. Can the authors comment on that and include the 20HE-titer data?

We thank reviewer for pointing to this central issue as well and added this data now. Please find new data and discussion in Essential revisions 1.

2) This relates more to the parallels drawn between the work described here and the parallels with mammalian steroid hormone signaling. Based on their results, I do not think the statement that "our findings suggest a tumor-suppressive role for steroidal signalling " is warranted. Loss of EcR suppresses ISC/EB proliferation upon mating and the EcR agonist RH5849 dramatically induces proliferation, which would be more in line with an oncogenic effect of EcR-signaling in the fly. I understand that EcR induces Eip75, a PPARγ orthologue and they provide evidence that this induces differentiation and therefore impairs Notch LOF-driven tumorigenesis, in line with mammalian data. I would suggest altering some of these statements and moving them out of the Abstract and Introduction

to the Discussion section, where there is more room to elaborate on these contradictions.

We followed the reviewer(s) suggestion here and moved and softened statements in Abstract, Introduction and the final paragraph of the Results section. Furthermore, we added experiments with an PPARy agonist impairing Notch driven tumorigenesis and extended and focusing the discussion accordingly (new Figure 4).

Concerning a role for steroidal signaling and tumor suppressive or oncogenic roles: the effects of ER signaling in humans are context dependent. The major functions of steroid hormone receptor signaling in normal adult tissues appear to involve differentiation rather than proliferation (Cheng and Balk, 2003). This role is drastically changed in the pathology of cancer and there is a plethora of studies showing the benefits of blocking ER signaling in breast and prostate cancer (Cheng and Balk, 2003), whereas activation seems to be beneficial for female colorectal cancer patients (Chen et al., 1998, Hendifar et al., 2009, Lin et al., 2012).

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Data from Figure 1.

    Panel G,H experimental data.

    Figure 1—figure supplement 1—source data 1. Data from Figure 1—figure supplement 1.

    Panel H experimental data.

    Figure 2—source data 1. Data from Figure 2.

    Panel A,B,C,J,O,P,Q experimental data.

    Figure 2—figure supplement 1—source data 1. Data from Figure 2—figure supplement 1.

    Panel H,O experimental data.

    Figure 3—source data 1. Data from Figure 3.

    Panel C,L,M experimental data.

    Figure 3—figure supplement 1—source data 1. Data from Figure 3—figure supplement 1.

    Panel D,E,F,G experimental data.

    Figure 3—figure supplement 2—source data 1. Data from Figure 3—figure supplement 2.

    Panel A,J,K,L experimental data.

    Figure 4—source data 1. Data from Figure 4.

    Panel E,F experimental data.

    Figure 5—source data 1. Data from Figure 5.

    Panel I,J experimental data.

    Figure 6—source data 1. Data from Figure 6.

    Panel F,I,J experimental data.

    Figure 6—figure supplement 1—source data 1. Data from Figure 6—figure supplement 1.

    Panel A experimental data.

    Figure 7—source data 1. Data from Figure 7.

    Panel F,G experimental data.

    Figure 7—figure supplement 1—source data 1. Data from Figure 7—figure supplement 1.

    Panel C,G experimental data.

    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided in a separate Excel File.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES